Cookbook: Merging samples or Assemblies

ipyrad is designed to allow you to work with your samples in a very modular way. Meaning you can easily split your Assembly objects to group different samples into different runs that apply different parameter settings, and then you can merge them back together later. Similarly, with ipyrad you can easily merge multiple samples into a single sample, which may be useful when you include technical replicates in your sequencing lanes, or sequence an individual on multiple lanes.

In [1]:
import ipyrad as ip

Merging assemblies

This will combine all samples from the two assemblies into a single assembly. If some samples have the same name in both assemblies they will be merged into one sample in the merged assembly.

In [2]:
# demux first lane of data
data1 = ip.Assembly("data1")
data1.params.raw_fastq_path = "./ipsimdata/pairddrad_example_R*.gz"
data1.params.barcodes_path = "./ipsimdata/pairddrad_example_barcodes.txt"
data1.params.assembly_method = "reference"
data1.params.reference_sequence = "./ipsimdata/pairddrad_example_genome.fa"
data1.params.datatype = "pairddrad"
data1.run('1', force=True, launch_client=True)

# demux second lane of data
data2 = ip.Assembly("data2")
data2.params.raw_fastq_path = "./ipsimdata/pairddrad_example_R*.gz"
data2.params.barcodes_path = "./ipsimdata/pairddrad_example_barcodes.txt"
data2.params.assembly_method = "reference"
data2.params.reference_sequence = "./ipsimdata/pairddrad_example_genome.fa"
data2.params.datatype = "pairddrad"
data2.run('1', force=True, launch_client=True)

# merge assemblies
mdata = ip.merge("alldata", [data1, data2])
mdata.run("234567", force=True, launch_client=True)
New Assembly: data1
establishing parallel connection:
Assembly: data1
[####################] 100% 0:00:06 | sorting reads        | s1 |
[####################] 100% 0:00:01 | writing/compressing  | s1 |
New Assembly: data2
establishing parallel connection:
Assembly: data2
[####################] 100% 0:00:05 | sorting reads        | s1 |
[####################] 100% 0:00:01 | writing/compressing  | s1 |
New Assembly: alldata
establishing parallel connection:
Assembly: alldata
[####################] 100% 0:00:01 | concatenating inputs | s2 |
[####################] 100% 0:00:08 | processing reads     | s2 |
[####################] 100% 0:00:00 | indexing reference   | s3 |
[####################] 100% 0:00:00 | concatenating        | s3 |
[####################] 100% 0:00:03 | join unmerged pairs  | s3 |
[####################] 100% 0:00:03 | dereplicating        | s3 |
[####################] 100% 0:00:00 | splitting dereps     | s3 |
[####################] 100% 0:00:04 | mapping reads        | s3 |
[####################] 100% 0:00:06 | building clusters    | s3 |
[####################] 100% 0:00:00 | calc cluster stats   | s3 |
[####################] 100% 0:00:03 | inferring [H, E]     | s4 |
[####################] 100% 0:00:00 | calculating depths   | s5 |
[####################] 100% 0:00:00 | chunking clusters    | s5 |
[####################] 100% 0:00:21 | consens calling      | s5 |
[####################] 100% 0:00:02 | indexing alleles     | s5 |
[####################] 100% 0:00:00 | concatenating bams   | s6 |
[####################] 100% 0:00:00 | fetching regions     | s6 |
[####################] 100% 0:00:00 | building loci        | s6 |
[####################] 100% 0:00:03 | applying filters     | s7 |
[####################] 100% 0:00:02 | building arrays      | s7 |
[####################] 100% 0:00:00 | writing conversions  | s7 |
[####################] 100% 0:00:01 | indexing vcf depths  | s7 |
[####################] 100% 0:00:01 | writing vcf output   | s7 |

Merge samples

Sometimes you may wish to merge samples within an Assembly. This can be done like below.

In [2]:
# demux first lane of data
data1 = ip.Assembly("data1")
data1.params.raw_fastq_path = "./ipsimdata/rad_example_R1_.fastq.gz"
data1.params.barcodes_path = "./ipsimdata/rad_example_barcodes.txt"
data1.run('1', force=True, launch_client=True)
New Assembly: data1
establishing parallel connection:
Assembly: data1
[####################] 100% 0:00:04 | sorting reads        | s1 |
[####################] 100% 0:00:01 | writing/compressing  | s1 |
In [3]:
# the rename dictionary is applied during merge
mergedict = {
    "1A_0": "A", 
    "1B_0": "A", 
    "1C_0": "A",
    "1D_0": "D",
}
merged = ip.merge("merged", data1, rename_dict=mergedict)
merged.run("234567", force=True, launch_client=True)
merged.stats
New Assembly: merged
establishing parallel connection:
Assembly: merged
[####################] 100% 0:00:00 | concatenating inputs | s2 |
[####################] 100% 0:00:03 | processing reads     | s2 |
[####################] 100% 0:00:00 | concatenating        | s3 |
[####################] 100% 0:00:02 | dereplicating        | s3 |
[####################] 100% 0:00:01 | clustering/mapping   | s3 |
[####################] 100% 0:00:00 | building clusters    | s3 |
[####################] 100% 0:00:00 | chunking clusters    | s3 |
[####################] 100% 0:00:07 | aligning clusters    | s3 |
[####################] 100% 0:00:00 | concat clusters      | s3 |
[####################] 100% 0:00:00 | calc cluster stats   | s3 |
[####################] 100% 0:00:03 | inferring [H, E]     | s4 |
[####################] 100% 0:00:00 | calculating depths   | s5 |
[####################] 100% 0:00:00 | chunking clusters    | s5 |
[####################] 100% 0:00:10 | consens calling      | s5 |
[####################] 100% 0:00:00 | indexing alleles     | s5 |
[####################] 100% 0:00:00 | concatenating inputs | s6 |
[####################] 100% 0:00:00 | clustering across    | s6 |
[####################] 100% 0:00:00 | building clusters    | s6 |
[####################] 100% 0:00:08 | aligning clusters    | s6 |
[####################] 100% 0:00:02 | applying filters     | s7 |
[####################] 100% 0:00:02 | building arrays      | s7 |
[####################] 100% 0:00:00 | writing conversions  | s7 |
[####################] 100% 0:00:00 | indexing vcf depths  | s7 |
[####################] 100% 0:00:01 | writing vcf output   | s7 |
Out[3]:
state reads_raw reads_passed_filter clusters_total clusters_hidepth hetero_est error_est reads_consens
2E_0 6 20017 20017 1000 1000 0.001830 0.000766 1000
2F_0 6 19933 19933 1000 1000 0.001996 0.000755 1000
2G_0 6 20030 20030 1000 1000 0.001940 0.000763 1000
2H_0 6 20199 20199 1000 1000 0.001747 0.000756 1000
3I_0 6 19885 19885 1000 1000 0.001807 0.000758 1000
3J_0 6 19822 19822 1000 1000 0.001931 0.000776 1000
3K_0 6 19965 19965 1000 1000 0.002092 0.000766 1000
3L_0 6 20008 20008 1000 1000 0.002042 0.000748 1000
A 6 60041 60041 1000 1000 0.009826 0.000833 1000
D 6 19966 19966 1000 1000 0.001803 0.000761 1000
In [104]:
from ipyrad.assemble.write_outputs import *
import ipyparallel as ipp
ipyclient = ipp.Client()
step = Step7(merged, True, ipyclient)
In [105]:
step.split_clusters()
step.remote_process_chunks()
step.collect_stats()
step.store_file_handles()
step.remote_build_arrays_and_write_loci()
step.remote_write_outfiles()
[####################] 100% 0:00:03 | applying filters     | s7 |
[####################] 100% 0:00:01 | building arrays      | s7 |
[####################] 100% 0:00:00 | writing conversions  | s7 |
In [106]:
step.remote_fill_depths()
[####################] 100% 0:00:00 | indexing vcf depths  | s7 |
In [107]:
step.remote_build_vcf()
[####################] 100% 0:00:01 | writing vcf output   | s7 |
In [91]:
filler.snpsmap[filler.snpsmap[:, 0] == 2]
Out[91]:
array([[ 2,  1],
       [ 2, 74],
       [ 2, 84]], dtype=uint32)
In [ ]:

In [102]:
#step.remote_fill_depths()

sample = step.data.samples["D"]
filler = VCF_filler(step.data, step.nsnps, sample)

# run function loop
for idx in range(len(filler.locbits)):
    filler.localidx = 0
    
    # locfill function
    edges = np.load(filler.trimbits[idx])
    inds = filler.indbits[idx]
    filler.loclines = iter(open(filler.locbits[idx], 'r'))
    
    while 1:
        try:
            filler.yield_loc()
        except StopIteration:
            break

        filler.locsnps = filler.snpsmap[filler.snpsmap[:, 0] == filler.locidx]
        filler.gtrim = edges[filler.localidx - 1]
        
        # denovo enter catgs func
        if (filler.locsnps.size) and (filler.sname in filler.names):
            nidx = filler.names.index(filler.sname)
            sidx = filler.sidxs[nidx]
            tups = [[int(j) for j in i.split("-")] for i in sidx.split(":")]
            seq = filler.seqs[nidx]
            seqarr = np.array(list(seq))

            print('idx', idx, 'locidx', filler.locidx - 1)

            for snp in filler.locsnps[:, 1]:
                print(snp, seq[snp])
                ishift = seq[:snp].count('-')
                for tup in tups:
                    cidx, coffset = tup
                    pos = snp + (coffset) - ishift            
                    print(pos, (snp, filler.gtrim, coffset, ishift))
                    print(filler.catgs[cidx, pos])
                    if (pos >= 0) & (pos < filler.maxlen):
                        filler.vcfd[filler.snpidx] += filler.catgs[cidx, pos]

                filler.snpidx += 1
            print(seq)
            print("")
        
        else:
            print("NOT HERE")
            filler.snpidx += filler.locsnps.shape[0]
idx 0 locidx 0
10 G
15 (10, 5, 5, 0)
[ 0  0  0 22]
ACTCTCAGGCGTACGATTCGGTACAAGTGTTTTGCTCGTTGGTTGCTTTGACAAACGACGGTATAGCAACGACGAATCATAAGTGT

idx 0 locidx 1
1 G
6 (1, 5, 5, 0)
[ 0  0  0 17]
74 T
79 (74, 5, 5, 0)
[ 0  0 17  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 17]
GGATTTGGGTCTGGACGGAGCCAGTTAGTTAAAGTCCGTGCCCCCACGGAATAACGGTAAAATATACAAAACATTAAAGCACTTGG

idx 0 locidx 2
21 T
26 (21, 5, 5, 0)
[ 0  0 18  0]
47 C
52 (47, 5, 5, 0)
[18  0  0  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 18  0]
ATAAGGGTCTCTTCTAGCAAATCGGCGTGCGCTGATCCTGGAATGTCCGGTTGAAGATATGATTACAGTACAGCGTGCGGCGCTAA

idx 0 locidx 3
13 C
18 (13, 5, 5, 0)
[19  0  0  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 19]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 19]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 19]
54 C
59 (54, 5, 5, 0)
[19  0  0  0]
60 A
65 (60, 5, 5, 0)
[ 0 19  0  0]
TTACTAAGTGGTTCAAGTGGTTACTGAAGGGATAAGAGACGGGGTCGGAGGCCTCCTGAAATGGGCGGAAAGCTCTCTAACAGGAA

idx 0 locidx 4
42 G
47 (42, 5, 5, 0)
[ 0  0  0 15]
46 A
51 (46, 5, 5, 0)
[ 0 15  0  0]
55 A
60 (55, 5, 5, 0)
[ 0 15  0  0]
61 C
66 (61, 5, 5, 0)
[15  0  0  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 15  0]
64 C
69 (64, 5, 5, 0)
[15  0  0  0]
GTATAACTGAGCGGTGCGCACGAACAGACCTAGAGTTAGACTGAGAAGAAGCACAAGTACTCTTCCAAAGCCGGGGAGGGCCTGCA

idx 0 locidx 5
12 C
17 (12, 5, 5, 0)
[19  0  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 19  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 19  0]
67 T
72 (67, 5, 5, 0)
[ 0  0 19  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 19]
72 A
77 (72, 5, 5, 0)
[ 0 19  0  0]
TTATTTAGTATTCAGATCGCGCAACAATCGAGGGTAAATTTCTTCATGCGCCATGCAACGCCCGTATTGCCAAAAGGTGCCGCGAT

idx 0 locidx 6
18 C
23 (18, 5, 5, 0)
[20  0  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 20]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 20]
AGGAGGCCCGTTGCTCCCCCGACAGGATCGTCGTAGCAGAACCTATAACCCCCGCTCACTCTATTTGGCGTACTTGAAGCTTGCCC

idx 0 locidx 7
26 T
31 (26, 5, 5, 0)
[ 0  0 22  0]
GGTAAGAACCTCACTGAGAGATTATATCCTTTAAGGGGATGATACTCCTGGAGCACACACGGTGCTACGATCGTCTCAAACACGTC

idx 0 locidx 8
14 A
19 (14, 5, 5, 0)
[ 0 21  0  0]
66 C
71 (66, 5, 5, 0)
[21  0  0  0]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 21]
GCGTCGGGAAGGGCATTCTGGAGGACCAGCGATCTAGGCCCGTCGCGTTCCAATACTAGGCACACGCAGGGTACTCAGCAGCACCA

idx 0 locidx 9
18 G
23 (18, 5, 5, 0)
[ 0  0  0 24]
24 A
29 (24, 5, 5, 0)
[ 0 24  0  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 24]
TACAAGTTCTCCTATTCCGGCAAAAAGCGGGGCTTAATTCTCGTGTTTCGTCACTGATTCGAGAGCCTAAACTAGTTAAGACTCGC

idx 0 locidx 10
16 G
21 (16, 5, 5, 0)
[ 0  0  0 23]
51 A
56 (51, 5, 5, 0)
[ 0 23  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 23  0]
73 -
78 (73, 5, 5, 0)
[ 0  0 23  0]
77 A
81 (77, 5, 5, 1)
[ 0 23  0  0]
TCATGCCTCGAAGTGCGTTGTCTCCCCCCTCTAGTAGCATTGTAATGGTGCAATTTGATAGTCGTAAATAAAA-TGTAGAGTGGGG

idx 0 locidx 11
18 T
23 (18, 5, 5, 0)
[ 0  0 19  0]
TAAGGCCGGGCATATTAATCCAAACGAAAGAATTCATAAATTCGTTACTCTAGAGTAGGTCAGGTAGATCTTGATCGAGTGGAACA

idx 0 locidx 12
20 A
25 (20, 5, 5, 0)
[ 0 18  0  0]
24 C
29 (24, 5, 5, 0)
[18  0  0  0]
26 A
31 (26, 5, 5, 0)
[ 0 18  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 18  0]
57 C
62 (57, 5, 5, 0)
[18  0  0  0]
ATTACATACCGCAAACGGTTATTCCCAGGCTACTCTCAGTAGGCGTAATACTGGAGTCACTCTTCTGGCATCGCGCCACTGGAGAC

idx 0 locidx 13
16 A
21 (16, 5, 5, 0)
[ 0 20  0  0]
63 C
68 (63, 5, 5, 0)
[20  0  0  0]
75 A
80 (75, 5, 5, 0)
[ 0 20  0  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 20  0]
TAATGGGCTTGTGATGAGAGCCACAGCAGGAGACTTGCGGTGCCGTTCAAGGCCTCGTTCCGTCCTGCACAGCCCACACGTTACTC

idx 0 locidx 14
19 C
24 (19, 5, 5, 0)
[22  0  0  0]
35 A
40 (35, 5, 5, 0)
[ 0 22  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 22  0]
63 A
68 (63, 5, 5, 0)
[ 0 22  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 22  0  0]
79 C
84 (79, 5, 5, 0)
[22  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 22  0]
CGTATAATGATCTTAGTGACCTGACTACTGCGGCCACTGCCGCGTAATGATGGTCCAACTCCAAGCGACAGGTTCAGAACCAATCG

idx 0 locidx 15
18 W
23 (18, 5, 5, 0)
[ 0 10 10  0]
35 A
39 (35, 5, 5, 1)
[ 0 20  0  0]
72 T
76 (72, 5, 5, 1)
[ 0  0 20  0]
78 T
82 (78, 5, 5, 1)
[ 0  0 20  0]
83 G
87 (83, 5, 5, 1)
[ 0  0  0 20]
AACATGAGCATTAAAGTGWATAGAGTATT-CCAACAGTGTGCGTCGATTAAATAAGCACTACTAGCGATGATTATTTATTCGAGCG

idx 0 locidx 16
17 T
22 (17, 5, 5, 0)
[ 0  0 21  0]
50 C
55 (50, 5, 5, 0)
[21  0  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 21]
CCGTTCAAGTGAGTATGTAACAGAACTCAGCAAACACGAGCGCGCTTTCTCAAAGACATGAGCGGAGAGGACACAAGGTCCGCTGA

idx 0 locidx 17
4 A
9 (4, 5, 5, 0)
[ 0 17  0  0]
5 A
10 (5, 5, 5, 0)
[ 0 17  0  0]
10 T
15 (10, 5, 5, 0)
[ 0  0 17  0]
19 C
24 (19, 5, 5, 0)
[17  0  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 17  0]
58 T
63 (58, 5, 5, 0)
[ 0  0 17  0]
AGCTAACATTTTCAAAGTGCGAGGTCTTACCTGTGCAATCACCCTTAGTTCATACCCGTGTCGACATTGCTTCCGCTATAAGGATT

idx 0 locidx 18
15 C
20 (15, 5, 5, 0)
[19  0  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 19  0  0]
GCGATGTACTTAAAACCGTTATTCAGGGGCATCGTTACAATTTACTCCAGTAGCGTCCGTACAACTTGTAAGCCATCGTCTCTGAC

idx 0 locidx 19
1 A
6 (1, 5, 5, 0)
[ 0 17  0  0]
21 A
26 (21, 5, 5, 0)
[ 0 17  0  0]
31 T
36 (31, 5, 5, 0)
[ 0  0 17  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 17  0]
81 T
86 (81, 5, 5, 0)
[ 0  0 17  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 17  0]
GAGATTCACTGGAGGCACGTCAGGTTGATATTGTCTAACGGTGGCCACGTTGCTAATTTTCCCAGATGTTCGTCCATCACTTATAG

idx 0 locidx 20
10 A
15 (10, 5, 5, 0)
[ 0 13  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 13  0]
GGGAGCGATTAGGGCCGTGAACATCTTTCAGGTTCGCGCCCATCTCGGTGTCCGTGTGCTCTGAGTCGACAATGCGATACGCTCTC

idx 0 locidx 21
1 A
6 (1, 5, 5, 0)
[ 0 19  0  0]
6 G
11 (6, 5, 5, 0)
[ 0  0  0 19]
28 C
33 (28, 5, 5, 0)
[19  0  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 19]
AATACGGGACCACAAGGGAAGCTTGCCCCCCTGCGTCATATCCTGGGACCTGGACCCTACTCTGAGCATTCAGTACGTCGCGGGCT

idx 0 locidx 22
17 T
22 (17, 5, 5, 0)
[ 0  0 21  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 21]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 21]
GCACGTATTTTATCGCTTAGTATAGTAGAATCGATACCCGTTCACGCAGTGGACGGCCGACCTTCTCTTGTTCGTTTTGATCCCTG

idx 0 locidx 23
4 G
9 (4, 5, 5, 0)
[ 0  0  0 19]
20 T
25 (20, 5, 5, 0)
[ 0  0 19  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 19]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 19]
84 C
89 (84, 5, 5, 0)
[19  0  0  0]
TATCGATGTCTGATGCGTCCTTACCAGTAAGATTTTCAGGATAGATGCGGATTACGCCAAGCTACAGTAGTAGGGGTCTGCGCTCA

idx 0 locidx 24
62 G
67 (62, 5, 5, 0)
[ 0  0  0 25]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 25]
TAGCAGACGTCCCGATGGAAGGCACACGTACCCCGCTTAGTGAGATTGGCATTAGGACTCTGGATCCGGAGAACTTGACGTTCTGT

idx 0 locidx 25
9 G
14 (9, 5, 5, 0)
[ 0  0  0 23]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 23]
42 T
47 (42, 5, 5, 0)
[ 0  0 23  0]
50 C
55 (50, 5, 5, 0)
[23  0  0  0]
72 C
77 (72, 5, 5, 0)
[23  0  0  0]
CTAGCGTTTGTTCGGCGCATAGCCTCCCATATCACCGAGTGCTCGATGCGCAAGTGGGACACCTCCCCCCTACGCGGCTCATAAAA

idx 0 locidx 26
36 A
41 (36, 5, 5, 0)
[ 0 17  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 17  0  0]
51 C
56 (51, 5, 5, 0)
[17  0  0  0]
57 T
62 (57, 5, 5, 0)
[ 0  0 17  0]
58 C
63 (58, 5, 5, 0)
[17  0  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 17  0  0]
GTAGAGCTCCACGGCCCTTATGCCGGAGGAGGTCTTAATGACCCCCGAGCACGGCCGTCAATCGTTAAACTAAATAACTCACAGAC

idx 0 locidx 27
2 G
7 (2, 5, 5, 0)
[ 0  0  0 18]
TCGGTAATGGTATTAGCACGTCCATTAACCTTTTAAGTTATACGACAGCCAGCGGAGATACAGTCGGAAATGCCCAAATGAAATCG

idx 0 locidx 28
6 C
11 (6, 5, 5, 0)
[21  0  0  0]
20 T
25 (20, 5, 5, 0)
[ 0  0 21  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 21]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 21]
CGCTAACGGACTTATTTTGTTACTAAGGGGTGTCCCAGGCTCTTCTCCTGTAGGTCTGAAGCTTCAATGGGCAATGAAATACTCTT

