M1_R1
#Claire's M1_R1
!head /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq
@HWI-ST700693:373:C39EMACXX:4:1101:15213:2222 TTTTAATAAGAATTATTGATAAAGAAGTATTTGTATATGTTTGAATTGGTTTATTTTGTTTTTTTTTGAAATGATA + 4:BD42243323<EGHJJIJIJJJIJJHJIJJJIJJIIJIJIIHGIIJJFHEFGHIGIIJJJJJJHFEECCCA@C# @HWI-ST700693:373:C39EMACXX:4:1101:15748:2215 AAATATGTAATTATTGTTATTGTGAATTATTGAAAGATTTTGTTTGAATAGTATTGTATTAGTAGCGGAATAATTT + 1:?D44223333<EHIIJIJJJIJIJJJJJJJGIJJJJJJJJFHIJHIHIJHIIJIJJJJJJIJIEIJGHHHHIJC @HWI-ST700693:373:C39EMACXX:4:1101:15816:2198 AGGTTAAGGTTTTATTTTCGGTTAAGGTTAAGGTATCGTTTATTTTTTAGAAGTTTTAGTTTTGATAGTAGTAGTT
!wc /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq
33188808 33188808 1680104182 /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq
!grep -c "@HWI" /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq
8297202
#Steven's M1_R1
!head /Volumes/web/cnidarian/BiGo_larvae_merge/CgM1_R1a.fastq
@HWI-ST700693:351:D2CA8ACXX:7:1101:1686:2216 AAAAAAGTATTTAAAATGGTTTTTGTTTTAGAATGAAAAAAAAAATTGATATGTTTAAGATAAGGGATGAATTTGA + B@@FFFFBFHHHHJJJJJJFHIJJJIJJJIIIJJJJJJJJJIJJHHHC@DDFFFDEECA>ACCDDD?CDDDEEDDC @HWI-ST700693:351:D2CA8ACXX:7:1101:2200:2105 TTTAATATAAATTATATATAAAATTGTTTGAGGTAAAGAAAAAATATTAGTTAATATTTAATATATTGTGTTAGTT + BBCFDFFFHHHHHJJJJJJJJJJJJJJJJHEHIAFGCHIIJIJJJJJJJJIJJJIIJJJJJJIJJJJJGIIHJJGB @HWI-ST700693:351:D2CA8ACXX:7:1101:2596:2201 GATTTTTTATTTTTAATTTAATTAATATGGTTATTTAAAAATGGGTTGAATTTGTTTGATGAGAGGGGAGATAGGT
!wc /Volumes/web/cnidarian/BiGo_larvae_merge/CgM1_R1a.fastq
33188808 33188808 1680104182 /Volumes/web/cnidarian/BiGo_larvae_merge/CgM1_R1a.fastq
!grep -c "@HWI" /Volumes/web/cnidarian/BiGo_larvae_merge/CgM1_R1a.fastq
8297202
!wc /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq
29402580 29402580 1488447849 /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq
!wc /Volumes/web/cnidarian/BiGo_larvae_merge/CgT3D5_R1a.fastq
29402580 29402580 1488447849 /Volumes/web/cnidarian/BiGo_larvae_merge/CgT3D5_R1a.fastq
!grep -c "@HWI" /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq
7350645
!grep -c "@HWI" /Volumes/web/cnidarian/BiGo_larvae_merge/CgT3D5_R1a.fastq
7350645
!/Users/sr320/galaxy-dist/tools/fastq/fastq_trimmer.py
/bin/sh: /Users/sr320/galaxy-dist/tools/fastq/fastq_trimmer.py: Permission denied
!/Volumes/Bay3/Software/bin/fastx_clipper -h
usage: fastx_clipper [-h] [-a ADAPTER] [-D] [-l N] [-n] [-d N] [-c] [-C] [-o] [-v] [-z] [-i INFILE] [-o OUTFILE] Part of FASTX Toolkit 0.0.13 by A. Gordon (gordon@cshl.edu) [-h] = This helpful help screen. [-a ADAPTER] = ADAPTER string. default is CCTTAAGG (dummy adapter). [-l N] = discard sequences shorter than N nucleotides. default is 5. [-d N] = Keep the adapter and N bases after it. (using '-d 0' is the same as not using '-d' at all. which is the default). [-c] = Discard non-clipped sequences (i.e. - keep only sequences which contained the adapter). [-C] = Discard clipped sequences (i.e. - keep only sequences which did not contained the adapter). [-k] = Report Adapter-Only sequences. [-n] = keep sequences with unknown (N) nucleotides. default is to discard such sequences. [-v] = Verbose - report number of sequences. If [-o] is specified, report will be printed to STDOUT. If [-o] is not specified (and output goes to STDOUT), report will be printed to STDERR. [-z] = Compress output with GZIP. [-D] = DEBUG output. [-M N] = require minimum adapter alignment length of N. If less than N nucleotides aligned with the adapter - don't clip it. [-i INFILE] = FASTA/Q input file. default is STDIN. [-o OUTFILE] = FASTA/Q output file. default is STDOUT.
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-clipper
usage: fastq-clipper [options] <fastq-file> <adapters> Removes one or more adapter sequences from the fastq file. Adapter sequences are colon-delimited. Stats go to stderr, unless -o is specified. Options: -h This help -o FIL Output file (stats to stdout) -p N Maximum difference percentage (10) -m N Minimum clip length (1) -l N Minimum remaining sequence length (15) -x [N] Extra match length past adapter length, N =-1 : search all N = 0 : search only up to adapter length -e End-of-line (default) -b Beginning-of-line (not supported yet)
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf -o /Volumes/web/cnidarian/test_adp /Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt /Volumes/web/cnidarian/BiGo_larvae_merge/CgT3D5_R1a.fastq
!wc /Volumes/web/cnidarian/BiGo_larvae_merge/CgT3D5_R1a.fastq
29402580 29402580 1488447849 /Volumes/web/cnidarian/BiGo_larvae_merge/CgT3D5_R1a.fastq