idx 0 locidx 29
45 G
50 (45, 5, 5, 0)
[ 0  0  0 24]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 24]
82 C
87 (82, 5, 5, 0)
[24  0  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 24]
TATTCACGTTTTACATCCTTCTGTGATTGGAGTAAATTACAGTCTGCCTCGTTGTATAACTGTGCAAAGCCCGCTACACGAACCAG

idx 0 locidx 30
1 G
6 (1, 5, 5, 0)
[ 0  0  0 23]
5 G
10 (5, 5, 5, 0)
[ 0  0  0 23]
36 C
41 (36, 5, 5, 0)
[23  0  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 23  0]
51 T
56 (51, 5, 5, 0)
[ 0  0 23  0]
52 C
57 (52, 5, 5, 0)
[23  0  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 23]
TGTGGGCCGGACCCACGTGCTCAGGGCTGCTCGACGCCATTCCGTAGAAAGTCGTGCCCCAAAGTCCGCGTCGCTTCCTAACCATT

idx 0 locidx 31
16 G
21 (16, 5, 5, 0)
[ 0  0  0 19]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 19]
27 C
32 (27, 5, 5, 0)
[19  0  0  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 19]
61 A
66 (61, 5, 5, 0)
[ 0 19  0  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 19  0]
AGAAGGTAACCAGCTGGCTACCACCGGCGCTCTTCTATTCCTACTAGGGACATCTAAGAAAATCTTCTTGCCGGTCAATTTGTGAT

idx 0 locidx 32
13 T
18 (13, 5, 5, 0)
[ 0  0 20  0]
14 T
19 (14, 5, 5, 0)
[ 0  0 20  0]
19 A
24 (19, 5, 5, 0)
[ 0 20  0  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 20  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 20]
44 C
49 (44, 5, 5, 0)
[20  0  0  0]
46 C
51 (46, 5, 5, 0)
[20  0  0  0]
AGCCACCGTCGAATTAAGTAGGTCTGTATGGGCGAATTGACATTCCCATTACTGCGCCCTAATACCTTTTGCGCAATCAGGGATGA

idx 0 locidx 33
12 R
17 (12, 5, 5, 0)
[ 0 12  0  9]
20 T
25 (20, 5, 5, 0)
[ 0  0 21  0]
22 T
27 (22, 5, 5, 0)
[ 0  0 21  0]
23 A
28 (23, 5, 5, 0)
[ 0 21  0  0]
31 C
36 (31, 5, 5, 0)
[21  0  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 21  0]
50 C
55 (50, 5, 5, 0)
[21  0  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 21  0  0]
AGGAATTACCGCRTTAGCCCTCTACTATATGCATTTATCCGATTAACGCACCTAGAATGACACCCAATTTGGTGCCGTTTCCGGTC

idx 0 locidx 34
26 T
31 (26, 5, 5, 0)
[ 0  0 21  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 21  0]
52 M
57 (52, 5, 5, 0)
[10 11  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 21  0  0]
65 A
70 (65, 5, 5, 0)
[ 0 21  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 21]
CTGAACAAACCGGGGATCGTGTGGGTTGCTCCTTAACTCGGGCTCGGTTCTTMTGCGTAGGCTACACCGATCAAAACCAGGTAGCG

idx 0 locidx 35
20 G
25 (20, 5, 5, 0)
[ 0  0  0 20]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 20]
41 A
46 (41, 5, 5, 0)
[ 0 20  0  0]
48 T
53 (48, 5, 5, 0)
[ 0  0 20  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 20]
72 A
77 (72, 5, 5, 0)
[ 0 20  0  0]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 20]
TGGACGTAGGCATGTGGCAAGCACTACGCACCTACGCCAGAACGCTACTCGCGGGTGTGAAATTACTGTAATACTGGACTATATTC

idx 0 locidx 36
15 A
20 (15, 5, 5, 0)
[ 0 18  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 18  0  0]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 18]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 18]
81 T
86 (81, 5, 5, 0)
[ 0  0 18  0]
AACAAATTGCGCACGACTGCAGAGCCTCTCCACAGGCTGAGCCCTGTGCCATGCTGCACTAAAAGAGTACCGGCGAATCGATCGCA

idx 0 locidx 37
3 T
8 (3, 5, 5, 0)
[ 0  0 18  0]
10 C
15 (10, 5, 5, 0)
[18  0  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 18  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 18]
56 A
61 (56, 5, 5, 0)
[ 0 18  0  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 18]
ACTTGGTAATCGAGATTAATGGAAGGTACGCGGGTCTTATCATGGGAGGCCAGATCACATGAAGTGAGGATGTACTACGAGACCAT

idx 0 locidx 38
1 A
6 (1, 5, 5, 0)
[ 0 21  0  0]
4 T
9 (4, 5, 5, 0)
[ 0  0 21  0]
6 A
11 (6, 5, 5, 0)
[ 0 21  0  0]
66 C
71 (66, 5, 5, 0)
[21  0  0  0]
GACATCATGGGGCAGTCTTCTGACGGCGTCCTGACCGGTATTGCGCAACTAAACTTTGGCCCATTTCAATAACACATGAAGCCCCG

idx 0 locidx 39
14 G
19 (14, 5, 5, 0)
[ 0  0  0 21]
16 G
21 (16, 5, 5, 0)
[ 0  0  0 21]
24 G
29 (24, 5, 5, 0)
[ 0  0  0 21]
39 A
44 (39, 5, 5, 0)
[ 0 21  0  0]
60 A
65 (60, 5, 5, 0)
[ 0 21  0  0]
TTCCGGATCAGGCTGCGCGTTGGGGTGGAATTGGCACGGATCCGTGCGCGGGCTGCAACAATTAGATCCCACTCCGGATCTGCTGG

idx 0 locidx 40
24 C
29 (24, 5, 5, 0)
[20  0  0  0]
32 T
37 (32, 5, 5, 0)
[ 1  0 19  0]
36 A
41 (36, 5, 5, 0)
[ 0 20  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 20  0  0]
56 A
61 (56, 5, 5, 0)
[ 0 20  0  0]
59 A
64 (59, 5, 5, 0)
[ 0 20  0  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 20]
63 C
68 (63, 5, 5, 0)
[20  0  0  0]
TACTAGTCACAACTTCACTGCGTCCCAATAACTGCCAGTACCCAGCCAGTTTAAGTAAGAGGTCTTGGGACAATGGACGAATGGCC

idx 0 locidx 41
1 A
6 (1, 5, 5, 0)
[ 0 18  0  0]
2 T
7 (2, 5, 5, 0)
[ 0  0 18  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 18  0]
59 A
64 (59, 5, 5, 0)
[ 0 18  0  0]
60 C
65 (60, 5, 5, 0)
[18  0  0  0]
71 T
76 (71, 5, 5, 0)
[ 0  0 18  0]
81 A
86 (81, 5, 5, 0)
[ 0 18  0  0]
GATAGATCGGAAAGGAGATGGAGTGGGGCTGTAGAAGGCCCCTAATTGCATAGCTAAGAACAGTTGAAGCATTCATCTACTAAGGT

idx 0 locidx 42
13 C
18 (13, 5, 5, 0)
[17  0  0  0]
16 A
21 (16, 5, 5, 0)
[ 0 17  0  0]
23 A
28 (23, 5, 5, 0)
[ 0 17  0  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 17  0]
73 C
78 (73, 5, 5, 0)
[17  0  0  0]
TTGATTAGAAGAGCATACAGCTCAAGTCCAATGTAGGATGGGGCGTATTAGATGCTACTCCTCCATACACGATCTCTATTGAAGGT

idx 0 locidx 43
3 M
8 (3, 5, 5, 0)
[9 7 0 0]
8 G
13 (8, 5, 5, 0)
[ 0  0  0 16]
17 T
22 (17, 5, 5, 0)
[ 0  0 16  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 16]
32 T
37 (32, 5, 5, 0)
[ 0  0 16  0]
43 A
48 (43, 5, 5, 0)
[ 0 16  0  0]
54 T
59 (54, 5, 5, 0)
[ 0  0 16  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 16  0]
CATMAGTAGCTCGAGCCTGGGGAGGAACCTATTCGGGGGTCTCACCGCCTAACCTGCTCTGATTCAAGAAGTGGCCTATCTCCTTT

idx 0 locidx 44
31 T
36 (31, 5, 5, 0)
[ 0  0 13  0]
33 T
38 (33, 5, 5, 0)
[ 0  0 13  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 13  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 13]
70 C
75 (70, 5, 5, 0)
[12  1  0  0]
84 C
89 (84, 5, 5, 0)
[13  0  0  0]
TAAAAGGCACCCCATAACAGATCATGCCGATTATAGTCAACGACTTAGTCAGTAACTTGCGGTTATGGGTCCACAACAAGATTCCG

idx 0 locidx 45
7 C
12 (7, 5, 5, 0)
[26  0  0  0]
8 T
13 (8, 5, 5, 0)
[ 0  1 25  0]
34 A
39 (34, 5, 5, 0)
[ 0 26  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 26]
40 A
45 (40, 5, 5, 0)
[ 0 26  0  0]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 26]
CGAAAAGCTCCGGGGCGGATCAATCTGTCTGTCGACAGCCATAGGTATGTCAACCCGTCGAAGCATACAGAACACCCATAACTACG

idx 0 locidx 46
31 G
36 (31, 5, 5, 0)
[ 0  0  0 23]
65 T
70 (65, 5, 5, 0)
[ 0  0 23  0]
GACAACGATTTACCCCGCTGATGCGCGCCAAGGCTTATTGTGATTTTCAAGTAAGGTTATAACGTTAGCGCCGCCGTAAGTTTCGC

idx 0 locidx 47
65 A
70 (65, 5, 5, 0)
[ 0 18  0  0]
CTTGGGCAAGAGCAACGTGCCGCTGAGGAGATCAGCTCCTCACCCCCCTTTATCAACCAATTGAGAGACGCGTCCATCGAAACCCC

idx 0 locidx 48
33 G
38 (33, 5, 5, 0)
[ 0  0  0 23]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 23]
54 T
59 (54, 5, 5, 0)
[ 0  0 23  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 23]
84 C
89 (84, 5, 5, 0)
[23  0  0  0]
TCCTATTTGTGACGGTCTAGTACCCGTATCCATGGTTATTTTCTGCAACGCGTATATTGGACGACCCCGGCTGAACTAGATCGTCA

idx 0 locidx 49
31 A
36 (31, 5, 5, 0)
[ 0 21  0  0]
55 S
60 (55, 5, 5, 0)
[10  0  0 11]
58 T
63 (58, 5, 5, 0)
[ 0  0 21  0]
TATGAAATCACCGTCCTTCGTACATAAACTGACCCAACGGCTCGCTTGATCGTGCSGCTCTGAGACCGTGCAAACGCGGGTTCCTT

idx 1 locidx 50
48 T
53 (48, 5, 5, 0)
[ 0  0 19  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 19]
81 C
86 (81, 5, 5, 0)
[19  0  0  0]
AGCACAGGTCGAACCCATGCGGTCCTAGGTACCCTGCGTTCATGGGAGTTATCTCATCTCATGCTTTCCGGGTTATTTAAACAGTC

idx 1 locidx 51
27 T
32 (27, 5, 5, 0)
[ 0  0 24  0]
29 A
34 (29, 5, 5, 0)
[ 0 24  0  0]
44 C
49 (44, 5, 5, 0)
[24  0  0  0]
50 T
55 (50, 5, 5, 0)
[ 0  0 24  0]
CTTTCCCGTCGTGTCGGAAGACACCTGTAAAGGTCGGAAACAGCCAGATGTGCTTACACAACGCCTGAGGTACGTCGACTTTAGGG

idx 1 locidx 52
29 C
34 (29, 5, 5, 0)
[21  0  0  0]
55 C
60 (55, 5, 5, 0)
[21  0  0  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 21  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 21]
62 C
67 (62, 5, 5, 0)
[21  0  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 21]
TTGAACACTTTAGAAGAAACCTGGTATCCCAATCGACATCATGGGTATGTGGTCCCTATAAGCTCATGCGACCGAGCCATGTCGTA

idx 1 locidx 53
36 T
41 (36, 5, 5, 0)
[ 0  0 28  0]
81 T
86 (81, 5, 5, 0)
[ 0  0 28  0]
83 A
88 (83, 5, 5, 0)
[ 0 28  0  0]
AAAGGATGGATTTGGCGCCGACACCTATATTGGCACTGTCTGAGACAATCTCAGCTAAATGTGCCGCGATCTCCTTGAACTTTATC

idx 1 locidx 54
7 T
12 (7, 5, 5, 0)
[ 0  0 23  0]
12 T
17 (12, 5, 5, 0)
[ 0  0 23  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 23]
63 T
68 (63, 5, 5, 0)
[ 0  0 23  0]
65 C
70 (65, 5, 5, 0)
[23  0  0  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 23  0]
CACGAAGTTAACTTCAACCCTCGCCACTACTGCGTACAAAACGCGAGAGGTCTCCATGAGTGTTGCATCCGCTGTGGTGGTTACAT

idx 1 locidx 55
22 T
27 (22, 5, 5, 0)
[ 0  0 17  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 17]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 17]
AATAACTAGCAGACGGAGAAATTTCATTATTCGGTTTGTCTACAAAAGATTCTTTTTCACTAGTTAGGTCTGGCTGTTCCGATTGC

idx 1 locidx 56
63 A
68 (63, 5, 5, 0)
[ 0 17  0  0]
66 C
71 (66, 5, 5, 0)
[17  0  0  0]
81 T
86 (81, 5, 5, 0)
[ 0  0 17  0]
CATGCTTTAACCAGTTACGCCGACCGATTTGTAGCGAGCTATAATAAAAGTCGCTATTCGGTAACTCTTGCTGCTATATGGTGGAA

idx 1 locidx 57
7 G
12 (7, 5, 5, 0)
[ 0  0  0 17]
34 C
39 (34, 5, 5, 0)
[17  0  0  0]
38 A
43 (38, 5, 5, 0)
[ 0 17  0  0]
42 A
47 (42, 5, 5, 0)
[ 0 17  0  0]
54 A
59 (54, 5, 5, 0)
[ 0 17  0  0]
66 A
71 (66, 5, 5, 0)
[ 0 17  0  0]
GGAGCTAGAAAGGCCGTCGTTAACAAAGTCGGCTCCAAAAGAATAGGTCATGGCACTGTTTAAGAGATATCCAATGTGGCCCTATT

idx 1 locidx 58
16 C
21 (16, 5, 5, 0)
[22  0  0  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 22]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 22]
39 T
44 (39, 5, 5, 0)
[ 0  0 22  0]
41 C
46 (41, 5, 5, 0)
[22  0  0  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 22]
48 A
53 (48, 5, 5, 0)
[ 0 22  0  0]
CTTTGGCGAGACGAGGCTATTCGTAAAGCAAGTTTATGATACGACCAAAAGTTCCCGAAAGTCACTACGTTGTAGATACACCAGCA

idx 1 locidx 59
11 T
16 (11, 5, 5, 0)
[ 0  0 23  0]
57 C
62 (57, 5, 5, 0)
[23  0  0  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 23  0]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 23]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 23]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 23]
GATGGGCGTGCTAGCCGGAGTTTCGCCCAACTTGTAACATGTTCTCTAGGGAATTTTCGATGTTGTAATCCAGAATCAGAAGGTGG

idx 1 locidx 60
43 C
48 (43, 5, 5, 0)
[16  0  0  0]
46 C
51 (46, 5, 5, 0)
[16  0  0  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 16]
GTCCTTGAGGTGACGGCGTCGATTGACAATTGTATCCCAACTGCAGCACCCGTTTGGTATACCGCGTCCCTGAGTATCTGGATCAC

idx 1 locidx 61
3 G
8 (3, 5, 5, 0)
[ 0  0  0 21]
40 T
45 (40, 5, 5, 0)
[ 0  0 21  0]
58 C
63 (58, 5, 5, 0)
[21  0  0  0]
68 T
73 (68, 5, 5, 0)
[ 0  0 21  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 21]
82 A
87 (82, 5, 5, 0)
[ 0 21  0  0]
GACGAGTGGACTCAACGCTAGCTGCCTTTATCAGCAGTTTTAAAGAAACTATCGTGCCCTCATAGTTGTGTAAGTCTGTGCCAGGC

idx 1 locidx 62
10 A
15 (10, 5, 5, 0)
[ 0 19  0  0]
13 C
18 (13, 5, 5, 0)
[19  0  0  0]
52 A
57 (52, 5, 5, 0)
[ 0 19  0  0]
CCAACCCGGCATCCCATCCGCTCTAGCAGCTGATGTGACAATCTTATTACAGACATCGCTACAGCGGTTATGACCCGTTCGCCTCA

idx 1 locidx 63
7 A
12 (7, 5, 5, 0)
[ 0 17  0  0]
9 G
14 (9, 5, 5, 0)
[ 0  0  0 17]
11 A
16 (11, 5, 5, 0)
[ 0 17  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 17]
62 C
67 (62, 5, 5, 0)
[17  0  0  0]
GGCGCTGACGGATTTTGCTCAGTTAGACCAGCAATGCTGCCTTGACATACTAAAAAGACTAGCTCCACTCAAATTAGACACGATAA

idx 1 locidx 64
27 G
32 (27, 5, 5, 0)
[ 0  0  0 19]
39 T
44 (39, 5, 5, 0)
[ 0  0 19  0]
40 A
45 (40, 5, 5, 0)
[ 0 19  0  0]
46 A
51 (46, 5, 5, 0)
[ 0 19  0  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 19]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 19]
CATTGAGATCAGCACGACTAATACCAAGTATCAGGACCATACTGTGAGATGGCCGGAACAGACATGTAAGAATGGGGTTACAGGGA

idx 1 locidx 65
7 G
12 (7, 5, 5, 0)
[ 0  1  0 19]
15 C
20 (15, 5, 5, 0)
[20  0  0  0]
36 T
41 (36, 5, 5, 0)
[ 0  0 20  0]
GTGGTATGTATATCTCGGCCGGACCTACCACCCGTCTAATATCCACTAAATAGTCCCAGTTGCATGAGCCCAGCCTTGAGAAAAAC

idx 1 locidx 66
22 A
27 (22, 5, 5, 0)
[ 0 23  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 23]
59 T
64 (59, 5, 5, 0)
[ 0  0 23  0]
AGATGCACGGTAGCGTTTTGCGAATTGCACACGTTGTGGTTCAGTAAGAGAATCTGACGTGGTCGCTGTGAAATGTAGAACTAGGT

idx 1 locidx 67
5 C
10 (5, 5, 5, 0)
[22  0  0  0]
35 C
40 (35, 5, 5, 0)
[22  0  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 22]
84 C
89 (84, 5, 5, 0)
[22  0  0  0]
GCGAGCCATACCGTGCCGTAGCGACGAATCAGTTGCTGCTAAAGTGTGAGATATCGGACGGAGGTACTCAATCGTGTGCTCACACA

idx 1 locidx 68
51 G
56 (51, 5, 5, 0)
[ 0  0  0 21]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
AAATTATGAAATTATGCGAAACTTAAAGACGTATCGGTTGGCAGCGGCACTGCTCCCGAGGAGTCCGTGCCTTTGCCAATAATGCC

idx 1 locidx 69
9 G
14 (9, 5, 5, 0)
[ 0  0  0 22]
29 C
34 (29, 5, 5, 0)
[22  0  0  0]
52 C
57 (52, 5, 5, 0)
[22  0  0  0]
54 C
59 (54, 5, 5, 0)
[22  0  0  0]
67 A
72 (67, 5, 5, 0)
[ 0 22  0  0]
73 T
78 (73, 5, 5, 0)
[ 0  0 22  0]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 22]
CCACGTTGTGAGCGACTACTCAGCTTCACCTGCTCTCAAGTGAGCCGTCGACCACCTACTGCGTTCGACACTGTGCGAGCGAGCCT

idx 1 locidx 70
16 A
21 (16, 5, 5, 0)
[ 0 23  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 23  0  0]
25 A
30 (25, 5, 5, 0)
[ 0 23  0  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 23]
79 C
84 (79, 5, 5, 0)
[23  0  0  0]
82 A
87 (82, 5, 5, 0)
[ 0 23  0  0]
CCATCCCTGTGTGGCTACCTATCGAATTGGTAGCGCGTGGGTACTGGACAACTGTGTGTTCTGCTCGTTCCGCATTAGACACACGT

idx 1 locidx 71
9 A
14 (9, 5, 5, 0)
[ 0 22  0  0]
19 A
24 (19, 5, 5, 0)
[ 0 22  0  0]
22 C
27 (22, 5, 5, 0)
[22  0  0  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 22]
CTGCGAATAAACCCATTGGACCCGCACCTACTCGTTACACGAGCAGAATCGCACCTTTAGACAGCGCAGCTGGACATCCCAACGAC

idx 1 locidx 72
19 C
24 (19, 5, 5, 0)
[23  0  0  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 23]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 23]
TATAACAAAGAACTATCAGCATTTGCTACGATCAACGGGATTGGAGCGCAGTTATGTGCTTGTAAGTAGAGTTTGCAGCGGGTATG

idx 1 locidx 73
66 W
71 (66, 5, 5, 0)
[ 0 12  6  0]
CCCGGTTGCTTCGGGGACTGTGCATCTAATTAATCTGTAGACCTAATGGTACCAGAAGTGTTTTAGWATGATGTGTACATCGTAGT

idx 1 locidx 74
8 A
13 (8, 5, 5, 0)
[ 0 23  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 23]
54 A
59 (54, 5, 5, 0)
[ 0 23  0  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 23]
TTGAAAGTACCGTATCTGCCTCAGTCCGCGGTCCAAAGCAGATATTTATTTGGGACCACGTTGCGTCCAAATGACGAGAGTCGGAG

idx 1 locidx 75
13 G
18 (13, 5, 5, 0)
[ 0  0  1 17]
32 K
37 (32, 5, 5, 0)
[ 0  0  8 10]
51 A
56 (51, 5, 5, 0)
[ 0 18  0  0]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 18]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 18]
CTTACATCAGCTCGGGCACAAAGGCCATCTTGKGGATGTTCGACGAGCTAAATTACTGGATTTGTATCCTCCGAGGATGGACCTTT

idx 1 locidx 76
17 C
22 (17, 5, 5, 0)
[20  0  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 20  0]
GATAGAGTGGTACGTTTCCACTGCTGTCACTGAGGGGGCGATCTCTTTAGACCTTGCCCAGCACTCTGGCCGGACTAAGAGAGCGT

idx 1 locidx 77
2 A
7 (2, 5, 5, 0)
[ 0 25  0  0]
14 G
19 (14, 5, 5, 0)
[ 0  0  0 25]
30 T
35 (30, 5, 5, 0)
[ 0  0 25  0]
47 A
52 (47, 5, 5, 0)
[ 0 25  0  0]
70 A
75 (70, 5, 5, 0)
[ 0 25  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 25  0]
CGAGCGTTTTCACAGACGCCGTTAAAAGGATCCCTTCGGAATATCCTACCTCTCCTCCAACGCCGCACGTATCGGGCTCTCCTGCT

idx 1 locidx 78
9 A
14 (9, 5, 5, 0)
[ 0 17  0  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 17]
TGAGTCCCCACTTGTTTATCGTGGTGTGCCAATGTGGTGGTGCTTCCCCTCGGCAAGGATCTAGGCGGAGATAACGTACATGCTCA

idx 1 locidx 79
41 T
46 (41, 5, 5, 0)
[ 0  0 15  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 15  0]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 15]
CGACCCAAGACGGTGAGGAGGCGAACACCGTTGTAACGTCTTACAGTGTTCGGGGGTATATCAGACACCGCTGACGACTGGGGTCA

idx 1 locidx 80
15 A
20 (15, 5, 5, 0)
[ 0 25  0  0]
16 T
21 (16, 5, 5, 0)
[ 0  0 25  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 25]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 25]
31 T
36 (31, 5, 5, 0)
[ 0  0 25  0]
61 A
66 (61, 5, 5, 0)
[ 0 25  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 25  0  0]
TGAAATATGCTGCTGATTATGGAGTGCTTGATTTTTTACGGCTTAACGCCTTTCTTCGCCTACCGGGGCGTGCTAGTATGCATTGA

idx 1 locidx 81
84 G
89 (84, 5, 5, 0)
[ 0  0  0 26]
CTGTTAGTATACGGCGACGTCTCGTGATTACCCTGGCTCGCGACGTGCTTGTATACCCCATCTTGGTTTGGGTGCAGGCCGCACGC

idx 1 locidx 82
25 T
30 (25, 5, 5, 0)
[ 0  0 20  0]
47 C
52 (47, 5, 5, 0)
[20  0  0  0]
GTGCTTGGCCACACGTATGTGCGCCTAGCCGCTGACAAGCGAACCTTCCCGAGCACTTGCACCCATTAATTTCTTATATTCAATGG

idx 1 locidx 83
0 T
5 (0, 5, 5, 0)
[ 0  0 22  0]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 22]
37 A
42 (37, 5, 5, 0)
[ 0 22  0  0]
57 A
62 (57, 5, 5, 0)
[ 0 22  0  0]
TACACAGCAAGAATCTGGCCATACGGGGCACTGTATGAAACTGCTTGGATTTACGTTACTCAGTGGTAAACCCCCGGAAGCCGATA

idx 1 locidx 84
14 A
19 (14, 5, 5, 0)
[ 0 16  0  0]
26 A
31 (26, 5, 5, 0)
[ 0 16  0  0]
55 C
60 (55, 5, 5, 0)
[16  0  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  1 15  0]
CGACCGAGGTGCTAAGTGGAACCTGAAGGCTGGAACTACTTTAACGGCACTGTCGCGCCATTAAGCAAAGATTACAGCCAACTCAT

idx 1 locidx 85
52 C
57 (52, 5, 5, 0)
[19  0  0  0]
71 C
76 (71, 5, 5, 0)
[19  0  0  0]
AAGGCGAGCACTCCCGCAATGTGCAACCAACGGCATTCCTGTGTGCGGAGACCCCTGATCAACGGCTCCCCCGCATCCCGCCTGGC

idx 1 locidx 86
2 T
7 (2, 5, 5, 0)
[ 0  0 21  0]
20 A
25 (20, 5, 5, 0)
[ 0 21  0  0]
36 C
41 (36, 5, 5, 0)
[21  0  0  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 21]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 21]
TCTCACTGCAGTGTGTAAAGACGTAGAAAATGGACCCTGATGGGTGAGCAAAGTTTTCATGTCCGCCGTCTATAAGCCATTGCTTT

idx 1 locidx 87
33 A
38 (33, 5, 5, 0)
[ 0 20  0  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 20  0]
82 C
87 (82, 5, 5, 0)
[20  0  0  0]
CATATCCTGTTTTCCTAATTAAATGGGTGGTCGAGGAAGCGCCCTAACAGGGTTGATCAACTACCAAAGACTCGGTGGAACCCTAG

idx 1 locidx 88
7 T
12 (7, 5, 5, 0)
[ 0  0 21  0]
10 A
15 (10, 5, 5, 0)
[ 0 21  0  0]
58 C
63 (58, 5, 5, 0)
[21  0  0  0]
66 T
71 (66, 5, 5, 0)
[ 0  0 21  0]
AGCCCCTTTCACGATCAGTCACCACGCCCCGCATTGGTAGTCAAGGTTCTAGTTGTTCCGAAGCGCTAATCTGCGGACGTAAATTA

idx 1 locidx 89
22 C
27 (22, 5, 5, 0)
[22  0  0  0]
28 C
33 (28, 5, 5, 0)
[22  0  0  0]
35 C
40 (35, 5, 5, 0)
[22  0  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 22  0  0]
58 T
63 (58, 5, 5, 0)
[ 0  0 22  0]
CTGAAGCTAACTTGCCACTAGTCACGCTCATCATGCCCGTAAGACTGAGGAGTGGCTGTACAGTCGCTAGATAGACAATACCGCAG

idx 1 locidx 90
23 T
28 (23, 5, 5, 0)
[ 0  0 22  0]
24 A
29 (24, 5, 5, 0)
[ 0 22  0  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 22]
57 T
62 (57, 5, 5, 0)
[ 0  0 22  0]
63 G
68 (63, 5, 5, 0)
[ 0  0  0 22]
66 T
71 (66, 5, 5, 0)
[ 0  0 22  0]
GGGACTCCCTACCCCCTCAAAATTACCCGTTTTGTTTCCATCAGGTACAACGGAGGATGCACGGAGTAAGAGGGGCCACCGTAGGG

idx 1 locidx 91
2 C
7 (2, 5, 5, 0)
[22  0  0  0]
33 C
38 (33, 5, 5, 0)
[22  0  0  0]
80 C
85 (80, 5, 5, 0)
[22  0  0  0]
AACGCGTTCTTTTGTGTTTTTGCAAGTTAGGCGCTCGCAGCTGATTTAGATCAATACGACTCGTCTACTAGTAACAAAGGCATGGA

idx 1 locidx 92
23 T
28 (23, 5, 5, 0)
[ 0  0 22  0]
45 A
50 (45, 5, 5, 0)
[ 0 22  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 22]
64 A
69 (64, 5, 5, 0)
[ 0 22  0  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 22]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 22]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 22]
TCCGGTAGCATGGGTTGACTCTGTTCCTGTAAGGTGTGCTTAGGGAGGCAGCACTTCACCGTAAAGGCACAGCTGGTAAGGTTACG

idx 1 locidx 93
9 T
14 (9, 5, 5, 0)
[ 0  0 20  0]
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
53 T
58 (53, 5, 5, 0)
[ 0  0 20  0]
CATTAGGATTGGTCCACTTCGTCCAGCCCCTGGACATGGCGTTTATCTGATTGTGTTGTATTCACGTTGGGGTGCACCCAATGCCC

idx 1 locidx 94
16 A
21 (16, 5, 5, 0)
[ 0 23  0  0]
33 C
38 (33, 5, 5, 0)
[23  0  0  0]
50 A
55 (50, 5, 5, 0)
[ 0 23  0  0]
TTTTATTAACTTCGAAACCATTCCCACAGCGTACGTTAGAGCTTTGGGGAAATATGTATAAGGGCTGCGACTGGCGCTCGATGCTA

idx 1 locidx 95
15 C
20 (15, 5, 5, 0)
[19  0  0  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 19]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 19]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 19]
AGGAAATAGTAACTCCACGGCTGGTGAGAACGTAAGGAGAGCCGCTACTATCCTCGCTTTTGGCCAACGAGTGCCTGATTCCTGTT

idx 1 locidx 96
30 G
35 (30, 5, 5, 0)
[ 0  0  0 24]
31 C
36 (31, 5, 5, 0)
[24  0  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 24]
67 T
72 (67, 5, 5, 0)
[ 0  0 24  0]
GTTGTCAACCTTATCTTCTGGGGTCTTGGGGCGGACCTTCTGGGCCGCAGCGATGTTGAGTAAGCGATACATAAGTGGGCCCGCAG

idx 1 locidx 97
1 T
6 (1, 5, 5, 0)
[ 0  0 22  0]
4 A
9 (4, 5, 5, 0)
[ 0 22  0  0]
11 K
16 (11, 5, 5, 0)
[ 0  0 10 12]
50 T
55 (50, 5, 5, 0)
[ 0  0 22  0]
77 A
82 (77, 5, 5, 0)
[ 0 22  0  0]
ATGGATCTTACKCTAGCTGTGGTGGACCCGCGTTCTTTGGACTAGTAGGTTCCCCGCTCGTTCCGTTGTTTAACTCCATATAGCGT

idx 1 locidx 98
3 T
8 (3, 5, 5, 0)
[ 0  0 22  0]
10 A
15 (10, 5, 5, 0)
[ 0 22  0  0]
18 C
23 (18, 5, 5, 0)
[22  0  0  0]
23 T
28 (23, 5, 5, 0)
[ 0  0 22  0]
28 A
33 (28, 5, 5, 0)
[ 0 22  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 22  0]
40 T
45 (40, 5, 5, 0)
[ 0  0 22  0]
66 C
71 (66, 5, 5, 0)
[22  0  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 22]
GATTCTGTTCATCGGTGCCATCCTTAAGAAGAGTGAACATTCAAATCGAGTAAGTCGGTTCTGTAACGGGGTTCATATGCAAGGGG

idx 1 locidx 99
5 M
10 (5, 5, 5, 0)
[12 11  0  0]
40 K
45 (40, 5, 5, 0)
[ 0  0 12 11]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 23]
55 Y
60 (55, 5, 5, 0)
[12  0 11  0]
67 C
72 (67, 5, 5, 0)
[23  0  0  0]
69 Y
74 (69, 5, 5, 0)
[12  0 11  0]
71 A
76 (71, 5, 5, 0)
[ 0 23  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 23  0]
CCCCTMCGATAGGCAGGTTTGGCTGAGAGAAGTGTAGTACKCGCGTTGCTTGAGGYGAGGGCTGATCCGYCAAACTTAGATGGCCG

idx 2 locidx 100
3 A
8 (3, 5, 5, 0)
[ 0 15  0  0]
49 C
54 (49, 5, 5, 0)
[15  0  0  0]
54 A
59 (54, 5, 5, 0)
[ 0 15  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 15]
CCAATATTGGCAAGGTCGTCTGATACGTGCCACTAGGCTCCTTTAACAGCTCCCAACTACATTGCCCGATCCCAAGTCTGCGGTTA

NOT HERE
NOT HERE
idx 2 locidx 103
10 G
15 (10, 5, 5, 0)
[ 0  0  0 17]
34 A
39 (34, 5, 5, 0)
[ 0 17  0  0]
46 C
51 (46, 5, 5, 0)
[17  0  0  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 17  0]
60 C
65 (60, 5, 5, 0)
[17  0  0  0]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 17]
CTTGGGCAGCGATCGGTAGGATCCGATACAGACTAGATCTGACATGCTAGAGTGGAAGGACCATCACCATGGCGATGTGTCGGCCC

idx 2 locidx 104
7 T
12 (7, 5, 5, 0)
[ 0  0 19  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 19]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 19]
31 A
36 (31, 5, 5, 0)
[ 0 19  0  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 19]
73 T
78 (73, 5, 5, 0)
[ 0  0 19  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 19]
CCCGGCCTGCACCCCGTTTCGTGTCGTCCATAGCATAAATCTCGGCATCGCGCGCCTGAAAGTAGCGGCTTGCTTGAACTTTACCG

idx 2 locidx 105
4 A
9 (4, 5, 5, 0)
[ 0 19  0  0]
15 C
20 (15, 5, 5, 0)
[19  0  0  0]
38 C
43 (38, 5, 5, 0)
[19  0  0  0]
AAAAAGCTACGCACTCGGACACCCCCTTTAACGAAATTCCGAACTCGAACGTCCGGGTCGGAACTCAAGAATCGGCGTTAGTTACT

idx 2 locidx 106
14 G
19 (14, 5, 5, 0)
[ 0  0  0 19]
23 T
28 (23, 5, 5, 0)
[ 0  0 19  0]
34 C
39 (34, 5, 5, 0)
[19  0  0  0]
84 C
89 (84, 5, 5, 0)
[19  0  0  0]
GCTTATAACAGCTGGGGACAACTTATCGCTCTTACAATAGGCGAATCAGTGTTATTACGTGGTAACGAGCTAATCATTCATCTCCC

idx 2 locidx 107
16 T
21 (16, 5, 5, 0)
[ 0  0 18  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 18  0]
82 W
87 (82, 5, 5, 0)
[ 0 12  6  0]
TTGTCCATTTTCAAGTTAGTTAGCGAAAGACCAGTGTACTTACACTTGCCCCGGCCCGACCGACTCTAACTCGATGTAGGAGWTCT

idx 2 locidx 108
22 T
27 (22, 5, 5, 0)
[ 0  0 21  0]
34 C
39 (34, 5, 5, 0)
[21  0  0  0]
61 A
66 (61, 5, 5, 0)
[ 0 21  0  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 21  0]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 21]
ACGTTTCCTTACCATCCCAGCATAATGGGATCACCGGCAATTTCCCAAGGCGCGTCCGTCAAGACCACTTGACACTTTGTCGTTAT

idx 2 locidx 109
1 G
6 (1, 5, 5, 0)
[ 0  0  0 19]
2 T
7 (2, 5, 5, 0)
[ 0  0 19  0]
19 C
24 (19, 5, 5, 0)
[19  0  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 19  0  0]
TGTTCACCTTAGATGTAGCCGCTAATGATGCAACCTTCAGTACGCTGTCGACTTATAGGCTGAAGCATATAGTGGGTTTGAGGAGT

idx 2 locidx 110
8 G
13 (8, 5, 5, 0)
[ 0  0  0 21]
33 A
38 (33, 5, 5, 0)
[ 0 21  0  0]
63 C
68 (63, 5, 5, 0)
[21  0  0  0]
GGCCCATAGCGCCGTTCCCAATAACAGAATAGTATGACCTGCGCTGTATAGGTAACCCCAATACAGTCCACGACCTATTATAGTCC

idx 2 locidx 111
4 A
9 (4, 5, 5, 0)
[ 0 25  0  0]
11 A
16 (11, 5, 5, 0)
[ 0 25  0  0]
29 T
34 (29, 5, 5, 0)
[ 0  0 25  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 25]
43 T
48 (43, 5, 5, 0)
[ 0  0 25  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 25]
74 C
79 (74, 5, 5, 0)
[25  0  0  0]
ACTCATGATGGACAATCGCTGCTAAAACGTTTATCCCGAAAAATACACCGCCGTCGATAAAGCCGGCGGACCGTCTTCTACGGGGC

idx 2 locidx 112
23 Y
28 (23, 5, 5, 0)
[12  0  4  0]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 16]
58 C
63 (58, 5, 5, 0)
[16  0  0  0]
62 C
67 (62, 5, 5, 0)
[16  0  0  0]
85 W
90 (85, 5, 5, 0)
[ 0 12  4  0]
AGAAAGGTATGTTGACGTAGACTYACCAGTGCATCACTCGAGAGTGTTTCACGTTACTCCCGCAAGCGAGCCGCGCTCGTCCGCTW

idx 2 locidx 113
39 T
44 (39, 5, 5, 0)
[ 0  0 21  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 21  0]
46 C
51 (46, 5, 5, 0)
[21  0  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 21  0]
TGGGACATACTAGAAGGTAACGATCGATGGTTTGTAGGATCTATTCCTCAACCCTCGCTTGTATATACCTTTCCGGCCCGGATATC

idx 2 locidx 114
3 T
8 (3, 5, 5, 0)
[ 0  0 23  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 23]
25 C
30 (25, 5, 5, 0)
[23  0  0  0]
39 M
44 (39, 5, 5, 0)
[12 11  0  0]
45 C
50 (45, 5, 5, 0)
[23  0  0  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 23  0]
81 C
86 (81, 5, 5, 0)
[23  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 23]
TAATGGACTCATCGTGCTGAGCTACCACCCTCCGTGTGTMCTATACTCCTCTGTTTGGAGGGATATATTCCCTATCACCATCCGGG

idx 2 locidx 115
4 T
9 (4, 5, 5, 0)
[ 0  0 15  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 15]
70 A
75 (70, 5, 5, 0)
[ 0 15  0  0]
GTACTGTGATCCATTTAATATTATCGCGTGGGACGCACGCATGTACGGGTCTGGCGTTGCAGGCGTTCACAGGTCAAATTGGAGCC

idx 2 locidx 116
6 T
11 (6, 5, 5, 0)
[ 0  0 19  0]
30 A
35 (30, 5, 5, 0)
[ 0 19  0  0]
64 A
69 (64, 5, 5, 0)
[ 0 19  0  0]
84 C
89 (84, 5, 5, 0)
[19  0  0  0]
CACGCATTGCCGATCTGAATACAATAAACCACCTGTACTGTCGGTGAGGACGTCTGGTGGGTAAACCGCAAGGAAGGACAGCGCCT

idx 2 locidx 117
24 W
29 (24, 5, 5, 0)
[ 0  8 13  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 21  0]
ATAGGGTCCAAGTGCTTGCTCGAAWCTCTGCGCTGGGTTAGATATTCTCATTGTGTTCAGGTACTGAGCTAGATTATATTGCGACG

idx 2 locidx 118
6 A
11 (6, 5, 5, 0)
[ 0 23  0  0]
15 T
20 (15, 5, 5, 0)
[ 0  0 23  0]
56 A
61 (56, 5, 5, 0)
[ 0 23  0  0]
CTAAAGAGTCCAAGATGCTTGGGGAGTCTTGGACTGGACGTCGCGAGGTTTTAGTGAGGGCATTCGTCCACACGATGCCACGTAGG

idx 2 locidx 119
1 T
6 (1, 5, 5, 0)
[ 0  0 27  0]
20 A
25 (20, 5, 5, 0)
[ 0 27  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 27  0  0]
40 T
45 (40, 5, 5, 0)
[ 0  0 27  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 27]
76 T
81 (76, 5, 5, 0)
[ 0  0 27  0]
GTTATCGATTAAACGTCGGAACAGCTACCGGCCCTAATAGTCCTTGTCTAAACTCCTGGCAGTCCTCCGGCTTGGCTCCTGCAGCT

idx 2 locidx 120
11 T
16 (11, 5, 5, 0)
[ 0  0 19  0]
22 T
27 (22, 5, 5, 0)
[ 0  0 19  0]
45 C
50 (45, 5, 5, 0)
[19  0  0  0]
47 C
52 (47, 5, 5, 0)
[19  0  0  0]
68 C
73 (68, 5, 5, 0)
[19  0  0  0]
GGAGTCCTCGCTTCGATCCTTATCTTGTTACAGCAAAGCAGCTTTCCCTCAGCTCAACCGGGAGATGCCACCATATTGTTATCAAA

idx 2 locidx 121
9 G
14 (9, 5, 5, 0)
[ 0  0  0 26]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 26]
47 C
52 (47, 5, 5, 0)
[26  0  0  0]
GGGTTAGGCGTATCTGCCAAAGATTCTTCGATCGTGATGATTCTAGACGACAATACACCTGATGCTTCTCGCATGCATAGCAATGG

idx 2 locidx 122
9 A
14 (9, 5, 5, 0)
[ 0 21  0  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 21  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 21]
73 T
78 (73, 5, 5, 0)
[ 0  0 21  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 21  0]
CTTAGTACCAGCACAGTGCCGCAACCTTTCGGCTTTGGGATAGGATACATATTTTTAGGATAGTTTGAGTATGTTGCGTCCTCTCT

idx 2 locidx 123
31 G
36 (31, 5, 5, 0)
[ 0  0  0 21]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 21]
83 T
88 (83, 5, 5, 0)
[ 0  0 21  0]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 21  0  0]
AGAAAGACGATGGCCGCCCCAAGAGAGGCCTGAACGGCATGATTAGAGCGTGTAGGGCTGACGAACGTCTGGACGACACAGCATCA