!wc /Volumes/web/cnidarian/test_adp
28807196 28807196 1439780747 /Volumes/web/cnidarian/test_adp
post
pre
!ls /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/
F_R1.fastq M3_R1.fastq T1D5_R1.fastq T3D5_R1.fastq M1_R1.fastq T1D3_R1.fastq T3D3_R1.fastq
!ls /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2
F_R2.fastq M3_R2.fastq T1D5_R2.fastq T3D5_R2.fastq M1_R2.fastq T1D3_R2.fastq T3D3_R2.fastq
#variables
lib="M1"
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf \
-o /Volumes/web/cnidarian/mcf_{lib}_R1.fastq \
-o /Volumes/web/cnidarian/mcf_{lib}_R2.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/{lib}_R1.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/{lib}_R2.fastq
Scale used: 2.2 Phred: 33 Within-read Skew: Position 14 from the start of reads is skewed! Within-read Skew: Position 16 from the start of reads is skewed! Within-read Skew: Position 17 from the start of reads is skewed! Within-read Skew: Position 18 from the start of reads is skewed! Within-read Skew: Position 19 from the start of reads is skewed! Within-read Skew: Position 20 from the start of reads is skewed! Within-read Skew: Position 21 from the start of reads is skewed! Within-read Skew: Position 22 from the start of reads is skewed! Within-read Skew: Position 23 from the start of reads is skewed! Within-read Skew: Position 24 from the start of reads is skewed! Within-read Skew: Position 25 from the start of reads is skewed! Within-read Skew: Position 26 from the start of reads is skewed! Within-read Skew: Position 27 from the start of reads is skewed! Within-read Skew: Position 28 from the start of reads is skewed! Within-read Skew: Position 29 from the start of reads is skewed! Within-read Skew: Position 30 from the start of reads is skewed! Within-read Skew: Position 31 from the start of reads is skewed! Within-read Skew: Position 32 from the start of reads is skewed! Within-read Skew: Position 33 from the start of reads is skewed! Within-read Skew: Position 34 from the start of reads is skewed! Within-read Skew: Position 35 from the start of reads is skewed! Within-read Skew: Position 36 from the start of reads is skewed! Within-read Skew: Position 37 from the start of reads is skewed! Within-read Skew: Position 17 from the end of reads is skewed! Within-read Skew: Position 18 from the end of reads is skewed! Within-read Skew: Position 20 from the end of reads is skewed! Within-read Skew: Position 21 from the end of reads is skewed! Within-read Skew: Position 23 from the end of reads is skewed! Within-read Skew: Position 24 from the end of reads is skewed! Within-read Skew: Position 27 from the end of reads is skewed! Within-read Skew: Position 28 from the end of reads is skewed! Within-read Skew: Position 29 from the end of reads is skewed! Within-read Skew: Position 30 from the end of reads is skewed! Within-read Skew: Position 31 from the end of reads is skewed! Within-read Skew: Position 32 from the end of reads is skewed! Within-read Skew: Position 33 from the end of reads is skewed! Within-read Skew: Position 34 from the end of reads is skewed! Within-read Skew: Position 35 from the end of reads is skewed! Within-read Skew: Position 36 from the end of reads is skewed! Within-read Skew: Position 37 from the end of reads is skewed! Warning: Too much skewing found (76), disabling skew clipping Threshold used: 751 out of 300000 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1699 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1672 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2720 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 1933 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2136 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 6 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1699 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 6 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1672 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2720 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 6822 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG): counted 5154 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq', clip set to 5 Files: 2 Total reads: 8297202 Too short after clip: 273559 Clipped 'start' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq): Count 19291, Mean: 6.69, Sd: 8.01 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq): Count 162366, Mean: 18.88, Sd: 14.83 Trimmed 749148 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M1_R1.fastq) by an average of 11.48 bases on quality < 7 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq): Count 158664, Mean: 17.93, Sd: 13.92 Trimmed 4912567 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M1_R2.fastq) by an average of 10.92 bases on quality < 7