idx 2 locidx 124
4 T
9 (4, 5, 5, 0)
[ 0  0 24  0]
15 A
20 (15, 5, 5, 0)
[ 0 24  0  0]
34 A
39 (34, 5, 5, 0)
[ 0 24  0  0]
43 C
48 (43, 5, 5, 0)
[24  0  0  0]
52 A
57 (52, 5, 5, 0)
[ 0 24  0  0]
57 T
62 (57, 5, 5, 0)
[ 0  0 24  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 24]
TGGATCCGCCGTGGGACGGCATTACTAATGCAAAACCGTTGGTCAAGGTCTTAAGCTTCGTCCGTGCTCTTCAAATTTCTTAACGT

idx 2 locidx 125
3 T
8 (3, 5, 5, 0)
[ 0  0 23  0]
24 A
29 (24, 5, 5, 0)
[ 0 23  0  0]
73 T
78 (73, 5, 5, 0)
[ 0  0 23  0]
81 A
86 (81, 5, 5, 0)
[ 0 23  0  0]
CCGTTTCACCACGTGATACTCCAGAGTCTTCCATTGCACACATACTTGGCTCCAGTAGCTCACGTACCATACTTACACTTTAGCGT

idx 2 locidx 126
4 A
9 (4, 5, 5, 0)
[ 0 22  0  0]
31 C
36 (31, 5, 5, 0)
[22  0  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 22]
48 A
53 (48, 5, 5, 0)
[ 0 22  0  0]
51 C
56 (51, 5, 5, 0)
[22  0  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 22]
TAAAAATAAAGCAATTGCTGCCATCTATGGGCAGTTTGATGGTTTTTTATGCTCTACTATTAATTATGTGATCTTGCCCAGGAGGT--

idx 2 locidx 127
7 T
12 (7, 5, 5, 0)
[ 0  0 16  0]
9 A
14 (9, 5, 5, 0)
[ 0 16  0  0]
15 G
20 (15, 5, 5, 0)
[ 0  0  0 16]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 16]
80 C
85 (80, 5, 5, 0)
[16  0  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 16  0]
GAAGCCTTTAGAAGGGCCAAGGGGAGATCCATTCAGGGCTTGTTGCACGAAATCCATTAGCTCTCATTAATTCTATACCACTTATC

idx 2 locidx 128
22 G
27 (22, 5, 5, 0)
[ 0  0  0 21]
45 A
50 (45, 5, 5, 0)
[ 0 21  0  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 21  0]
85 A
90 (85, 5, 5, 0)
[ 0 21  0  0]
CCGGTCAACTACTGTCTTACGGGGGGGGCATCCGTTCCTAGTCGCATTACGATATTCGTATGCCGGTACTTCCCTGGTGGATAGCA

idx 2 locidx 129
4 T
9 (4, 5, 5, 0)
[ 0  0 19  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 19]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 19]
38 C
43 (38, 5, 5, 0)
[19  0  0  0]
44 C
49 (44, 5, 5, 0)
[19  0  0  0]
45 A
50 (45, 5, 5, 0)
[ 0 19  0  0]
50 A
55 (50, 5, 5, 0)
[ 0 19  0  0]
57 A
62 (57, 5, 5, 0)
[ 0 19  0  0]
59 A
64 (59, 5, 5, 0)
[ 0 19  0  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  1 18]
79 T
84 (79, 5, 5, 0)
[ 0  0 19  0]
83 C
88 (83, 5, 5, 0)
[19  0  0  0]
ATCCTCTCCGACAAGGTTCTGGTGCGTTGAATGGTAGGCGACCTCACAGCACCCACAACAGTACCGACAGCTGACCTAATCCGCCC

idx 2 locidx 130
1 G
6 (1, 5, 5, 0)
[ 0  0  0 21]
9 T
14 (9, 5, 5, 0)
[ 0  0 21  0]
12 A
17 (12, 5, 5, 0)
[ 0 21  0  0]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 21]
47 A
52 (47, 5, 5, 0)
[ 0 21  0  0]
78 A
83 (78, 5, 5, 0)
[ 0 21  0  0]
CGTTAACCTTACAGACACATTCGGTTCGCGCAGTTAGATGTGAGACGAGGATCGTGGTACAACCAAGCTTATCACAGTACGGAGAG

idx 2 locidx 131
24 C
29 (24, 5, 5, 0)
[20  0  0  0]
27 T
32 (27, 5, 5, 0)
[ 0  0 20  0]
63 G
68 (63, 5, 5, 0)
[ 0  0  0 20]
AGGTTCAAGAGTTTGTGCACTATTCACTCAACCTAACGCAGAGATTACCCAGGGGCTACGCTAGCGATAAACCACCGCAATACCGG

idx 2 locidx 132
3 T
8 (3, 5, 5, 0)
[ 0  0 14  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 14  0]
59 C
64 (59, 5, 5, 0)
[14  0  0  0]
68 C
73 (68, 5, 5, 0)
[14  0  0  0]
AAATTGCCACGGTGACAATTGAGGTTACGAGCCAGAGTACAGCCTTGTTATCTCAAAGTCCGGTGGTTCCCTACCCTGTATGGTCC

idx 2 locidx 133
79 A
84 (79, 5, 5, 0)
[ 0 19  0  0]
GCCGGCATGTAGGCTAGAGCATCGAGCTCTAGTGAATAACTAGCACCGCAGGGAAACCATGCGGGTATTGACAGCCCTAATGCACT

idx 2 locidx 134
20 T
25 (20, 5, 5, 0)
[ 0  0 22  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 22  0]
71 C
76 (71, 5, 5, 0)
[22  0  0  0]
74 K
79 (74, 5, 5, 0)
[ 0  0 13  9]
75 T
80 (75, 5, 5, 0)
[ 0  0 22  0]
CGATCAATGCCGGTCCTAGTTAACGCAATTGCTGATGCTCTTCTGGCCTAGGGTCCAATCCATGACTAGCACGAKTGAAAGAGAGG

idx 2 locidx 135
83 G
88 (83, 5, 5, 0)
[ 0  0  0 19]
84 T
89 (84, 5, 5, 0)
[ 0  0 19  0]
TTACGAACGTTGACAGCCGCGCATGACAAACAAGGTATCCAGAAATCCCCTGTCATATGAGGCAGGCAAGCAATTTACTCGGGGTT

idx 2 locidx 136
20 A
25 (20, 5, 5, 0)
[ 0 20  0  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 20]
47 A
52 (47, 5, 5, 0)
[ 0 20  0  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 20]
78 C
83 (78, 5, 5, 0)
[20  0  0  0]
GTTTGCAGCGGGCCAATGACAGGCTAATACGTTGATGGTGGCGCTAAAAGTAGTCGAGCACTGGCGAACCTGTGAAGACCGCCGTC

idx 2 locidx 137
54 G
59 (54, 5, 5, 0)
[ 0  0  0 22]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 22]
85 A
90 (85, 5, 5, 0)
[ 0 22  0  0]
CCCCACAGAGCCCATTTGGGATGCCAGTTGGCGGGGGTGCCCCGCCTCACCTCAGTCAGTTCTGTGAACGTAAGGGTCTGTCGAAA

idx 2 locidx 138
10 T
15 (10, 5, 5, 0)
[ 0  0 20  0]
77 C
82 (77, 5, 5, 0)
[20  0  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 20  0  0]
GGTGCTGTGGTGTCTCACCATAGATGGTTTTCTTCGCAGATGTCATAGCTGGCCCTGCCACCCTTGAATCGTGATCGCTAGTGACA

idx 2 locidx 139
26 T
31 (26, 5, 5, 0)
[ 0  0 19  0]
29 A
34 (29, 5, 5, 0)
[ 0 19  0  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 19  0]
77 M
82 (77, 5, 5, 0)
[ 9 10  0  0]
TCCCTACTATCCACCCTGCAGTGCAATTCAGTCTACGCTGCATTGCACAAATAGTATCGCAGTTGAAGTATAATAATMAGCCTACT

idx 2 locidx 140
50 T
55 (50, 5, 5, 0)
[ 0  0 21  0]
80 A
85 (80, 5, 5, 0)
[ 0 21  0  0]
CACAACGTTGACACTCTCGCGCCAACCCGTCCCGGCAAGAGGCGGCAATCTAATGTGTCACGAAAGTGCGTGGGAAAGACAAGACG

idx 2 locidx 141
15 G
20 (15, 5, 5, 0)
[ 0  0  0 24]
25 M
30 (25, 5, 5, 0)
[13 11  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 24  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 24]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 24]
CGGATTGCCGAAAAAGGAGAAAAAGMTCCACCGATATGTGGCTCTTACAGGAGTCTGTAGGCGAGTCGCTTGTCTGCCGTTTATCC

idx 2 locidx 142
66 G
71 (66, 5, 5, 0)
[ 0  0  0 18]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 18]
CCGTGACCTACGTGTTTTAACGGTGAGACCGGTGACATAATTAAGATGCATAATGCAGGGGAGTGAGGCGGGTACGGAGTCGATGT

idx 2 locidx 143
0 A
5 (0, 5, 5, 0)
[ 0 21  0  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 21]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 21]
48 A
53 (48, 5, 5, 0)
[ 0 21  0  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 21]
60 G
65 (60, 5, 5, 0)
[ 1  0  0 20]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 21]
AGCTATTCGCCTTTGCATCGGATCTCGAGCTCGCGGACCGAAATGACAAAGTCGCACGCGGCTGATCTACTTGTTCTTTGAAGTAT

idx 2 locidx 144
14 C
19 (14, 5, 5, 0)
[19  0  0  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 19]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 19]
69 K
74 (69, 5, 5, 0)
[ 0  0 10  9]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 19]
GGCAGCACCGCTTGCGTGCGCGAATGCAGGGCGTGTCAATGCGGCAGAACATCTCTGGGAGGGCCCTCGKACCGGATCGTCGACAG

idx 2 locidx 145
1 A
6 (1, 5, 5, 0)
[ 0 21  0  0]
21 A
26 (21, 5, 5, 0)
[ 0 21  0  0]
26 C
31 (26, 5, 5, 0)
[21  0  0  0]
30 C
35 (30, 5, 5, 0)
[21  0  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 21]
57 T
62 (57, 5, 5, 0)
[ 0  0 21  0]
CATGTCTACATGAGAATTGGCAGCTTCATACTATGACGTGGGGTTGCAGGTGAAGAGTAAAATAGACGATGTAAGTGTACTGCCAA

idx 2 locidx 146
22 A
27 (22, 5, 5, 0)
[ 0 22  0  0]
31 C
36 (31, 5, 5, 0)
[22  0  0  0]
33 A
38 (33, 5, 5, 0)
[ 0 22  0  0]
46 C
51 (46, 5, 5, 0)
[22  0  0  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 22  0]
TCGCATGAAGATCTGGTTCCTAACTAGACTTCGACTAGTACGCTCACGTCGTCTCAACGGCTCGCTAACAAGATACGAGGTGTCTT

idx 2 locidx 147
6 T
11 (6, 5, 5, 0)
[ 0  0 18  0]
11 G
16 (11, 5, 5, 0)
[ 0  0  0 18]
28 T
33 (28, 5, 5, 0)
[ 0  0 18  0]
73 C
78 (73, 5, 5, 0)
[18  0  0  0]
82 C
87 (82, 5, 5, 0)
[18  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 18  0]
84 A
89 (84, 5, 5, 0)
[ 0 18  0  0]
GGTGGCTCAGTGGTATGTATCTCTGTATTAAAAACGCTGGTATTGAAAATACCAACCATCGATGGGATGCCACCTGTCGATTCTAA

idx 2 locidx 148
7 G
12 (7, 5, 5, 0)
[ 0  0  0 18]
19 C
24 (19, 5, 5, 0)
[18  0  0  0]
53 C
58 (53, 5, 5, 0)
[18  0  0  0]
60 C
65 (60, 5, 5, 0)
[18  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 18]
GAAGCCCGATTCCTAACAGCGGATCTTGTAGGACTTCCACCGGCAAGCGTGTCCAGGCGCCGACGTAGGGAGAGTGTAGCTTCGAG

idx 2 locidx 149
18 G
23 (18, 5, 5, 0)
[ 0  0  0 19]
49 A
54 (49, 5, 5, 0)
[ 0 19  0  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 19  0]
TAGGTTAGGCCACCGTCGGACATTGTGTATGGTAGACATGCCGCCGCTTAATAGGAAATTGCACAGAAAGGTCTTAGACGGTTGAT

idx 3 locidx 150
4 C
9 (4, 5, 5, 0)
[19  0  1  0]
7 T
12 (7, 5, 5, 0)
[ 0  0 20  0]
10 A
15 (10, 5, 5, 0)
[ 0 20  0  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 20  0]
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
15 G
20 (15, 5, 5, 0)
[ 0  0  0 20]
17 C
22 (17, 5, 5, 0)
[20  0  0  0]
18 C
23 (18, 5, 5, 0)
[20  0  0  0]
61 C
66 (61, 5, 5, 0)
[20  0  0  0]
AGCGCACTATATTCCGGCCGAAGCCCACGCGGAACTGTAAGCGTAGTGTTGCTTCTGCGAGCGCGAATTGGGATATCGGCTGCACA

idx 3 locidx 151
11 T
16 (11, 5, 5, 0)
[ 0  0 16  0]
12 T
17 (12, 5, 5, 0)
[ 0  0 16  0]
27 T
32 (27, 5, 5, 0)
[ 0  0 16  0]
48 C
53 (48, 5, 5, 0)
[16  0  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 16]
74 A
79 (74, 5, 5, 0)
[ 0 16  0  0]
AACGTCTCCTTTTTCTCTCGGTGGCGATACACGTATCAAGCGCTGAAGCACCGTCGCTATGCAGCTAGTGGCAAAGGCGATGCTCC

idx 3 locidx 152
19 C
24 (19, 5, 5, 0)
[21  0  0  0]
29 A
34 (29, 5, 5, 0)
[ 0 21  0  0]
55 A
60 (55, 5, 5, 0)
[ 0 21  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 21  0  0]
ATGACCTAAGAGAACGGCGCCGTTACTGCAATAATTCCGCAGGATCCTTTTGGACAAAAAACGAAACAGAGACTGAGCTTCCATTG

idx 3 locidx 153
17 T
22 (17, 5, 5, 0)
[ 0  0 20  0]
20 C
25 (20, 5, 5, 0)
[20  0  0  0]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 20]
TCGCCAATGTATTGAACTACCTCTTGCATATTTTTAATTCCTCAGTCCTTCGTTGTTGGATCCGCAAAGACAGTTCGTGGTTCCGC

idx 3 locidx 154
40 A
45 (40, 5, 5, 0)
[ 0 17  0  0]
46 C
51 (46, 5, 5, 0)
[17  0  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 17  0  0]
48 C
53 (48, 5, 5, 0)
[17  0  0  0]
GTCCAAGATAGTACGCATTACGGAAATAATCTAGCTACATACGCGCCACGGGTTAAGCAAGGAATTAACGGCTCTATCAGAAGATG

idx 3 locidx 155
15 T
20 (15, 5, 5, 0)
[ 0  0 22  0]
35 T
40 (35, 5, 5, 0)
[ 0  0 22  0]
84 C
89 (84, 5, 5, 0)
[22  0  0  0]
TTTAACTGTTCAAGTTGGCAAGATCAAGTCGTCCCTAGCCCCCGCGTCCGTTTTTACCTGGTCGCGGTCCCGACCCAGCTGCCCCC

idx 3 locidx 156
36 A
41 (36, 5, 5, 0)
[ 0 23  0  0]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 23]
43 C
48 (43, 5, 5, 0)
[23  0  0  0]
73 A
78 (73, 5, 5, 0)
[ 0 23  0  0]
TGCACTGCGAGGGCTAGGGGACTGCAACAAGCCGAAAGGGTGACGTGCCTCTCCGTCGGGTGCGCTGTGTCGAACCATCCCTTGTT

idx 3 locidx 157
5 T
10 (5, 5, 5, 0)
[ 0  0 20  0]
10 A
15 (10, 5, 5, 0)
[ 0 20  0  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 20  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 20  0]
82 C
87 (82, 5, 5, 0)
[20  0  0  0]
CCCAGTCAGTATGCCTATCGGGCATTCGGGCCCGCGTGCACTCCACTGACGCCGATAGTGCTACAGGCGCCGCTATTGAATCCCGG

idx 3 locidx 158
22 A
27 (22, 5, 5, 0)
[ 0 21  0  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 21]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 21]
36 T
41 (36, 5, 5, 0)
[ 0  0 21  0]
79 C
84 (79, 5, 5, 0)
[21  0  0  0]
TAAAGATTCACTTCCACGAGTCATGTTACTAAAGCGTTAAAGCGTAAAGCTTATATCTCTCTTGCATTTGGTATTACATCCTGCGA

idx 3 locidx 159
14 T
19 (14, 5, 5, 0)
[ 0  0 17  0]
51 S
56 (51, 5, 5, 0)
[9 0 0 8]
63 A
68 (63, 5, 5, 0)
[ 0 17  0  0]
75 A
80 (75, 5, 5, 0)
[ 0 17  0  0]
CGACCCGCCTCCTGTGAATCGCATGGCTGGGGCTGAACGTACGTAGTAACTSGGGAGTGGACCAAGTACTAGGGTATAGTTCTATT

idx 3 locidx 160
9 G
14 (9, 5, 5, 0)
[ 0  0  0 26]
14 C
19 (14, 5, 5, 0)
[26  0  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 26]
ATCGGATACGATGGCTATAGCAATTGACATCCGCCTCCTAGTTTGTAATATTGTTCACGAGGGTGTACATGGCTAGGCAGAAATCG

NOT HERE
idx 3 locidx 162
1 G
6 (1, 5, 5, 0)
[ 0  0  0 20]
12 A
17 (12, 5, 5, 0)
[ 0 20  0  0]
21 A
26 (21, 5, 5, 0)
[ 0 20  0  0]
71 C
76 (71, 5, 5, 0)
[20  0  0  0]
76 A
81 (76, 5, 5, 0)
[ 0 20  0  0]
77 C
82 (77, 5, 5, 0)
[20  0  0  0]
83 C
88 (83, 5, 5, 0)
[20  0  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 20  0]
AGGAATGGATAAACGCTCTTCAGGCTGAATTCTGCTACTTATTAGATGGTGGATCACACGTGATCCTTAATCTTAAACCGACACCT

idx 3 locidx 163
30 A
35 (30, 5, 5, 0)
[ 0 16  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 16  0]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 16]
CTCGAGTTGCTATCGGCCAACGATTGGCAAAGCTCCTGAGATATATAACTAGTTCGTTGTCTTCGCGGGATAAGGTCGTGCTGGAG

idx 3 locidx 164
77 A
82 (77, 5, 5, 0)
[ 0 23  0  0]
82 T
87 (82, 5, 5, 0)
[ 0  0 23  0]
83 A
88 (83, 5, 5, 0)
[ 0 23  0  0]
GCGTGGGCCAGGGAAGCTCTCGCGAATTATTCGCTCGTTTGGGGGGACTGATACATGTGAAGGCGTGCGACCTAGTGATTTATATG

idx 3 locidx 165
3 T
8 (3, 5, 5, 0)
[ 0  0 16  0]
9 A
14 (9, 5, 5, 0)
[ 0 16  0  0]
28 C
33 (28, 5, 5, 0)
[16  0  0  0]
31 W
36 (31, 5, 5, 0)
[0 7 9 0]
37 T
42 (37, 5, 5, 0)
[ 0  0 16  0]
55 C
60 (55, 5, 5, 0)
[16  0  0  0]
AACTAAGACAGATCCGAATAACGCCTCTCAAWTAACCTCCTTGTGTCACGCGTGGCTCATGCGATTACGCGATATCCTTGGCGCAT

idx 3 locidx 166
0 G
5 (0, 5, 5, 0)
[ 0  0  0 16]
50 A
55 (50, 5, 5, 0)
[ 0 16  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 16  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 16  0]
73 A
78 (73, 5, 5, 0)
[ 0 16  0  0]
79 A
84 (79, 5, 5, 0)
[ 0 16  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 16  0]
GGGCGGGACCGCCCCAGACTATCTTCGGAAACGGTCGCTAGAACACCCTCAGACCATGTGAATACTTGTCGATAGGCCGACGCTAA

idx 3 locidx 167
6 A
11 (6, 5, 5, 0)
[ 0 21  0  0]
21 C
26 (21, 5, 5, 0)
[21  0  0  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 21  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 21]
39 C
44 (39, 5, 5, 0)
[21  0  0  0]
44 A
49 (44, 5, 5, 0)
[ 0 21  0  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 21]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
TCCTTAAGGATCGTACGAATGCATGGCGTTGCTGATGCCCATCGATGGTCCATTACCACCTGATGGCGCATAAACGGAGCTCGCCA

idx 3 locidx 168
0 A
5 (0, 5, 5, 0)
[ 0 19  0  0]
34 A
39 (34, 5, 5, 0)
[ 0 19  0  0]
54 C
59 (54, 5, 5, 0)
[19  0  0  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 19  0]
66 C
71 (66, 5, 5, 0)
[19  0  0  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
AATTGCGCCTTTGTCTCGGTCGAACCTGTCCACCATATCACACCTGCCTCACGCCAAGTGAATTTACATGATTCTTTCCGAGGCCT

idx 3 locidx 169
0 C
5 (0, 5, 5, 0)
[17  0  0  0]
14 T
19 (14, 5, 5, 0)
[ 0  0 17  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 17]
26 A
31 (26, 5, 5, 0)
[ 0 17  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 17  0  0]
42 C
47 (42, 5, 5, 0)
[17  0  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 17  0  0]
CATGAAGTCTGAACTCCTTTGCGAGGAAGCCCTTTGTTGTGACCAGGATTAGTATGCTTGTGCCTGGGCACGACTTAACTGAGAGT

idx 3 locidx 170
4 T
9 (4, 5, 5, 0)
[ 0  0 21  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 21  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 21]
45 A
50 (45, 5, 5, 0)
[ 0 21  0  0]
54 A
59 (54, 5, 5, 0)
[ 0 21  0  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 21]
73 A
78 (73, 5, 5, 0)
[ 0 21  0  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 21]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 21]
CTCGTTGTAAACCTGCGTCCGTTATGCGGCCAACTTTCGCACGCTAGGGTAGTTAAAGGTAATCCATCCCCGGACTCGTGGGAGAT

idx 3 locidx 171
28 G
33 (28, 5, 5, 0)
[ 0  0  1 18]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 19]
42 A
47 (42, 5, 5, 0)
[ 0 19  0  0]
79 C
84 (79, 5, 5, 0)
[19  0  0  0]
AGCCCCCGTGTTAGACAGTTGAATATTTGGTCCTGGGTTACCAGTGCATGTTGTAAGAGACTCGTGTACGCAAGGAGAACCTTCAA

idx 3 locidx 172
38 A
43 (38, 5, 5, 0)
[ 0 19  0  0]
41 C
46 (41, 5, 5, 0)
[19  0  0  0]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 19]
77 W
82 (77, 5, 5, 0)
[ 0  9 10  0]
ACAATCTCAGTATGCAAATGTGAAAGGCACGATGCGATAAGCCGCACCGGTAACCAATCGTGAGCGTTGGCACTACGWACCAGGAA---

idx 3 locidx 173
40 G
45 (40, 5, 5, 0)
[ 0  0  0 20]
55 T
60 (55, 5, 5, 0)
[ 0  0 20  0]
69 C
74 (69, 5, 5, 0)
[20  0  0  0]
CTAAGGCAAAATACAGTCACAAGTCTTAGACAGAGGAAGTGTGGGGACATGCTTCTTACAGTCGCGCGACTCATTTGGGAAGTACT

idx 3 locidx 174
14 C
19 (14, 5, 5, 0)
[18  0  0  0]
49 C
54 (49, 5, 5, 0)
[18  0  0  0]
56 C
61 (56, 5, 5, 0)
[18  0  0  0]
AACAAAATGATAAACCGATCATTTTTGTAGTCCTGTGCGTCGAGCCATTCTTCCACCCGTCTACTACGGTCGATTACTCAGCCGTA

idx 3 locidx 175
17 G
22 (17, 5, 5, 0)
[ 0  0  0 18]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 18]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 18]
56 C
61 (56, 5, 5, 0)
[18  0  0  0]
61 C
66 (61, 5, 5, 0)
[18  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 18  0]
GCGGCTTCCATTGGCTTGATCTCTAACAGCAGGGACTGGTTTCGCCGGAACGGTGCCAACGCTACGAGATGGGGTAGATGACTTCG

idx 3 locidx 176
6 C
11 (6, 5, 5, 0)
[16  0  0  0]
23 A
28 (23, 5, 5, 0)
[ 0 16  0  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 16  0]
30 R
35 (30, 5, 5, 0)
[0 9 0 7]
51 C
56 (51, 5, 5, 0)
[16  0  0  0]
GTATAGCTTTTTTTGTTGGCCGTAGTGATCRATGATAATAGCCTCATCTCACGATTCGAGGGTAAGTCAACTTCCGACGAATGCAT

idx 3 locidx 177
11 G
16 (11, 5, 5, 0)
[ 0  0  0 23]
19 A
24 (19, 5, 5, 0)
[ 0 23  0  0]
35 C
40 (35, 5, 5, 0)
[23  0  0  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 23]
73 A
78 (73, 5, 5, 0)
[ 0 23  0  0]
83 A
88 (83, 5, 5, 0)
[ 0 23  0  0]
TCGGATAGAGAGTTCAATTATTGCAATATCCGAATCGACGTGTAGACGAGAGGTGGTATAAAGTCGATGGCAAACGCCACGAGATC

idx 3 locidx 178
0 T
5 (0, 5, 5, 0)
[ 0  0 20  0]
4 C
9 (4, 5, 5, 0)
[20  0  0  0]
16 A
21 (16, 5, 5, 0)
[ 0 20  0  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 20]
32 C
37 (32, 5, 5, 0)
[20  0  0  0]
71 C
76 (71, 5, 5, 0)
[20  0  0  0]
TCTACATTGTAATTGGATCCCCCTGGCCGCGGCGGAAATGTTGGGACGTTTCTAGGTTAGCACTAGTAACCCTTGTATAATACTGG

idx 3 locidx 179
51 T
56 (51, 5, 5, 0)
[ 0  0 13  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 13]
82 C
87 (82, 5, 5, 0)
[13  0  0  0]
TAACATAGCCAAATTAAGATATTAGTTCGACGCCCCGGCCCTGGACGGCTTTGGCCCAGTTGATAGCTCGGGCATCCCAAGTCGGC

idx 3 locidx 180
9 C
14 (9, 5, 5, 0)
[18  1  0  0]
20 T
25 (20, 5, 5, 0)
[ 0  0 19  0]
40 A
45 (40, 5, 5, 0)
[ 0 19  0  0]
43 C
48 (43, 5, 5, 0)
[19  0  0  0]
49 T
54 (49, 5, 5, 0)
[ 0  0 19  0]
TTATAAGACCCTACGCGAATTGGGGCAAATGCGGACGTGTATGCGGGCTTTGTTATGCATAATTGAATTCCACGTCTGGTTTGAAG

idx 3 locidx 181
11 G
16 (11, 5, 5, 0)
[ 0  0  0 20]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 20]
18 T
23 (18, 5, 5, 0)
[ 0  0 20  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 20]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
56 C
61 (56, 5, 5, 0)
[20  0  0  0]
81 A
86 (81, 5, 5, 0)
[ 0 20  0  0]
CGCTACTTCCGGGGTGCGTGGTCTACACACTTAGGCAGACTAGGGCGAACTCCTTACTAAGCTGTACCCTCAGGTAGCCTTAAATC

idx 3 locidx 182
0 A
5 (0, 5, 5, 0)
[ 0 18  0  0]
12 C
17 (12, 5, 5, 0)
[18  0  0  0]
31 C
36 (31, 5, 5, 0)
[18  0  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 18  0  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 18]
46 T
51 (46, 5, 5, 0)
[ 0  0 18  0]
66 C
71 (66, 5, 5, 0)
[18  0  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 18  0  0]
AGTGGAGGGAGACGTAGACGTGTAGTGGCACCACTGCTGAGCAGTATTCCACCCGTTGTTGGTGTCCGTACTGTCTTGTTTGCCCA

idx 3 locidx 183
29 C
34 (29, 5, 5, 0)
[20  0  0  0]
56 C
61 (56, 5, 5, 0)
[20  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 20]
ATTAAAGTTCCATCTGCACCAGTAGGAAGCTCTCTAACGAGAAGTTTAGAAATAGGCCGGGTGCGCCCGGAAGCGATCGGAGAGGT

idx 3 locidx 184
15 T
20 (15, 5, 5, 0)
[ 0  0 19  0]
82 A
87 (82, 5, 5, 0)
[ 0 19  0  0]
TGTGTCCGATAGCCTTAGTCTTCTAACGAGAAGCCGAACTATACCCGCAACAGTGCTGATCTCTAGGCTAAACCGTACCATGAAAC-

idx 3 locidx 185
16 R
21 (16, 5, 5, 0)
[ 0 14  0  9]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 23]
24 C
29 (24, 5, 5, 0)
[23  0  0  0]
GTTCGACTCTATAGGCRCTAGCGGCACGTCGCGCGTTATAAATCCACGTTAGAAGCTCTCATCCGTACAAATAGTGTTGCCTAAAA

idx 3 locidx 186
52 T
57 (52, 5, 5, 0)
[ 0  0 17  0]
65 R
70 (65, 5, 5, 0)
[0 8 0 9]
82 T
87 (82, 5, 5, 0)
[ 0  0 17  0]
GGAAATCTCGTCTACCTCCGTTCCTATTCTTACTAGGGGGACCTGGACCAGCTTTGTAAGCAAAARGTCTTTGGCTTAGAAGTTTG

idx 3 locidx 187
30 A
35 (30, 5, 5, 0)
[ 0 24  0  0]
32 A
37 (32, 5, 5, 0)
[ 0 24  0  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 24]
CAACGGATCTGTAAAAGTGGGCAAAAATCGATAGAACGGTGCAATTAAGTACCGTCAATGGGACCTGAGGCTTCTAACAGCCCGGT-

idx 3 locidx 188
20 G
25 (20, 5, 5, 0)
[ 0  0  0 19]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 19]
53 T
58 (53, 5, 5, 0)
[ 0  0 19  0]
CTGAGCTGCTTCTGAGCTTGGTCCTGATCCTCCCCGTTCGTCGACTGCCCAGCTCAAGATGGAGATTCAGCTGCCGTGATCACCGT

idx 3 locidx 189
6 A
11 (6, 5, 5, 0)
[ 0 24  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 24  0  0]
37 C
42 (37, 5, 5, 0)
[24  0  0  0]
45 C
50 (45, 5, 5, 0)
[24  0  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 24]
AATGTGAGATAAAGCCCATCATAGACCCGGAAGGAAGCCGAGGGGCGATAGGCTCCGTCCCCCAGTCCACAGCTACCGCAGAGCTC

idx 3 locidx 190
4 A
9 (4, 5, 5, 0)
[ 0 20  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 20]
54 G
59 (54, 5, 5, 0)
[ 0  0  0 20]
80 A
85 (80, 5, 5, 0)
[ 0 20  0  0]
ATTAATGGCCCCGTCGTCCCCGCGAAATCTAAGCTGCATGGTGAGGCGGCTCGTGAACGCGCAGTATTTTCTTGTACTCAACTTGA

idx 3 locidx 191
1 A
6 (1, 5, 5, 0)
[ 0 20  0  0]
13 C
18 (13, 5, 5, 0)
[20  0  0  0]
15 G
20 (15, 5, 5, 0)
[ 0  0  0 20]
77 C
82 (77, 5, 5, 0)
[20  0  0  0]
AAAACGGCTAGACCGGTAGGGATATAAAATCATAACATAGCTTGGTTGGGCTTACGCACGTGCGACGCTTACGCCGTCAAGAATCT

idx 3 locidx 192
2 C
7 (2, 5, 5, 0)
[18  0  0  0]
7 A
12 (7, 5, 5, 0)
[ 0 18  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 18  0]
TTCAACTACACCAGTCGCTGCCTCCATAAAGGGATCATCATACAGCACCGGTAAAGTAAATTGCGTCGCGATTCTATGCTACATTT

idx 3 locidx 193
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
GTGACAGTCCGTGACAAGGGTCGGCATAGCCGATGCTACTACGTAATTCACTGCGGCGGTAAATAATATATGTACTTACCCTGAGG

idx 3 locidx 194
6 C
11 (6, 5, 5, 0)
[17  0  0  0]
19 T
24 (19, 5, 5, 0)
[ 0  0 17  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 17]
69 T
74 (69, 5, 5, 0)
[ 0  0 17  0]
CAATGGCGGTGCAACAACGTGAAGAATTCCGAGTCTTACATGACCTTACGTGGAAACGCAGTAACTTTGTATAGGACGCGGCCAAT

idx 3 locidx 195
7 T
12 (7, 5, 5, 0)
[ 0  0 18  0]
33 T
38 (33, 5, 5, 0)
[ 0  0 18  0]
AAATTTGTTCACCGGTCCCTGGTTTATTTAGCGTCGAGGAACATTGCTATGACTCGCACTTTATTCACTTGCGGTATGCATCCAAG

idx 3 locidx 196
7 A
12 (7, 5, 5, 0)
[ 0 19  0  0]
10 G
15 (10, 5, 5, 0)
[ 0  0  0 19]
14 T
19 (14, 5, 5, 0)
[ 0  0 19  0]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 19]
50 T
55 (50, 5, 5, 0)
[ 0  0 19  0]
52 A
57 (52, 5, 5, 0)
[ 0 19  0  0]
56 C
61 (56, 5, 5, 0)
[19  0  0  0]
58 S
63 (58, 5, 5, 0)
[10  0  0  9]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 19]
64 T
69 (64, 5, 5, 0)
[ 0  0 19  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 19  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 19]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 19]
CTCCGTCAAGGGAATATTTCTCCAACCGATCCCATGTGGGAATTAGGTCCTAAGGTCCSAAGTTTTCGAGATAAGCCGGGAGCTCT

idx 3 locidx 197
1 M
6 (1, 5, 5, 0)
[12 10  0  0]
31 W
36 (31, 5, 5, 0)
[ 0 12 10  0]
44 A
49 (44, 5, 5, 0)
[ 0 22  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 22]
56 C
61 (56, 5, 5, 0)
[22  0  0  0]
AMATAGGAGTGACGTAGTTGACCTCGATCGGWCCGTCGAGGCAAATGTCACGCCGTCTCCACTTCTGGTGTAGCCCCCAGTGGAGT

idx 3 locidx 198
20 C
25 (20, 5, 5, 0)
[24  0  1  0]
25 A
30 (25, 5, 5, 0)
[ 0 25  0  0]
35 C
40 (35, 5, 5, 0)
[25  0  0  0]
CTAGTTGAGCAGTTAGTGCACGGATAAGGCGTGGTCTCCGGTTGTCTTCTTAGGTGGAGGAGTCCTCGTAGTCTGTGGGTGCAATT

idx 3 locidx 199
34 K
39 (34, 5, 5, 0)
[0 0 5 8]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 13]
58 A
63 (58, 5, 5, 0)
[ 0 13  0  0]
GGCTACAGGGGTCGTCGGACCAATTTACTCAATTKTGCCGGGAAACCTGCTTTTGCGTAGACCTTCTTAGGGAGGGTATCAGATCA

idx 4 locidx 200
20 C
25 (20, 5, 5, 0)
[18  0  0  0]
21 T
26 (21, 5, 5, 0)
[ 0  0 18  0]
52 C
57 (52, 5, 5, 0)
[18  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 18  0  0]
AGTTGCCCCTCGAAATCGTTCTTGTTGCAGTCACTAACTGCAGGTGGACGTGCGACAACTTCGGAGGTAACCATGTTACCCAATCG

idx 4 locidx 201
20 G
25 (20, 5, 5, 0)
[ 0  0  0 18]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 18]
67 A
72 (67, 5, 5, 0)
[ 0 18  0  0]
AGACCTAACGTAGGTCCCAGGGTTAACGGGTGGACACCCATCTATATTAAGATGTAACCGGGCCAGTACTTCAGGCCGATGGCTTC

idx 4 locidx 202
65 G
70 (65, 5, 5, 0)
[ 0  0  0 25]
TCTCTCCAATACGTTGCCGAGTCGGGATTTAGACCATGGCTAACTTCGTGCAGAGTTGTAGTGGGGGTCGGGCCACCCAGAAATTT

idx 4 locidx 203
15 A
20 (15, 5, 5, 0)
[ 0 22  0  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 22]
68 T
73 (68, 5, 5, 0)
[ 0  0 22  0]
74 C
79 (74, 5, 5, 0)
[22  0  0  0]
CGACTCAGAGCTCATAGTGGACCCATGACGTAGACCAGTGGCGTGCGTTTAGTAGTGGTGTTGAACAGTAGCTCCCTGACGATCCT

NOT HERE
idx 4 locidx 205
1 T
6 (1, 5, 5, 0)
[ 0  0 18  0]
35 A
40 (35, 5, 5, 0)
[ 0 18  0  0]
38 C
43 (38, 5, 5, 0)
[18  0  0  0]
GTCGAGCAGGACCAAAGTATGCCCATCAAGGTAACACGCGCTCTCGCTTTATTTTGCCGCCGCCGGATGCAATGACCGTAAAACCG

idx 4 locidx 206
2 G
7 (2, 5, 5, 0)
[ 0  0  0 22]
3 T
8 (3, 5, 5, 0)
[ 0  0 22  0]
12 C
17 (12, 5, 5, 0)
[22  0  0  0]
13 T
18 (13, 5, 5, 0)
[ 0  0 22  0]
15 C
20 (15, 5, 5, 0)
[22  0  0  0]
18 T
23 (18, 5, 5, 0)
[ 0  0 22  0]
53 A
58 (53, 5, 5, 0)
[ 0 22  0  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 22  0]
GAGTAACAGACCCTACTCTACTCTGATCGCCGATGTCGATGAGGCTTGATCATAGGCAAACTAAGGCTCAGTCGTTGCTACTGTCG

idx 4 locidx 207
39 S
44 (39, 5, 5, 0)
[ 9  0  0 10]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 19]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 19]
70 C
75 (70, 5, 5, 0)
[19  0  0  0]
79 C
84 (79, 5, 5, 0)
[19  0  0  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
TTGGGAGTCCTTTGCACCCGGCAAGAACACGCCGTATCCSCGGCACCCGAGGGTTTGGAGACGGGGGGCTCAGTGCTGCCCGCATA

idx 4 locidx 208
5 A
10 (5, 5, 5, 0)
[ 0 21  0  0]
36 A
41 (36, 5, 5, 0)
[ 0 21  0  0]
74 C
79 (74, 5, 5, 0)
[21  0  0  0]
77 A
82 (77, 5, 5, 0)
[ 0 21  0  0]
81 C
86 (81, 5, 5, 0)
[21  0  0  0]
ACCCGACATCTAAGGTGGATAGTGTCCATTGTCCATAAATGGCACTGTGTCCAGTCAAACACCTAAAGTGAACGCCTACAACTGAG

idx 4 locidx 209
3 T
8 (3, 5, 5, 0)
[ 0  0 19  0]
15 G
20 (15, 5, 5, 0)
[ 0  0  0 19]
17 C
22 (17, 5, 5, 0)
[19  0  0  0]
36 A
41 (36, 5, 5, 0)
[ 0 19  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 19  0]
43 A
48 (43, 5, 5, 0)
[ 0 19  0  0]
79 A
84 (79, 5, 5, 0)
[ 0 19  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 19  0]
CTCTCTGTTGGCGACGGCTAATTGATCTCAGCACTCAGTTTAGAAACACACCTTCGTGTGAGGGCTGGCCGTCCCTTACAAAGCGT

idx 4 locidx 210
2 A
7 (2, 5, 5, 0)
[ 0 19  0  0]
11 A
16 (11, 5, 5, 0)
[ 0 19  0  0]
57 A
62 (57, 5, 5, 0)
[ 0 19  0  0]
76 C
81 (76, 5, 5, 0)
[19  0  0  0]
GGATTAAGGCAATCCGAGACCACTCACCGAGACTCTTACATTCTGCGCCCGACGCTGAGGGGCTGATATGGGTGGGCTATGTTCTG

idx 4 locidx 211
1 T
6 (1, 5, 5, 0)
[ 0  0 15  0]
23 A
28 (23, 5, 5, 0)
[ 0 15  0  0]
39 C
44 (39, 5, 5, 0)
[15  0  0  0]
54 G
59 (54, 5, 5, 0)
[ 0  0  0 15]
74 A
79 (74, 5, 5, 0)
[ 0 15  0  0]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 15]
79 C
84 (79, 5, 5, 0)
[15  0  0  0]
CTTGTCCAAAAGTTAGAATCGTGACAGGCCCCCAGTGGTCTGTGATACATTAGTGACACGTAATGAAGATATCAATGCGCATGGTG