#variables
lib="M3"
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf \
-o /Volumes/web/cnidarian/mcf_{lib}_R1.fastq \
-o /Volumes/web/cnidarian/mcf_{lib}_R2.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/{lib}_R1.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/{lib}_R2.fastq
Scale used: 2.2 Phred: 33 Warning: Too much skewing found (76), disabling skew clipping Threshold used: 751 out of 300000 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1816 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2878 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2880 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3177 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 6 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1816 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2878 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 5462 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG): counted 3237 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq', clip set to 5 Files: 2 Total reads: 8078115 Too short after clip: 210991 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq): Count 202159, Mean: 18.74, Sd: 14.05 Trimmed 680382 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/M3_R1.fastq) by an average of 11.74 bases on quality < 7 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq): Count 205913, Mean: 16.97, Sd: 13.53 Trimmed 4893990 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/M3_R2.fastq) by an average of 10.93 bases on quality < 7
#variables
lib="T1D3"
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf \
-o /Volumes/web/cnidarian/mcf_{lib}_R1.fastq \
-o /Volumes/web/cnidarian/mcf_{lib}_R2.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/{lib}_R1.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/{lib}_R2.fastq
Scale used: 2.2 Phred: 33 Within-read Skew: Position 4 from the start of reads is skewed! Within-read Skew: Position 5 from the start of reads is skewed! Within-read Skew: Position 6 from the start of reads is skewed! Within-read Skew: Position 7 from the start of reads is skewed! Within-read Skew: Position 8 from the start of reads is skewed! Within-read Skew: Position 9 from the start of reads is skewed! Within-read Skew: Position 10 from the start of reads is skewed! Within-read Skew: Position 12 from the start of reads is skewed! Within-read Skew: Position 14 from the start of reads is skewed! Within-read Skew: Position 16 from the start of reads is skewed! Within-read Skew: Position 17 from the start of reads is skewed! Within-read Skew: Position 19 from the start of reads is skewed! Within-read Skew: Position 20 from the start of reads is skewed! Within-read Skew: Position 21 from the start of reads is skewed! Within-read Skew: Position 22 from the start of reads is skewed! Within-read Skew: Position 24 from the start of reads is skewed! Within-read Skew: Position 27 from the start of reads is skewed! Within-read Skew: Position 28 from the start of reads is skewed! Within-read Skew: Position 29 from the start of reads is skewed! Within-read Skew: Position 31 from the start of reads is skewed! Within-read Skew: Position 33 from the start of reads is skewed! Within-read Skew: Position 34 from the start of reads is skewed! Within-read Skew: Position 35 from the start of reads is skewed! Within-read Skew: Position 17 from the end of reads is skewed! Within-read Skew: Position 18 from the end of reads is skewed! Within-read Skew: Position 20 from the end of reads is skewed! Within-read Skew: Position 21 from the end of reads is skewed! Within-read Skew: Position 23 from the end of reads is skewed! Within-read Skew: Position 24 from the end of reads is skewed! Within-read Skew: Position 27 from the end of reads is skewed! Within-read Skew: Position 28 from the end of reads is skewed! Within-read Skew: Position 29 from the end of reads is skewed! Within-read Skew: Position 30 from the end of reads is skewed! Within-read Skew: Position 31 from the end of reads is skewed! Within-read Skew: Position 33 from the end of reads is skewed! Within-read Skew: Position 35 from the end of reads is skewed! Within-read Skew: Position 36 from the end of reads is skewed! Within-read Skew: Position 37 from the end of reads is skewed! Within-read Skew: Position 1 from the end of reads is skewed! Within-read Skew: Position 2 from the end of reads is skewed! Within-read Skew: Position 3 from the end of reads is skewed! Within-read Skew: Position 4 from the end of reads is skewed! Within-read Skew: Position 5 from the end of reads is skewed! Within-read Skew: Position 6 from the end of reads is skewed! Within-read Skew: Position 7 from the end of reads is skewed! Within-read Skew: Position 8 from the end of reads is skewed! Within-read Skew: Position 9 from the end of reads is skewed! Within-read Skew: Position 10 from the end of reads is skewed! Within-read Skew: Position 11 from the end of reads is skewed! Within-read Skew: Position 12 from the end of reads is skewed! Within-read Skew: Position 13 from the end of reads is skewed! Within-read Skew: Position 14 from the end of reads is skewed! Within-read Skew: Position 15 from the end of reads is skewed! Within-read Skew: Position 16 from the end of reads is skewed! Within-read Skew: Position 17 from the end of reads is skewed! Within-read Skew: Position 18 from the end of reads is skewed! Within-read Skew: Position 19 from the end of reads is skewed! Within-read Skew: Position 20 from the end of reads is skewed! Within-read Skew: Position 21 from the end of reads is skewed! Within-read Skew: Position 22 from the end of reads is skewed! Within-read Skew: Position 23 from the end of reads is skewed! Within-read Skew: Position 24 from the end of reads is skewed! Within-read Skew: Position 25 from the end of reads is skewed! Within-read Skew: Position 26 from the end of reads is skewed! Within-read Skew: Position 27 from the end of reads is skewed! Within-read Skew: Position 28 from the end of reads is skewed! Within-read Skew: Position 29 from the end of reads is skewed! Within-read Skew: Position 30 from the end of reads is skewed! Within-read Skew: Position 31 from the end of reads is skewed! Within-read Skew: Position 32 from the end of reads is skewed! Within-read Skew: Position 33 from the end of reads is skewed! Within-read Skew: Position 34 from the end of reads is skewed! Within-read Skew: Position 35 from the end of reads is skewed! Within-read Skew: Position 36 from the end of reads is skewed! Within-read Skew: Position 37 from the end of reads is skewed! Trim 'start': 3 from /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq Trim 'end': 16 from /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq Trim 'start': 38 from /Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq Threshold used: 751 out of 300000 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1581 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1542 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2560 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 3898 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 4300 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1581 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 6 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1542 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2560 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 9162 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG): counted 4411 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq', clip set to 5 Files: 2 Total reads: 5465974 Too short after clip: 449574 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq): Count 166326, Mean: 16.63, Sd: 12.16 Trimmed 113807 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D3_R1.fastq) by an average of 17.38 bases on quality < 7 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq): Count 100612, Mean: 10.09, Sd: 3.88 Trimmed 2999841 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D3_R2.fastq) by an average of 11.91 bases on quality < 7
#variables
lib="T1D5"
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf \
-o /Volumes/web/cnidarian/mcf_{lib}_R1.fastq \
-o /Volumes/web/cnidarian/mcf_{lib}_R2.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/{lib}_R1.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/{lib}_R2.fastq