NOT HERE
idx 4 locidx 213
1 A
6 (1, 5, 5, 0)
[ 0 21  0  0]
6 T
11 (6, 5, 5, 0)
[ 0  0 21  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 21  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 21  0]
48 A
53 (48, 5, 5, 0)
[ 0 21  0  0]
GAGCGATACAACGCCGCTCGGATGAACCTTTGACTTCCCTAAATAAATAGCTGATCCTACTAGCGGTCCGACGCTCACTACAATTT

idx 4 locidx 214
44 A
49 (44, 5, 5, 0)
[ 1 21  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 22  0]
CGGGTGACCCGAAACTTGTTGAAGCCCGGATGCTTTCAGACATTACTAGTGGTCGTACTCACGGTCGTGTCCCGATCGTGTTAAGG

idx 4 locidx 215
16 T
21 (16, 5, 5, 0)
[ 0  0 16  0]
51 A
56 (51, 5, 5, 0)
[ 0 16  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 16]
TCACTATCAATGGGAGTTTCAATCCTCATTACTCCACCTGCAACGAGTACCATATGGTAATCTCGGAGATCGAAGCTCTAGACAGT

idx 4 locidx 216
0 C
5 (0, 5, 5, 0)
[28  0  0  0]
6 T
11 (6, 5, 5, 0)
[ 0  0 28  0]
8 C
13 (8, 5, 5, 0)
[28  0  0  0]
21 A
26 (21, 5, 5, 0)
[ 0 28  0  0]
40 C
45 (40, 5, 5, 0)
[28  0  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 28]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 28]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 28]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 28]
CCTCTTTTCCTTGTAGTGGGAATATAAGGTAGCATGCCTACGATTTGGTCGGGAGTTATGGTTCCCTCAGGGTGGCGCGGCCTAAA

idx 4 locidx 217
14 C
19 (14, 5, 5, 0)
[14  0  0  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 14]
27 A
32 (27, 5, 5, 0)
[ 0 14  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 14  0]
GCGTAGTAAGCTTGCATGGGAGCGACCACCCGAACGAGATATCATTCACAACGTTATACATACACTGCGCTTCCCCGGCATATTGG

idx 4 locidx 218
31 A
36 (31, 5, 5, 0)
[ 1 21  0  0]
CAAAAGCATACGAAATTCCTAGACCGAGGGTACAGCGGAACGCCCCGCTATCTTATACTTTTAAGCATATACACGGGTACTAAGCT

idx 4 locidx 219
3 C
8 (3, 5, 5, 0)
[24  0  0  0]
10 G
15 (10, 5, 5, 0)
[ 0  0  0 24]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 24]
25 T
30 (25, 5, 5, 0)
[ 0  0 24  0]
73 S
78 (73, 5, 5, 0)
[11  0  0 13]
83 A
88 (83, 5, 5, 0)
[ 0 24  0  0]
TAGCTTATGAGGCTCCCTCGGGTTGTCCCGCCGGATGCTGGGCATACCTTAAGAGTGATGGCGACGACTGTATSTGAAAGCGCAGG

idx 4 locidx 220
34 T
39 (34, 5, 5, 0)
[ 0  0 20  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 20]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 20]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 20]
80 Y
85 (80, 5, 5, 0)
[10  0 10  0]
82 C
87 (82, 5, 5, 0)
[19  0  0  1]
CTCAATCAGCTGGCGCTGGTGTGCGGTAAACCGATCCGTATCAGCGTTGCCCACAGTTGCAAGCCCGCGATCAGAGCCAGYTCGAC

idx 4 locidx 221
18 A
23 (18, 5, 5, 0)
[ 0 22  0  0]
34 C
39 (34, 5, 5, 0)
[22  0  0  0]
52 C
57 (52, 5, 5, 0)
[22  0  0  0]
84 C
89 (84, 5, 5, 0)
[22  0  0  0]
GCCGTTTGCGACCCACTTATTGATTGGTGTCAGGCGGCCGTCCCCGTCGGGACCGTCGGTGAATCATCATTGGCAGGTCTAGCGCC

idx 4 locidx 222
11 T
16 (11, 5, 5, 0)
[ 0  1 24  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 25]
53 T
58 (53, 5, 5, 0)
[ 0  0 25  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 25  0]
TGGCATGGCATTGCCTCATGACCCCAAGTGGCTAGGGATACGGAAGGCCGTACTAATTGAACTTTGGATGGTCTGAGGCCTCCCAT

idx 4 locidx 223
30 T
35 (30, 5, 5, 0)
[ 0  0 18  0]
63 C
68 (63, 5, 5, 0)
[18  0  0  0]
TTTTGTATTACCAGCATAGCCAGTGTTAATTGTGCGACCAAGTCCCAAGTAGTATACCACTATCTATGGGGAATGATTAGGTTGGG

idx 4 locidx 224
30 A
35 (30, 5, 5, 0)
[ 0 22  0  0]
CGATGAAACCAATTTCTCAAGAGTTATACCACTTAGGCCGACTGAGACGGGCCGTTGGACTTACTCGGAAGCGCTACTCTGAGGTG

idx 4 locidx 225
60 G
65 (60, 5, 5, 0)
[ 0  0  0 15]
GCGTCCTCTTATACGTTTCTCTGCCAGCATATCAACGGCAGTTCTTGGTTCTGCGGTTTGGCCTGGCTAGAACTTTCTAGTTACTT

idx 4 locidx 226
34 A
39 (34, 5, 5, 0)
[ 0 18  0  0]
GACACATCGACTAGTATGCTATGGCCGGAAATCAAAGATTTCCATGGTGATCTTAGTTCTTTCCCTGGTTTGCTATGAAACAATCA

idx 4 locidx 227
32 C
37 (32, 5, 5, 0)
[19  0  0  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 19  0]
67 T
72 (67, 5, 5, 0)
[ 0  0 19  0]
74 A
79 (74, 5, 5, 0)
[ 0 19  0  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 19]
GGCGTAGCTCAAAATCTTTTCGTGTTCAATCGCGACTATCGTCTTGTGACAAGCGTCCCCTTCTATCTTCGTCTAGTGAGGCACCA

idx 4 locidx 228
27 C
32 (27, 5, 5, 0)
[20  0  0  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 20  0]
41 C
46 (41, 5, 5, 0)
[20  0  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 20  0  0]
48 T
53 (48, 5, 5, 0)
[ 0  0 20  0]
54 G
59 (54, 5, 5, 0)
[ 0  0  0 20]
64 C
69 (64, 5, 5, 0)
[20  0  0  0]
68 C
73 (68, 5, 5, 0)
[20  0  0  0]
CGTTTAGTTCTGGAGTATATTCCGATCCTTTCACTGTCGCTCAAATAATAGCGCGAGGGAGTTACCAGCTGTTTCTAGGTAAATGC

idx 4 locidx 229
32 G
37 (32, 5, 5, 0)
[ 0  0  0 18]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 18]
66 T
71 (66, 5, 5, 0)
[ 0  0 18  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 18  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 18  0]
AAACAAAATACGGACACCGCGTTTACGATGTTGTGGAACACGACCCCACTTTTCGATTGTGGACAGTGCCCTTTTGTGTCACCCAT

idx 4 locidx 230
16 C
21 (16, 5, 5, 0)
[20  0  0  0]
ATACACTGGACAGAGTCTTCATGATTACAACTATGAGGACTCACTTAAAGGTCCGGAATACAAGCTCTCTAACGTTCTCACCCGGG--

idx 4 locidx 231
2 T
7 (2, 5, 5, 0)
[ 0  0 15  0]
18 C
23 (18, 5, 5, 0)
[15  0  0  0]
20 C
25 (20, 5, 5, 0)
[15  0  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 15  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 15]
71 C
76 (71, 5, 5, 0)
[15  0  0  0]
ACTGTATGCGCTTTCGGACTCGGGAAATGCGGTCTGCGCCCACGGACGCGAGAAGTCGAGCGTAGCTCATTCGCCGGCATCACTAG

idx 4 locidx 232
5 C
10 (5, 5, 5, 0)
[21  0  0  0]
37 C
42 (37, 5, 5, 0)
[21  0  0  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 21]
44 T
49 (44, 5, 5, 0)
[ 0  0 21  0]
45 C
50 (45, 5, 5, 0)
[21  0  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 21]
55 A
60 (55, 5, 5, 0)
[ 0 21  0  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 21]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 21]
AGCCTCTGTATCTTCCGGTGGACTTCCTGTAAGGTATCTTGGGGTCTGTGTAGCGATGAGGGAAGGCTAAGTGTCCTGCGGGGATC

idx 4 locidx 233
20 C
25 (20, 5, 5, 0)
[17  0  0  0]
24 C
29 (24, 5, 5, 0)
[17  0  0  0]
28 A
33 (28, 5, 5, 0)
[ 0 17  0  0]
35 A
40 (35, 5, 5, 0)
[ 0 17  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 17]
69 A
74 (69, 5, 5, 0)
[ 0 17  0  0]
TACGACTCCGTTCCCTATGCCGCACGTAAAGAGGCACGCGCTCGAAAAGTTGTTATCCGCGGACCGGATACAGCAAACTAACTTGT

idx 4 locidx 234
3 T
8 (3, 5, 5, 0)
[ 0  0 17  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 17  0]
TATTCAGACACGTAAGCGCGGCTCTATCTTACACGTATCCGGGAGACTTTAGTCCTTGCTGGGTATAAATGCAGGTGCACTTGGAC

idx 4 locidx 235
13 C
18 (13, 5, 5, 0)
[17  0  0  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 17]
67 C
72 (67, 5, 5, 0)
[17  0  0  0]
AGACACCTTGAATCTCGATCTTCCAGGCTTGATAGAATTCAAAGTCGGGGATACCGGTCCGCAATTACTCACCGCCCCCCCACATA

idx 4 locidx 236
69 T
74 (69, 5, 5, 0)
[ 0  0 20  0]
73 T
78 (73, 5, 5, 0)
[ 0  0 20  0]
AGCTATAAACTGGGATGGTAATAGATGAGGCACTACGGGGGTCCGTTCGTCAGAGCTCACGGCGCGCGCTTACTCAGCGCTATCGG

idx 4 locidx 237
4 T
9 (4, 5, 5, 0)
[ 0  0 22  0]
15 C
20 (15, 5, 5, 0)
[22  0  0  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 22  0]
35 C
40 (35, 5, 5, 0)
[22  0  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 22  0  0]
62 A
67 (62, 5, 5, 0)
[ 0 22  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 22]
68 A
73 (68, 5, 5, 0)
[ 0 22  0  0]
TCGGTGTGTCAATGGCTTCTGTCACCTCTGTGGTCCTACTACAAAAGACAAAAGTTCCACGTAATATGATACTCTTCGAGGAGATC

idx 4 locidx 238
4 A
9 (4, 5, 5, 0)
[ 0 17  0  0]
17 C
22 (17, 5, 5, 0)
[17  0  0  0]
46 C
51 (46, 5, 5, 0)
[17  0  0  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 17]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 17]
78 A
83 (78, 5, 5, 0)
[ 0 17  0  0]
TGGGACCCGACCCTGAGCTCTCGGTGGATGGACGGGGTATTAGTGGCATCTGGGACTGACTCCAAAGAAGCATGGCCTAGTTTGCG

idx 4 locidx 239
7 T
12 (7, 5, 5, 0)
[ 0  0 19  0]
10 W
15 (10, 5, 5, 0)
[ 0 12  7  0]
26 A
31 (26, 5, 5, 0)
[ 0 19  0  0]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 19]
32 A
37 (32, 5, 5, 0)
[ 0 19  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 19  0]
47 W
52 (47, 5, 5, 0)
[ 0 12  7  0]
54 A
59 (54, 5, 5, 0)
[ 0 19  0  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 19  0]
TAAGATGTACWAAGGATGATCTGAACATGGCCAGTACTAGTAGTGGGWGTTTGAATGAAAAAGCAGGTTGTAAGTTTACGTGAATC

idx 4 locidx 240
10 A
15 (10, 5, 5, 0)
[ 0 17  0  0]
32 A
37 (32, 5, 5, 0)
[ 0 17  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 17  0]
CCTATGCGCCAGGTGCTAGTACGAGTACGGAAACTATGCGACAGAAAGCGGAGCACGAGATTGGAAAACCATAATTGCGGCATCAT

idx 4 locidx 241
29 T
34 (29, 5, 5, 0)
[ 0  0 20  0]
35 C
40 (35, 5, 5, 0)
[20  0  0  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 20  0]
62 C
67 (62, 5, 5, 0)
[20  0  0  0]
82 A
87 (82, 5, 5, 0)
[ 0 20  0  0]
TGATCCGCGGTGTAGATAGTCGTTATCTATAGCTACAACATACCGACCGTGTGCTCTTAAGCCTTTCACTAAAGATTTATTCAGGA

idx 4 locidx 242
19 R
24 (19, 5, 5, 0)
[ 0 11  0  9]
20 C
25 (20, 5, 5, 0)
[20  0  0  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 20  0]
72 C
75 (72, 5, 5, 2)
[20  0  0  0]
79 C
82 (79, 5, 5, 2)
[20  0  0  0]
GACTTGCCATTCACCAGAARCGGCATGATCTGCCGACGCTCCAGGGCCAATACAA-CACTAGTCGG-AAAGCCGTTCCACACACTACT

idx 4 locidx 243
11 C
16 (11, 5, 5, 0)
[21  0  0  0]
16 G
21 (16, 5, 5, 0)
[ 0  0  0 21]
19 A
24 (19, 5, 5, 0)
[ 0 21  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 21]
29 T
34 (29, 5, 5, 0)
[ 0  0 21  0]
48 C
53 (48, 5, 5, 0)
[21  0  0  0]
78 Y
83 (78, 5, 5, 0)
[ 9  0 12  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 21]
CAGAACTTCTACCCTAGAAATTAAGGAGCTTCCCTCTAACTCAGGTTACCGACGTTCCCGGACGACGACTAAGTCAACYACCGAGG

idx 4 locidx 244
4 T
9 (4, 5, 5, 0)
[ 0  0 21  0]
19 C
24 (19, 5, 5, 0)
[21  0  0  0]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 21]
54 M
59 (54, 5, 5, 0)
[11 10  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 21  0]
CATCTGCCCCGATCTTCAACGCCTAGGCGGAAAGGAACTTTGGGGCCTGTCCGGMGAGCCTTGCGATCGCACTCCAAAGAACCCTG

idx 4 locidx 245
2 G
7 (2, 5, 5, 0)
[ 0  0  0 20]
45 T
50 (45, 5, 5, 0)
[ 0  0 20  0]
68 A
73 (68, 5, 5, 0)
[ 0 20  0  0]
TGGCCAGGTGTCTATTCTACCCGCGTGAAGCCGTTAGTCTAACCCTATGGTTGGGCCGATTGCATGTGATGCACTTAGGGCTAACA

idx 4 locidx 246
22 A
27 (22, 5, 5, 0)
[ 0 19  0  0]
TGGAGGCAACATAAATCCGCCGAGATAGGATAAATTGTTCACCTTGCCGAGACTCGGACCTGGCGAGTTACGTCAGTGCGTCATTA

idx 4 locidx 247
64 A
69 (64, 5, 5, 0)
[ 0 22  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 22  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 22]
ATCTCAAACCAAGACATTCTGTACGAAGAGTAGAGGCTACATGTCCTCGGTCCACTGTCAGGGGAGCTTAAAGTCAGATAATCTGA

idx 4 locidx 248
4 G
9 (4, 5, 5, 0)
[ 0  0  0 21]
12 G
17 (12, 5, 5, 0)
[ 0  0  0 21]
32 C
37 (32, 5, 5, 0)
[21  0  0  0]
TGCAGGGGGCGAGTGTGGAACTGACTAAATACCACTGGAATGCGTGTGTCGGCGCAAGGTGCACGAAAGGAGCAGCAACACTCCCC

idx 4 locidx 249
1 A
6 (1, 5, 5, 0)
[ 0 21  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 21  0]
85 A
90 (85, 5, 5, 0)
[ 0 21  0  0]
CAGTCGTCTCGAACATTAAGGTCCATTATCGTACTGACGAACTGCGACGATACAGGATTGGACGGATATCCACCAGGGCCACATCA

idx 5 locidx 250
14 G
19 (14, 5, 5, 0)
[ 0  0  0 19]
47 T
52 (47, 5, 5, 0)
[ 0  0 19  0]
48 A
53 (48, 5, 5, 0)
[ 0 19  0  0]
GTTTTATTATAAGTGAGTTCTTTCACAGTACTTAGGTTGTCCTCGAGTAGACTAGAGACCGCCTTTATTCACGAAAGCCTCAACTA

idx 5 locidx 251
4 C
9 (4, 5, 5, 0)
[21  0  0  0]
22 C
27 (22, 5, 5, 0)
[21  0  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 21  0]
CAGTCAACGTCACTCGTAATCACCACCCTCTAATAGCGCAGGAGATCGAGGACGCAAGCAACCTTTCAAGTGGGGTTGTTTCAACC

NOT HERE
idx 5 locidx 253
8 A
13 (8, 5, 5, 0)
[ 0 22  0  0]
9 W
14 (9, 5, 5, 0)
[ 0 13  9  0]
27 W
32 (27, 5, 5, 0)
[ 0 13  9  0]
50 A
55 (50, 5, 5, 0)
[ 0 22  0  0]
CTCACAGCAWTATGCAACTGGTACGCCWGCGTACAGGCGTTGAAATCTCTAACGTATTCGCCGCGGTCTGGTGGCAGATCGACACG

idx 5 locidx 254
21 A
26 (21, 5, 5, 0)
[ 0 19  0  0]
23 A
28 (23, 5, 5, 0)
[ 0 19  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 19  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 19]
82 A
87 (82, 5, 5, 0)
[ 0 19  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 19  0  0]
GCGTGGTGCAACTATAGGCACACATCGCTGAGTAGGCTCTCTGATCGTGTGTTCCGGCACAGATGAAGTCCGTTCCTCTGGTAATA

idx 5 locidx 255
29 T
34 (29, 5, 5, 0)
[ 0  0 22  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 22  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 22  0]
65 A
70 (65, 5, 5, 0)
[ 0 21  0  1]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 22]
83 C
88 (83, 5, 5, 0)
[22  0  0  0]
TTCTAAGATTAGTGGCCGGACTTATCAATTGCGAGAAGTCAGGGCCAGGCACGCGATCTATGTTTACGCTAAGACAAAGCTCGCCA

idx 5 locidx 256
31 C
36 (31, 5, 5, 0)
[23  0  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 23]
51 A
56 (51, 5, 5, 0)
[ 0 23  0  0]
61 C
66 (61, 5, 5, 0)
[23  0  0  0]
GTGCGAATTAATGATCGGTACCTTTACACCACGTATACAGTGCTTCGCTGCAATGGCCCAACGATCGAGCCTTCACGGTATGTCCA

idx 5 locidx 257
20 Y
25 (20, 5, 5, 0)
[ 9  0 10  0]
31 s
36 (31, 5, 5, 0)
[ 9  0  0 10]
38 A
43 (38, 5, 5, 0)
[ 0 19  0  0]
41 T
46 (41, 5, 5, 0)
[ 0  0 19  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 19]
49 A
54 (49, 5, 5, 0)
[ 0 19  0  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 19  0]
85 A
90 (85, 5, 5, 0)
[ 0 19  0  0]
AGATATCTTCCAAATGGTACYCTCGCCGTGAsACCTATAATTCCCGGAGATGCCAGAATATACATCCCAACCAGTCAGTGGTTACA

idx 5 locidx 258
19 A
24 (19, 5, 5, 0)
[ 0 21  0  0]
30 T
35 (30, 5, 5, 0)
[ 0  0 21  0]
35 C
40 (35, 5, 5, 0)
[21  0  0  0]
51 A
56 (51, 5, 5, 0)
[ 0 21  0  0]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 21]
72 C
77 (72, 5, 5, 0)
[21  0  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 21  0]
AAATCCGGGAGCGGGTGCGAACTATGGGCATTAACCCTGGAGGTTCGCCACAAGCTGGGGGTCTCCCCTTGTCCGGTGCAAGAGAT

idx 5 locidx 259
55 A
60 (55, 5, 5, 0)
[ 0 18  0  0]
76 C
81 (76, 5, 5, 0)
[18  0  0  0]
GCGACCATGTATGGATGTCGCAAACTGCCCACATGACACTAAAGGTTATACGCTTAGTCCCGTGACAGCTATCGGTCCCTTTGAAA

idx 5 locidx 260
11 A
16 (11, 5, 5, 0)
[ 0 18  0  0]
12 T
17 (12, 5, 5, 0)
[ 0  0 18  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 18  0]
65 C
70 (65, 5, 5, 0)
[18  0  0  0]
CTAGAGCCAGGATGGTGCGGAGGGAAAGTTTTTATTTTCCGATACCTCGTAGCGAATCCGCTGCCCAGTTGCATCAACAGGCGTAG

idx 5 locidx 261
19 T
24 (19, 5, 5, 0)
[ 0  0 16  0]
22 A
27 (22, 5, 5, 0)
[ 0 16  0  0]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 16]
TGGCTCTAGCCTAGGTTGCTTAACGGATTTAACCACCGTTAGTACCTGAATACGGCTAGACGCTTATGCGGGTCTTTAGGCCTTAT

idx 5 locidx 262
28 T
33 (28, 5, 5, 0)
[ 0  0 24  0]
62 A
67 (62, 5, 5, 0)
[ 0 24  0  0]
68 A
73 (68, 5, 5, 0)
[ 0 24  0  0]
AACCACAGACCCAAGTAGATAAGATAAATCCGCCGAAGGCTTCGAGATGAACTATGTATGCCAGATTAACAAGGAAGCGGAGCATG

idx 5 locidx 263
20 T
25 (20, 5, 5, 0)
[ 0  0 19  0]
21 C
26 (21, 5, 5, 0)
[19  0  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 19]
CGGGATTCAGCGCCTGTGAATCACACAGTTTCGTTTGTTAAAGACCGAGGCGATTAGGTATATACTCGAGGTGACGACTTTAGGGA

idx 5 locidx 264
47 G
52 (47, 5, 5, 0)
[ 0  0  0 22]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 22]
67 T
72 (67, 5, 5, 0)
[ 0  0 22  0]
TAGTAAAAAGTAGAATACTCAGAGCACGGTTTCTCAAATCGCGCGATGAACATATCCTACACCTGTCTCTCGTACTAACGTGTCAC

idx 5 locidx 265
38 T
43 (38, 5, 5, 0)
[ 0  0 25  0]
43 A
48 (43, 5, 5, 0)
[ 0 25  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 25  0]
63 A
68 (63, 5, 5, 0)
[ 0 25  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 25  0]
GTCCTGATGTGCCCCCACTGAATACGTCTAGTAGCAATTAGGAATGAGTGGGTTTGACATATTAGTAGCACAAAGTCCCTACCTAG

idx 5 locidx 266
9 T
14 (9, 5, 5, 0)
[ 0  0 22  0]
18 A
23 (18, 5, 5, 0)
[ 0 22  0  0]
37 C
42 (37, 5, 5, 0)
[22  0  0  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 22]
CAGTTCTATTCTAAGAGGACCGTTCTCTGGGAAGAATCCGGACGCGTGACACACGTCACTCAGCAGTCGTGCTTGTTTATTAGACC

idx 5 locidx 267
16 C
21 (16, 5, 5, 0)
[20  0  0  0]
24 G
29 (24, 5, 5, 0)
[ 0  0  0 20]
32 C
37 (32, 5, 5, 0)
[20  0  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 20]
49 A
54 (49, 5, 5, 0)
[ 0 20  0  0]
62 A
67 (62, 5, 5, 0)
[ 0 20  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 20  0]
CATTAGGGCAATTTCGCGACAGTCGGAAGCTACGCCGGGACAACGAGTCAAAAATACCGCGAACGCTTCAGGATGATATTTAGTTG

idx 5 locidx 268
3 T
8 (3, 5, 5, 0)
[ 0  0 17  0]
52 A
57 (52, 5, 5, 0)
[ 0 17  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 17  0  0]
CCGTAGGGAATGAAATAACTACCTGTGCCGCCCTCTATGGGCGAGGTTCCCAAAACAACTAGAGTAGTATAGGTAGGGAAGGCTGC

idx 5 locidx 269
11 A
16 (11, 5, 5, 0)
[ 0 21  0  0]
19 C
24 (19, 5, 5, 0)
[21  0  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 21  0  0]
42 A
47 (42, 5, 5, 0)
[ 0 21  0  0]
51 C
56 (51, 5, 5, 0)
[21  0  0  0]
81 C
86 (81, 5, 5, 0)
[21  0  0  0]
ATACCTAGGGTACCATTTTCCCATCACGCAGGCGCTCTGGCTATACGGTTCCATGCGTGAATTTTAAGCGCCGATAAGGCCCGGCG

idx 5 locidx 270
0 G
5 (0, 5, 5, 0)
[ 0  0  0 19]
9 T
14 (9, 5, 5, 0)
[ 0  0 19  0]
20 C
25 (20, 5, 5, 0)
[19  0  0  0]
56 C
61 (56, 5, 5, 0)
[19  0  0  0]
76 C
81 (76, 5, 5, 0)
[19  0  0  0]
GGTTTGTAATCACCGCCCTTCGTTTCTCTCTCGTTTCCGTGGGGCTCCGAATTGCCCTGGTACTCTAAAGTCACATCGTAAGTAAA

idx 5 locidx 271
15 A
20 (15, 5, 5, 0)
[ 0 21  0  0]
18 A
23 (18, 5, 5, 0)
[ 0 21  0  0]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 21]
49 A
54 (49, 5, 5, 0)
[ 0 21  0  0]
53 C
58 (53, 5, 5, 0)
[21  0  0  0]
83 C
88 (83, 5, 5, 0)
[21  0  0  0]
TGGCCAGCGCCGTCAAAAACGGTCATGTCTGACAGTATGAAGTCATGAGACCCCGGGAAGGTTGGTACCACGCTGACATTATCCAC

idx 5 locidx 272
1 C
6 (1, 5, 5, 0)
[18  0  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 18  0]
61 K
66 (61, 5, 5, 0)
[0 0 9 9]
75 T
80 (75, 5, 5, 0)
[ 0  0 18  0]
ACGTTTTGCCGTAATGGTTTCGGACACATTGGCCTTTTGCGTCTCCAGTTTGACGTCGAATKTGCAGGTATGTAGTAACCCCGATC

idx 5 locidx 273
27 T
32 (27, 5, 5, 0)
[ 0  0 23  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 23  0]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 23]
40 A
45 (40, 5, 5, 0)
[ 0 23  0  0]
60 A
65 (60, 5, 5, 0)
[ 0 23  0  0]
73 C
78 (73, 5, 5, 0)
[23  0  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 23  0]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 23]
GCTTCAGCCAGCCTCCGATGTTTTTGGTTATCTGGGCATTAGCCGGGAAAAACTACGACCATGCACCAATGTACTTACCGGGTACG

idx 5 locidx 274
21 A
26 (21, 5, 5, 0)
[ 0 22  0  0]
27 A
32 (27, 5, 5, 0)
[ 0 22  0  0]
GCGTAATGTGGGTCGACCGCCAAAAACATAAAGAGACTAGCCGCTCCTATACACGCGCAGTGAAGCCCGTATACATGGAAATTTTG

idx 5 locidx 275
81 C
86 (81, 5, 5, 0)
[23  0  0  0]
AGCGCTGTAAGTACGAAACGCTACTCGAGCTCTACCGTCCATTCAGCCTACCTTACGTGTATTATAGGTTAGACCGACACCCGGCC

idx 5 locidx 276
35 R
40 (35, 5, 5, 0)
[ 0 14  0 10]
38 y
43 (38, 5, 5, 0)
[10  0 14  0]
54 A
59 (54, 5, 5, 0)
[ 0 24  0  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 24  0]
CCCCAATGGATCGGCGCACGTCCAGATACGGTGGCRTCyAGCCTCTATTTGCTCAAAGGAAGATATTGTTCAGTTTTATCCAGCCG

idx 5 locidx 277
57 T
62 (57, 5, 5, 0)
[ 0  0 18  0]
68 A
73 (68, 5, 5, 0)
[ 0 18  0  0]
CACTTCAGACTCTAAAACGGCGCTCTAAATCTATAGAGATCCCGGCGACTTTTCGGATAAGTTCGGTTACCGTTTACCACGACCCA

idx 5 locidx 278
32 G
37 (32, 5, 5, 0)
[ 0  0  0 18]
GATAGCTCTGACGTAGATCCCTACCTGATGCGGCCGTTAAGTCATTGCTGCGCACGGATTCAGCAACTTTTCGCATAGTGATAATT

idx 5 locidx 279
21 G
26 (21, 5, 5, 0)
[ 0  0  0 17]
40 A
45 (40, 5, 5, 0)
[ 0 17  0  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 17  0]
ATGGGTGAATCTACTATAGCCGTCCCAACCGGGACCGTTGATTCCTAGGAGGATGCAGCGGAGCTTAAATGTGGACCTTCCTCACT

idx 5 locidx 280
23 A
28 (23, 5, 5, 0)
[ 0 19  0  0]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 19]
50 T
55 (50, 5, 5, 0)
[ 0  0 19  0]
71 C
76 (71, 5, 5, 0)
[19  0  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 19  0  0]
83 C
88 (83, 5, 5, 0)
[19  0  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 19  0  0]
ACTCTTCCTCGTTGGGGTTTGAGATAACCACCTCCTGACCTCATCAAACTTTCGTCCCTGGCAACGGGCCGCGTAGCACCTATCCA

idx 5 locidx 281
4 G
9 (4, 5, 5, 0)
[ 0  0  0 20]
6 A
11 (6, 5, 5, 0)
[ 0 20  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 20]
72 A
77 (72, 5, 5, 0)
[ 0 20  0  0]
CGGAGGATCAATAGGCATATACCGCAGATTCCCCCGGAGTTACATGGATAGCTGTCGTGCATACTACGAGTAAGTCTAGCCTGCGC

idx 5 locidx 282
11 T
16 (11, 5, 5, 0)
[ 0  0 21  0]
28 A
33 (28, 5, 5, 0)
[ 0 21  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 21  0  0]
57 A
62 (57, 5, 5, 0)
[ 0 21  0  0]
72 C
77 (72, 5, 5, 0)
[21  0  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 21  0  0]
AGCGATTTCGGTGCAAGGCTCCCGGTTAACTAGGATATACGCTGAGGTCCGACAAAAAACGCTAATAAGTTCCAGCAGCTATACTC

idx 5 locidx 283
45 G
50 (45, 5, 5, 0)
[ 0  0  0 23]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 23]
79 C
84 (79, 5, 5, 0)
[23  0  0  0]
GGAAGCTCTATTAGTCACTCGCGGGAGAACGGGGGTTAGCCGGGGGCCAGCTCGGAGCCTACTAATAAGTCGTGCACTTCGCAAAG

idx 5 locidx 284
73 G
78 (73, 5, 5, 0)
[ 0  0  0 20]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 20]
TTAGCGGTACGTTCGCAGCTCGGCCATAAAGCTCCCTGAGCAGATGTGCCACATCGCTGCGGAGACGACGGTAGAGAGAGGGACGA

idx 5 locidx 285
77 C
82 (77, 5, 5, 0)
[16  0  0  0]
CACTCTAGAGGGACCCAATGGTCCCAATAGTCAATATCTGGAAGCGTCTTGAATCCCCGGGGCTCCGAAGGGAAGTGCAGGAGACG

idx 5 locidx 286
3 A
8 (3, 5, 5, 0)
[ 0 14  0  0]
9 A
14 (9, 5, 5, 0)
[ 0 14  0  0]
TAGACTTAAAACAAGGCTCTATGGCCCTGGTTATAAATCCATCAGAGAAGTATTTGTCTCCTAGGGTAAATTTATCAAGCACCGGG

idx 5 locidx 287
10 G
15 (10, 5, 5, 0)
[ 0  1  0 20]
11 T
16 (11, 5, 5, 0)
[ 0  0 21  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 21]
49 C
54 (49, 5, 5, 0)
[21  0  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 21  0]
53 A
58 (53, 5, 5, 0)
[ 0 21  0  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 21]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 21]
AGGACCTTTCGTAACTGAGACATGAATGAAGAAGTCACACAGCGCTGAACAGTAAGGGGGAGCACACTTCGCTCGATCCCGTACCG

idx 5 locidx 288
15 C
20 (15, 5, 5, 0)
[17  0  0  0]
40 T
45 (40, 5, 5, 0)
[ 0  0 17  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 17]
73 C
78 (73, 5, 5, 0)
[17  0  0  0]
ACGGAATTAAGTATCCCGTCTTAATCGCCTCCACTCCTGCTAGCCAACAGTGGAGATTAAGACTTCGGCCCACCACTGTATCAGCT-

idx 5 locidx 289
0 A
5 (0, 5, 5, 0)
[ 0 23  0  0]
24 C
29 (24, 5, 5, 0)
[23  0  0  0]
56 A
61 (56, 5, 5, 0)
[ 0 23  0  0]
ACGCGCGCATTAGTTAATCGGGCGCGAGGAAACGTAGCAGCAAGTATTTCAGTAAAATTCCCCTGCCCGCGAAATGCTCAACCGGA

idx 5 locidx 290
6 G
11 (6, 5, 5, 0)
[ 0  0  0 20]
20 A
25 (20, 5, 5, 0)
[ 0 20  0  0]
70 T
75 (70, 5, 5, 0)
[ 0  0 20  0]
CAACCCGACTAAGATGGCTTACGTATGGGTACTAGCAGGTATATTAACGTTGTACGACAGTGCCTATACTTTCCAGTGCATCGGGG

idx 5 locidx 291
17 A
22 (17, 5, 5, 0)
[ 0 18  0  0]
39 C
44 (39, 5, 5, 0)
[18  0  0  0]
42 R
47 (42, 5, 5, 0)
[ 0 12  0  6]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 18]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 18]
58 T
63 (58, 5, 5, 0)
[ 0  0 18  0]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 18]
AGTGTGTTGCCAAGTGAAGACCTCCCCTTATCACATGATCTTRCCTCGGGTCGATGGATACGATTGCTGCGTTCAAAATGAGCTAC

idx 5 locidx 292
5 C
10 (5, 5, 5, 0)
[22  0  0  0]
20 C
25 (20, 5, 5, 0)
[22  0  0  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 22]
85 C
90 (85, 5, 5, 0)
[22  0  0  0]
CATACCGACCATAGCTCGCACGGTTAAAGCAGAGTCGTACCTTCTGTCGCTGGAGAAGGCACGAGAGACTGGTATGCTAGTTGATC

idx 5 locidx 293
10 G
15 (10, 5, 5, 0)
[ 0  0  0 19]
54 T
59 (54, 5, 5, 0)
[ 0  0 19  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 19]
GAGTGTTATTGATAATTGGCGTCCGTCCTGACATCGAGCCGAGGGCAGGAACCTTGAGAAGCAAGACCCACCTGAGGGAGGCTCGC

idx 5 locidx 294
7 G
12 (7, 5, 5, 0)
[ 0  0  0 13]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 13]
79 C
84 (79, 5, 5, 0)
[13  0  0  0]
ATTGAAAGGCGAGACTGTAGAATTCATCTGGATTTCTGGATGTTGGGTGTTGAAGTCAAAAAGTCAGGAACTACGCTAGCTAGCAG

idx 5 locidx 295
4 C
9 (4, 5, 5, 0)
[22  0  0  0]
11 G
16 (11, 5, 5, 0)
[ 0  0  0 22]
16 T
21 (16, 5, 5, 0)
[ 0  0 22  0]
28 C
33 (28, 5, 5, 0)
[22  0  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 22  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 22]
76 C
81 (76, 5, 5, 0)
[22  0  0  0]
CCCACACTCAAGCCAGTACGCTTGGACACGGAGTCCCTCGAATTCGACCATGAAAAGGGCCAATAGGTTCAGGTTGCGTTTCGTCA

idx 5 locidx 296
27 C
32 (27, 5, 5, 0)
[19  0  0  0]
30 C
35 (30, 5, 5, 0)
[19  0  0  0]
33 C
38 (33, 5, 5, 0)
[19  0  0  0]
CCAAAGAGCATAATAGAGCATAAGTCTCTGCGGCCTTAGTCGCAGTTAAGCGACAGTCGCTCAGGCCAACGAGGAATTAGCCCCCT

idx 5 locidx 297
23 G
28 (23, 5, 5, 0)
[ 0  0  0 19]
28 A
33 (28, 5, 5, 0)
[ 0 19  0  0]
42 A
47 (42, 5, 5, 0)
[ 0 19  0  0]
45 A
50 (45, 5, 5, 0)
[ 0 19  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 19  0  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 19]
82 T
87 (82, 5, 5, 0)
[ 0  0 19  0]
ATCCCTCGTCAAACAGTCAAATGGATAGAACCCAATGCTATTATTAGGGCTTGGAGAACGTCTATACTGCCGGTAGCGCGCATCGC

idx 5 locidx 298
50 A
55 (50, 5, 5, 0)
[ 0 19  0  0]
66 A
71 (66, 5, 5, 0)
[ 0 19  0  0]
71 T
76 (71, 5, 5, 0)
[ 0  0 19  0]
72 C
77 (72, 5, 5, 0)
[19  0  0  0]
CGCCTCCAGTGGAAACTCGTAAGTGTGACGTCACTGTACATTTAAGAGCAAACTTCTATGAGCACGATCGGTCCTGAGTTACGATG

idx 5 locidx 299
32 C
37 (32, 5, 5, 0)
[19  0  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 19  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 19  0]
CCCAGGAAAATGAATGCGACGCACAGGACGGTCCGTTGTTGATAGCCTGCGATGCTTGTGCAAATGGACGTCAGACACTGAACCGG

idx 6 locidx 300
7 G
12 (7, 5, 5, 0)
[ 0  0  0 21]
48 C
53 (48, 5, 5, 0)
[21  0  0  0]
GAAGATAGTCTCGTACTGTGTATGTCTTTAGGCCTGACCGCAACCATACGTTATTTCACAAAGTCCTGACGAATGCCAACATTTAC

idx 6 locidx 301
36 C
41 (36, 5, 5, 0)
[21  0  0  0]
TTCGGGGCCGCCTCTGAGTGCGTCGAGATTTGGTGTCTAATGGGACGACGTTGAGGAGGGCCTCGGAGATCACCAATGAACGTGCC

idx 6 locidx 302
5 A
10 (5, 5, 5, 0)
[ 0 17  0  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 17]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 17]
51 C
56 (51, 5, 5, 0)
[17  0  0  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 17]
59 A
64 (59, 5, 5, 0)
[ 0 17  0  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 17]
TTTATATCCTGGTGCTCGGATCCCCAATCAGCGGCGCAATTAAGGGCATAGCAGAAGGGAACGGGACGCGGACAGAATAGCATCAT

idx 6 locidx 303
3 C
8 (3, 5, 5, 0)
[20  0  0  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 20]
42 T
47 (42, 5, 5, 0)
[ 0  0 20  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 20  0]
69 A
74 (69, 5, 5, 0)
[ 0 20  0  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 20]
83 A
88 (83, 5, 5, 0)
[ 0 20  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 20]
AATCTCGTGCTTATCTGGGTAGGACTTACGCTAGCGCGCACATCGTCGAATGGGAGCCGCTAGACGTTGATGCACACTTCTAGAGG

idx 6 locidx 304
3 T
8 (3, 5, 5, 0)
[ 0  0 22  0]
15 T
20 (15, 5, 5, 0)
[ 0  0 22  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 22]
68 A
73 (68, 5, 5, 0)
[ 0 22  0  0]
ACGTGCATGCTATCATGCTAATATCCCGGGGAGCCTCGTCGTGACTGCTTGGTTCCTGAAATCTTATTAACTCCCGCATGTCCGCC

idx 6 locidx 305
6 A
11 (6, 5, 5, 0)
[ 0 21  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 21]
52 A
57 (52, 5, 5, 0)
[ 0 21  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 21  0  0]
GATCAGATCGGAGGGAAGCTAGCGAACTGTCCTGACCGTGATTTTTGTGTCAAAAGACGCCTGTAGCAGGGGAATGGGACCATACG

idx 6 locidx 306
1 T
6 (1, 5, 5, 0)
[ 0  0 21  0]
8 A
13 (8, 5, 5, 0)
[ 0 21  0  0]
12 C
17 (12, 5, 5, 0)
[21  0  0  0]
22 C
27 (22, 5, 5, 0)
[21  0  0  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 21]
CTAATTGAATATCATCGATTTCCAAAGTTATTTGTGATCCAGGTGGACAAGAAGGTCATCGGATGGCGGTTGTGGAAGGATCTAGT

idx 6 locidx 307
7 C
12 (7, 5, 5, 0)
[17  0  0  0]
25 T
30 (25, 5, 5, 0)
[ 0  0 17  0]
48 C
53 (48, 5, 5, 0)
[17  0  0  0]
50 C
55 (50, 5, 5, 0)
[17  0  0  0]
62 C
67 (62, 5, 5, 0)
[17  0  0  0]
68 C
73 (68, 5, 5, 0)
[17  0  0  0]
CTCCGAACTCAGGTAGTGGACACGGTCTGCAACTTGGTATGCTTTATCCCCCATGCACGCCACTTCATCGGCGACTCTGGATAATG

idx 6 locidx 308
25 A
30 (25, 5, 5, 0)
[ 0 16  0  0]
41 C
46 (41, 5, 5, 0)
[16  0  0  0]
60 A
65 (60, 5, 5, 0)
[ 0 16  0  0]
65 C
70 (65, 5, 5, 0)
[16  0  0  0]
73 T
78 (73, 5, 5, 0)
[ 0  0 16  0]
79 A
84 (79, 5, 5, 0)
[ 0 16  0  0]
84 C
89 (84, 5, 5, 0)
[16  0  0  0]
GGCGATGAATCTACTTCTTAAGTGTAGTATTTGTTTATTCCCTAATAGGCCGTCAGAACCAATAACGTCTGATTATGGTAACATCA

idx 6 locidx 309
1 T
6 (1, 5, 5, 0)
[ 0  0 19  0]
8 A
13 (8, 5, 5, 0)
[ 0 19  0  0]
9 G
14 (9, 5, 5, 0)
[ 0  0  0 19]
ATACGATAAGATACTTACAGAACTCGCACGAACCAGACATACCTTTATCTCGGTATACTCTCGCCACTACCACGTCATACTACCCA

idx 6 locidx 310
9 G
14 (9, 5, 5, 0)
[ 0  0  0 20]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 20]
GCATAATCGGCCTTGCAGTTTTGCAATTCAACAAAACAGACCCTCAACCTACAGTGACATTGGTAGCCTGCCTTAATGTCTCGAAT