Scale used: 2.2 Phred: 33 Warning: Too much skewing found (76), disabling skew clipping Threshold used: 751 out of 300000 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1107 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 7 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1081 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 7 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 1910 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2562 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2851 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1107 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 7 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1081 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 7 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 1910 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 4607 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG): counted 2948 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq', clip set to 5 Files: 2 Total reads: 6327160 Too short after clip: 147886 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq): Count 143711, Mean: 17.70, Sd: 12.45 Trimmed 614930 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T1D5_R1.fastq) by an average of 11.55 bases on quality < 7 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq): Count 136939, Mean: 17.47, Sd: 12.21 Trimmed 2554684 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T1D5_R2.fastq) by an average of 11.73 bases on quality < 7
#variables
lib="T3D3"
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf \
-o /Volumes/web/cnidarian/mcf_{lib}_R1.fastq \
-o /Volumes/web/cnidarian/mcf_{lib}_R2.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/{lib}_R1.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/{lib}_R2.fastq
Scale used: 2.2 Phred: 33 Within-read Skew: Position 4 from the start of reads is skewed! Within-read Skew: Position 5 from the start of reads is skewed! Within-read Skew: Position 6 from the start of reads is skewed! Within-read Skew: Position 7 from the start of reads is skewed! Within-read Skew: Position 8 from the start of reads is skewed! Within-read Skew: Position 9 from the start of reads is skewed! Within-read Skew: Position 10 from the start of reads is skewed! Within-read Skew: Position 12 from the start of reads is skewed! Within-read Skew: Position 14 from the start of reads is skewed! Within-read Skew: Position 16 from the start of reads is skewed! Within-read Skew: Position 17 from the start of reads is skewed! Within-read Skew: Position 19 from the start of reads is skewed! Within-read Skew: Position 20 from the start of reads is skewed! Within-read Skew: Position 21 from the start of reads is skewed! Within-read Skew: Position 22 from the start of reads is skewed! Within-read Skew: Position 24 from the start of reads is skewed! Within-read Skew: Position 27 from the start of reads is skewed! Within-read Skew: Position 28 from the start of reads is skewed! Within-read Skew: Position 29 from the start of reads is skewed! Within-read Skew: Position 31 from the start of reads is skewed! Within-read Skew: Position 33 from the start of reads is skewed! Within-read Skew: Position 36 from the start of reads is skewed! Within-read Skew: Position 37 from the start of reads is skewed! Within-read Skew: Position 17 from the end of reads is skewed! Within-read Skew: Position 18 from the end of reads is skewed! Within-read Skew: Position 20 from the end of reads is skewed! Within-read Skew: Position 21 from the end of reads is skewed! Within-read Skew: Position 23 from the end of reads is skewed! Within-read Skew: Position 24 from the end of reads is skewed! Within-read Skew: Position 27 from the end of reads is skewed! Within-read Skew: Position 28 from the end of reads is skewed! Within-read Skew: Position 29 from the end of reads is skewed! Within-read Skew: Position 30 from the end of reads is skewed! Within-read Skew: Position 31 from the end of reads is skewed! Within-read Skew: Position 33 from the end of reads is skewed! Within-read Skew: Position 35 from the end of reads is skewed! Within-read Skew: Position 36 from the end of reads is skewed! Within-read Skew: Position 37 from the end of reads is skewed! Within-read Skew: Position 27 from the end of reads is skewed! Within-read Skew: Position 28 from the end of reads is skewed! Within-read Skew: Position 29 from the end of reads is skewed! Within-read Skew: Position 30 from the end of reads is skewed! Within-read Skew: Position 31 from the end of reads is skewed! Within-read Skew: Position 32 from the end of reads is skewed! Within-read Skew: Position 33 from the end of reads is skewed! Within-read Skew: Position 34 from the end of reads is skewed! Within-read Skew: Position 35 from the end of reads is skewed! Within-read Skew: Position 36 from the end of reads is skewed! Within-read Skew: Position 37 from the end of reads is skewed! Warning: Too much skewing found (64), disabling skew clipping Threshold used: 751 out of 300000 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1409 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1371 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2497 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 6934 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2903 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 3169 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 5 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1409 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 6 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1371 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2497 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 6934 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 9568 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG): counted 6933 at the 'start' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq', clip set to 4 Files: 2 Total reads: 7380649 Too short after clip: 270860 Clipped 'start' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq): Count 112025, Mean: 4.65, Sd: 4.54 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq): Count 164426, Mean: 16.65, Sd: 13.80 Trimmed 647629 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D3_R1.fastq) by an average of 10.89 bases on quality < 7 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq): Count 144073, Mean: 17.36, Sd: 13.18 Trimmed 5076848 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D3_R2.fastq) by an average of 10.78 bases on quality < 7
#variables
lib="T3D5"
!/Volumes/Bay3/Software/ea-utils.1.1.2-537/fastq-mcf \
-o /Volumes/web/cnidarian/mcf_{lib}_R1.fastq \
-o /Volumes/web/cnidarian/mcf_{lib}_R2.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Adapters_LarvaeSequencingFiles.txt \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/{lib}_R1.fastq \
/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/{lib}_R2.fastq
Scale used: 2.2 Phred: 33 Warning: Too much skewing found (76), disabling skew clipping Threshold used: 751 out of 300000 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1606 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1591 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2720 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 5 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (98% over 50bp) (ATCGGAAGAGCGTCGTGTAGGGAAAGAGGGTAGATCTCGGTGGTCGCCGT): counted 2408 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter Illumina Single End PCR Primer 1 (100% over 50bp) (GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG): counted 2631 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 6 Adapter No Hit (AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG): counted 1606 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter No Hit (GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA): counted 1591 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 3 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter No Hit (TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC): counted 2720 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq', clip set to 5 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 6 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 4 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 5 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 7 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Adapter TruSeq Adapter, Index 8 (100% over 50bp) (ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC): counted 6629 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 4 Adapter TruSeq Adapter, Index 9 (100% over 50bp) (GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG): counted 2626 at the 'end' of '/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq', clip set to 6 Files: 2 Total reads: 7350645 Too short after clip: 224845 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq): Count 171219, Mean: 18.47, Sd: 13.89 Trimmed 683973 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R1/T3D5_R1.fastq) by an average of 11.34 bases on quality < 7 Clipped 'end' reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq): Count 164649, Mean: 17.84, Sd: 13.46 Trimmed 3969240 reads (/Volumes/web/Mollusk/bs_larvae_exp/Concatenated_Files_R2/T3D5_R2.fastq) by an average of 11.14 bases on quality < 7