NOT HERE
idx 6 locidx 312
24 T
29 (24, 5, 5, 0)
[ 0  0 21  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 21  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 21]
CGCGCGGGGTTGCGCACGCGCTCATACTGTGGATTCTCTAATTAATGAGAGTTGGTATTCTGGTGCGCGAACATTCTGGTGCACGG

idx 6 locidx 313
6 W
11 (6, 5, 5, 0)
[ 0 11 11  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 22  0]
29 T
34 (29, 5, 5, 0)
[ 0  0 22  0]
31 A
36 (31, 5, 5, 0)
[ 0 22  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 22]
61 A
66 (61, 5, 5, 0)
[ 0 22  0  0]
76 A
81 (76, 5, 5, 0)
[ 0 22  0  0]
AAGTTTWGCGGTAATCCTCCCATTGCAATTTACTGTGCCGTGAACTCCGGGAACGTTACTCATTAGTGGGTAAGTCACGACGCCTA

idx 6 locidx 314
12 G
17 (12, 5, 5, 0)
[ 0  0  0 23]
49 C
54 (49, 5, 5, 0)
[23  0  0  0]
81 A
86 (81, 5, 5, 0)
[ 0 23  0  0]
CCCTGGTTCGGCGTGAGTGCTACCACTCTGGGCTGCTGGCCACCATTAACACTATCCTCATAAACCAACTACCCCAACGTAAGCAC

idx 6 locidx 315
0 C
5 (0, 5, 5, 0)
[21  0  0  0]
28 A
33 (28, 5, 5, 0)
[ 0 21  0  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 21  0]
45 C
50 (45, 5, 5, 0)
[21  0  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 21]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 21]
CACGTATGGGGGACGATCGCAGAAGGTGATAGAGTTCTGCTCACCCCGGAACCTACGAGTCAGTATTTAGTTACCTTCTCGACAGG

idx 6 locidx 316
10 T
15 (10, 5, 5, 0)
[ 0  0 21  0]
CCGTTGGACCTTCTAGTCAGTTGGCGTTGTCCAACTAGCCCCTACTCTAATGCTCTCACGCCTCGCATCATCGCCGGCGTTCTAAC

idx 6 locidx 317
55 G
60 (55, 5, 5, 0)
[ 0  0  0 21]
77 T
82 (77, 5, 5, 0)
[ 0  0 21  0]
TCTTTGGGGTTAACAACTTAGGGGCAGGGTTCGGGTGCACAGTTAGGTAAGGCCCGCACATTTTCCCAGTTAGCGTTTATAGCACG

idx 6 locidx 318
1 T
6 (1, 5, 5, 0)
[ 0  0 21  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 21  0]
30 C
35 (30, 5, 5, 0)
[21  0  0  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 21]
47 C
52 (47, 5, 5, 0)
[21  0  0  0]
TTCCTCGCCTGTGGGTATCGACACGGGAGCCATAGTCTGCGGGACCCCTGGATCCCAGTAGCAAACTCCTTGCTCAACCAGACCTT

idx 6 locidx 319
16 T
21 (16, 5, 5, 0)
[ 0  0 16  0]
80 C
85 (80, 5, 5, 0)
[16  0  0  0]
CCCCAATAGACTGGAGTGACCAACACTCCGTGACGGGATTTAGTTTAGGCACCCAGGAGTGATCTATACAAACTTGAAGACAGAGG

idx 6 locidx 320
25 T
30 (25, 5, 5, 0)
[ 0  0 20  0]
48 A
53 (48, 5, 5, 0)
[ 0 20  0  0]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 20]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 20]
76 T
81 (76, 5, 5, 0)
[ 0  0 20  0]
84 C
89 (84, 5, 5, 0)
[20  0  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 20  0]
GATCTATTAGTGTTACGTACATTAATGTTATAATACCAGATAGCCTAAAGGAGCCGATCACTGAACTTGTGAGGCATAGGTCCTCT

idx 6 locidx 321
11 G
16 (11, 5, 5, 0)
[ 0  0  0 20]
57 A
62 (57, 5, 5, 0)
[ 0 20  0  0]
GCCTAATCTGCGTACGAACGCGGTTCTGACACGCACATATGATCCAGGATCAAATTAAGTAGGTCCTGAAGGTGCGATAGGTTGCG

idx 6 locidx 322
22 C
27 (22, 5, 5, 0)
[14  0  0  1]
24 A
29 (24, 5, 5, 0)
[ 0 15  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 15  0]
CATTTACTTATAAGCAACATAGCCAGGATGTCTACAACCAGTCGGCTTTGACGATGTACATCGAAAAGGGAATACAGCATAGCATA

idx 6 locidx 323
6 A
11 (6, 5, 5, 0)
[ 0 21  0  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 21]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 21]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 21]
67 C
72 (67, 5, 5, 0)
[21  0  0  0]
68 A
73 (68, 5, 5, 0)
[ 0 21  0  0]
CGATCTAGCCGTAAAAGTTGCTTGCAGAGCGGAGCACTGCGGGGCAATCGCCTGATATATCCTAAAGCAGGATCAGGCCGTGTCGT

idx 6 locidx 324
45 A
50 (45, 5, 5, 0)
[ 0 21  0  0]
49 T
54 (49, 5, 5, 0)
[ 0  0 21  0]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 21]
CTAGCTCAGGTCGCAAGCCGTCCCCCTGGGTCGACTACCGCCCCAATTGTATGAAGACCAAGGGACCAGGCCATGCATGGTTGCGC

idx 6 locidx 325
12 G
17 (12, 5, 5, 0)
[ 0  0  0 17]
36 T
41 (36, 5, 5, 0)
[ 0  0 17  0]
43 A
48 (43, 5, 5, 0)
[ 0 17  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 17  0  0]
CGGGGCCTCAAAGGGTACGCAGTCTGTATCCATCACTAACCACACCTGAGATCGGAAGAGGTGTTGTGAACTATGGGACCTCAGAG

idx 6 locidx 326
23 C
28 (23, 5, 5, 0)
[23  0  0  0]
40 T
45 (40, 5, 5, 0)
[ 0  0 23  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 23  0]
GACCCCTATATACAACCTGCAGACAATTCAATCGGGGGTATCAACTAATAATGGGATGGGGTGCAGTATAAAGTCCAACGACGGCA

idx 6 locidx 327
29 G
34 (29, 5, 5, 0)
[ 0  0  0 17]
50 A
55 (50, 5, 5, 0)
[ 0 17  0  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 17]
63 C
68 (63, 5, 5, 0)
[17  0  0  0]
68 T
73 (68, 5, 5, 0)
[ 0  0 17  0]
75 A
80 (75, 5, 5, 0)
[ 0 17  0  0]
CTTGTGAATCTCTTTAGCCTAGTCGTAAAGAAATAATTCGAAAAAAACCAACAGTCTTGTCGTCGGCTTCTTGATATCTTCCAACG

idx 6 locidx 328
5 G
10 (5, 5, 5, 0)
[ 0  0  0 14]
34 C
39 (34, 5, 5, 0)
[14  0  0  0]
39 C
44 (39, 5, 5, 0)
[14  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 14  0  0]
TACAAGCTGGCCACGCTTCAGATAATGCCAATGCCCTTTCTAGCAAGTAGAGCTCTACTGGGCTTTAGATGGAATTTGTTTAGTAT

idx 6 locidx 329
15 T
20 (15, 5, 5, 0)
[ 0  0 21  0]
34 C
39 (34, 5, 5, 0)
[21  0  0  0]
74 C
79 (74, 5, 5, 0)
[21  0  0  0]
79 A
84 (79, 5, 5, 0)
[ 0 21  0  0]
CGCGGATATCGATCATTGCCCCTTTAACTGCCTGCTAAGGATGCTCCACCCAGGCTCCACGAGGTCCCGCCTACCCCCCACCTGAC

idx 6 locidx 330
48 G
53 (48, 5, 5, 0)
[ 0  0  0 19]
68 A
73 (68, 5, 5, 0)
[ 0 19  0  0]
GCAAGTAACGCGCTCGTGACTCGATAAGAGTAGCGCGGTATAGGCCTAGGGTAGATGTGTTCCAATTGAATACTCTCGCCCGGCCT

idx 6 locidx 331
20 G
25 (20, 5, 5, 0)
[ 0  0  0 24]
44 C
49 (44, 5, 5, 0)
[24  0  0  0]
56 C
61 (56, 5, 5, 0)
[24  0  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 24  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 24  0]
CGGCGAATTGGCCTGTATACGTTAGCCCTGTGCATTACCGCCTGCGGCAGTGAGAACGGCCCGAATGAACACAGGTTAAACGTTAG

idx 6 locidx 332
2 G
7 (2, 5, 5, 0)
[ 0  0  0 20]
10 C
15 (10, 5, 5, 0)
[20  0  0  0]
35 C
40 (35, 5, 5, 0)
[20  0  0  0]
40 M
45 (40, 5, 5, 0)
[ 8 12  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 20  0]
46 C
51 (46, 5, 5, 0)
[20  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 20  0  0]
GCGGAAATAACTAGAAGCATTCCAAAATTACTAAACCAAGMTTCATCGCCCACCGTAGCGCACGACCGCTTCACCTAACTCCAATC

idx 6 locidx 333
0 C
5 (0, 5, 5, 0)
[23  0  0  0]
1 T
6 (1, 5, 5, 0)
[ 0  0 23  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 23]
CTCCGGTCCGAAGCTATAGCCCCACCTGTTTAAATAGACAACATTCCATTGCTAGTACGGAGACGAATGTATGAGAGAGGCATACT

idx 6 locidx 334
3 C
8 (3, 5, 5, 0)
[21  0  0  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 21  0]
73 A
78 (73, 5, 5, 0)
[ 0 21  0  0]
83 C
88 (83, 5, 5, 0)
[20  0  0  1]
TTGCGTCCCTTTAGGGGCAAGCATTGATGTAAGAATACATGGGCGCCCTTCTTATTACAGGCCCATGGATCGTAGCACGACGGCGT

idx 6 locidx 335
22 T
27 (22, 5, 5, 0)
[ 0  0 22  0]
63 A
68 (63, 5, 5, 0)
[ 0 22  0  0]
68 C
73 (68, 5, 5, 0)
[22  0  0  0]
81 A
86 (81, 5, 5, 0)
[ 0 22  0  0]
CGCTGCAGCCACCGTCCATGGCTCATTTCGTTATATCACTAGCGTAGTGAGGACTGCGATTCGAGGAGCGCCTTAAATTAAAAAAA

idx 6 locidx 336
51 A
56 (51, 5, 5, 0)
[ 0 16  0  0]
55 C
60 (55, 5, 5, 0)
[16  0  0  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 16]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 16]
81 C
86 (81, 5, 5, 0)
[16  0  0  0]
ATTCAGGGACCAGAATTCACTCGGTGATGCATGTCATCACCCCGTCCGTCTACACCCCAGTGGACGGACTGTCTATGGTGGCTAAC

idx 6 locidx 337
11 A
16 (11, 5, 5, 0)
[ 0 20  0  0]
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 20]
ATCACCATGTAAGTCTGCCGGGCAGATTCAAATATTCAACCAAACTAGAGTTGTGCGGTCCTCGACAATTGTTTTCCTATGTACCT

idx 6 locidx 338
45 A
50 (45, 5, 5, 0)
[ 0 20  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 20  0]
CCTGGTCAATAGCCCCCAATTGGTCGATCCCGTTTATACTTGCAGAACAAATCGTTATATACAAAGACGGATGTGGTGCGAAATAC

idx 6 locidx 339
69 A
74 (69, 5, 5, 0)
[ 0 21  0  0]
AGCCGACCGGATGATGGGTGGAGGGCTGGGTATCGCCTTAGCTCAACCGATGATGGGGAGTAGCAATCAAGCGAGATCAAACCGGC

idx 6 locidx 340
13 G
18 (13, 5, 5, 0)
[ 0  0  0 21]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 21]
54 C
59 (54, 5, 5, 0)
[21  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 21  0]
GTAGAAATGTTTCGCCGAGTCACGGTTTGAAGGGACGGTCCGGGTTCCCTAAACCCAGTTGGCTCCAAGCGAGAATGCAGCTGTAT

idx 6 locidx 341
6 C
11 (6, 5, 5, 0)
[17  0  0  0]
17 G
22 (17, 5, 5, 0)
[ 0  0  0 17]
51 A
56 (51, 5, 5, 0)
[ 0 17  0  0]
56 C
61 (56, 5, 5, 0)
[17  0  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 17  0  0]
65 A
70 (65, 5, 5, 0)
[ 0 17  0  0]
80 C
85 (80, 5, 5, 0)
[17  0  0  0]
TTCAGACTCCTCGTCTGGATCCTGGTTGAGTTGTTCTAATCAGAGAATAGTACCTACAACATGCGACTAATAAAACAAATCGGCGA

idx 6 locidx 342
31 C
36 (31, 5, 5, 0)
[21  0  0  0]
39 C
44 (39, 5, 5, 0)
[21  0  0  0]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 21]
CGGCGCGATTGTCTCCAATTCCTGACTTCCACTGCTGACCTTAGGAGCCCCTAGGACATAAAAACAAGTTCGTTCCGTGGCTTCAA

idx 6 locidx 343
2 G
7 (2, 5, 5, 0)
[ 0  0  0 22]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 22]
80 T
85 (80, 5, 5, 0)
[ 0  0 22  0]
GCGTGTCGCACCGTTGGTAATAGTGCCGCCCCTGCCGAGCCTTTGGGAGAGTCGTAATAATAATACTGGTAACTTTCCCTTGAGTG

idx 6 locidx 344
9 T
14 (9, 5, 5, 0)
[ 0  0 20  0]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 20]
56 T
61 (56, 5, 5, 0)
[ 0  0 20  0]
69 A
74 (69, 5, 5, 0)
[ 0 20  0  0]
76 W
81 (76, 5, 5, 0)
[ 0  9 11  0]
85 A
90 (85, 5, 5, 0)
[ 0 20  0  0]
TGCACTTCTTATGTGGAGCACTGTATAAGAATTCTCGGTGGAGTGCTCCCTTATACTACAATCCATCGAATTTAGTWCTGTAAGTA

idx 6 locidx 345
73 G
78 (73, 5, 5, 0)
[ 0  0  0 21]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 21]
84 A
89 (84, 5, 5, 0)
[ 0 21  0  0]
85 C
90 (85, 5, 5, 0)
[21  0  0  0]
TTCTAGATGTGGGCGTCGACCATGCCAAATATACGTCTGCCAAAGAGCGCGCGGGCAAGTTGTTCACTTTGGGGATGCCATGCGAC

idx 6 locidx 346
1 T
6 (1, 5, 5, 0)
[ 0  0 24  0]
12 A
17 (12, 5, 5, 0)
[ 0 24  0  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 24]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 24]
CTAGCAGGAATGACCTGATCTCTAAGCAGAGATTTAGGAGAAAGACCACTGGATTCTGATGCAATTTTAGTGTTCCTGGTCGGCAC

idx 6 locidx 347
50 A
55 (50, 5, 5, 0)
[ 0 18  0  0]
64 C
69 (64, 5, 5, 0)
[17  0  1  0]
75 C
80 (75, 5, 5, 0)
[18  0  0  0]
77 C
82 (77, 5, 5, 0)
[18  0  0  0]
AGTGCATTATGAATGTTCGCACCAAACGCCCTGATGCTTGCGAGTTTTTTATGTTAGGCCACAGCAGCGTGGGGCCACATTTCTGG

idx 6 locidx 348
26 G
31 (26, 5, 5, 0)
[ 0  0  0 23]
29 A
34 (29, 5, 5, 0)
[ 0 23  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 23  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 23  0  0]
CAACGATGAGTGTGGTGTATCCCCACGGAAATTCCACGGACTTCCTTGACCGCAGAGGAGTGCAAGATGAGCCTGTAAGCGCAAAT

idx 6 locidx 349
35 T
40 (35, 5, 5, 0)
[ 0  0 22  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 22  0]
TACCGTGATGTAAATACAAAATCGAGAGCTTTAATTCATTGCAGTTAGGGCGGGTGCGCATTGCACCAACCGGTTCGTGGTTTAAT

idx 7 locidx 350
17 T
22 (17, 5, 5, 0)
[ 0  0 23  0]
34 A
39 (34, 5, 5, 0)
[ 0 23  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 23  0  0]
53 C
58 (53, 5, 5, 0)
[23  0  0  0]
75 C
80 (75, 5, 5, 0)
[23  0  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 23]
CAGGTGATTAGGGAAGCTCCCTCGCATCGGAATAAACCGATATCAAAGGGAGACAGAGTCCCTCATGCCGAGCGACTAACGGTATG

idx 7 locidx 351
26 G
31 (26, 5, 5, 0)
[ 0  0  0 18]
29 C
34 (29, 5, 5, 0)
[18  0  0  0]
65 C
70 (65, 5, 5, 0)
[18  0  0  0]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 18]
GTCGTCAATAGCTGAGACCTAAATTGGTGCAGTTTATTATAGGATTCTCAAGGTAGTTTCTACCGCATCCCCGCTCAAGGGATTCT

idx 7 locidx 352
16 T
21 (16, 5, 5, 0)
[ 0  0 22  0]
79 A
84 (79, 5, 5, 0)
[ 0 22  0  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 22  0]
ACATAGGTGTATGTCTTGATCGACAAGCTCGGGCGCGATGGGAGCTATGTAAGACACCCTAGTTGTTGCTCGTGATAAGATGCAAA

idx 7 locidx 353
16 G
21 (16, 5, 5, 0)
[ 0  0  0 15]
21 T
26 (21, 5, 5, 0)
[ 0  0 15  0]
36 C
41 (36, 5, 5, 0)
[15  0  0  0]
52 C
57 (52, 5, 5, 0)
[15  0  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 15  0]
71 C
76 (71, 5, 5, 0)
[15  0  0  0]
CACGCGGCTGATTCTCGGTAATGGCCCGTGGGGCCACTGTCACACACACGACCTATCAACTGACCAATAGTCCTAAAGAGTAGACG

idx 7 locidx 354
7 G
12 (7, 5, 5, 0)
[ 0  0  0 17]
23 C
28 (23, 5, 5, 0)
[17  0  0  0]
28 C
33 (28, 5, 5, 0)
[17  0  0  0]
73 T
78 (73, 5, 5, 0)
[ 0  0 17  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 17  0]
AGTGGATGATATTTTCAGCGTGCCATTACGTCGCGAGCACCTTAGACGGTCGCCAGGCAGTGTCTTTGGATCATTAGGAGTATAAC

idx 7 locidx 355
48 C
53 (48, 5, 5, 0)
[18  0  0  0]
57 T
62 (57, 5, 5, 0)
[ 0  0 18  0]
67 T
72 (67, 5, 5, 0)
[ 0  0 18  0]
82 C
87 (82, 5, 5, 0)
[18  0  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 18  0]
CGCTGTATTAAAAGGGGGATCTATTAACAGCCCTCTATATGAGTAGCTCTCTTGGGTTTGAATTAGTTTTAGGAATGACGTACGTA

idx 7 locidx 356
35 A
40 (35, 5, 5, 0)
[ 0 21  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 21  0]
64 C
69 (64, 5, 5, 0)
[21  0  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 21  0  0]
CATGGTAGTCTATGGGCCAGCTATTAACTCGTTGAAACTCGATTCACAGGCGCTGAAGTCGATTCATATCAACTCCGGTCGGGTAT

idx 7 locidx 357
18 A
23 (18, 5, 5, 0)
[ 0 19  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 19  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 19  0  0]
57 C
62 (57, 5, 5, 0)
[19  0  0  0]
GGTGCCTTACGACCGGATACAAATCACCGCAAGAGATTCCACAAGTCACTCACTTTTCGGGGGGGAATATTTGAACATATGTGGAC

idx 7 locidx 358
3 C
8 (3, 5, 5, 0)
[16  0  0  0]
7 G
12 (7, 5, 5, 0)
[ 0  0  0 16]
16 C
21 (16, 5, 5, 0)
[16  0  0  0]
26 A
31 (26, 5, 5, 0)
[ 0 16  0  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 16]
53 S
58 (53, 5, 5, 0)
[ 5  0  0 11]
60 T
65 (60, 5, 5, 0)
[ 0  0 16  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 16  0]
AGTCCTAGGTAGAAGGCGGACAAACGAAAGGTATGTCAGCCTAGCTTACCTTASAGGATTTTACAGTTCTGGTATCATCTTCTATT

idx 7 locidx 359
35 A
40 (35, 5, 5, 0)
[ 0 18  0  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 18]
41 T
46 (41, 5, 5, 0)
[ 0  0 18  0]
70 C
74 (70, 5, 5, 1)
[18  0  0  0]
74 G
78 (74, 5, 5, 1)
[ 0  0  0 18]
GGAATCTGATCATTGTGAAATTCGAGCTGAAAGCTAGTAGGTGGCCTACT-TCCTTATGTGAGCCGTGATCAAAGAC-ATGAACGG

idx 7 locidx 360
34 G
39 (34, 5, 5, 0)
[ 0  0  0 20]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 20]
TAGAAGATCGGTATATGCATACGGAGGCTATTTAGAAAGTCTGTTAAGTGCTACAGGCTCACCCTGTATACAGCATCATTCTCGAC

idx 7 locidx 361
4 T
9 (4, 5, 5, 0)
[ 0  0 22  0]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 22]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 22]
74 T
79 (74, 5, 5, 0)
[ 0  0 22  0]
ATATTAGAGGGGTGGATCCTCCACTCCACAAAGCTCGCCAGGCGTTCAGCACTTCTAGGCTCTGTGGAGAACCCTTGATCCCTTAG

idx 7 locidx 362
12 A
17 (12, 5, 5, 0)
[ 0 21  0  0]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 21]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 21]
AACTTAAGCGGAAGGAGGTCGTAGTACGACATTCGGATTGTATTGTGGTCCCGAACTTAAAAGCCCGGTAATACGAAGGGAAACGT

idx 7 locidx 363
0 T
5 (0, 5, 5, 0)
[ 0  0 22  0]
1 A
6 (1, 5, 5, 0)
[ 0 22  0  0]
50 C
55 (50, 5, 5, 0)
[22  0  0  0]
TACATTGGGATCTGACGGGGAGAAGTACTTCGGTACCGACTTTGAACGGCCGTGACTAATATCTATTAATTCACGGCTATTCCGCT

idx 7 locidx 364
55 C
60 (55, 5, 5, 0)
[17  0  0  0]
71 T
76 (71, 5, 5, 0)
[ 0  0 17  0]
GATGGTGCGTCCCGAAGTGGTGTCTTAACTGAGTGACAATCTGCCGGATTTAGATCCAATTTGCGGATTGGTAGCGAGTCCCCGGA

idx 7 locidx 365
10 C
15 (10, 5, 5, 0)
[17  0  0  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 17  0]
13 A
18 (13, 5, 5, 0)
[ 0 17  0  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 17  0]
21 T
26 (21, 5, 5, 0)
[ 0  0 17  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 17]
TGTATATGCCCTAACGTTGTATATAGGTCTAACTATTGTAAGGACGACGGCGTGCAATAAGTTGTTATGTTTTGGGTTCACGGTAT

idx 7 locidx 366
4 T
9 (4, 5, 5, 0)
[ 0  0 25  0]
34 W
39 (34, 5, 5, 0)
[ 0 13 12  0]
AGCATTAAGACGCATCCGCATGTCCGGGTCCAATWGTGAGGGCGAGAGGATACGATAAATATTTACGCCGGAACTCGGTTCATAAA

idx 7 locidx 367
44 A
49 (44, 5, 5, 0)
[ 0 24  0  0]
64 A
69 (64, 5, 5, 0)
[ 0 24  0  0]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 24]
TGATGCACAAACTGACGTAGTGCTTCGTGACGTGATCCGTTTCGACCAAGAAGCATTGTTTATCATTTCCGGTTGAAAATAGATAC-

idx 7 locidx 368
7 S
12 (7, 5, 5, 0)
[10  0  0 10]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 20]
65 A
70 (65, 5, 5, 0)
[ 0 20  0  0]
CTATATCSAATGATGTTACTGAAATAGACGTGAGAGATCCGGCTCCAACCCTATTGGATGGCGTTATGCATCTTGATATATATACG

idx 7 locidx 369
6 A
11 (6, 5, 5, 0)
[ 0 20  0  0]
53 C
58 (53, 5, 5, 0)
[20  0  0  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 20  0]
71 C
76 (71, 5, 5, 0)
[20  0  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 20  0]
TTCTCTATATATTCACCAGGACACCCAGCCATCCTACAACGAACGTCTACTAGCCGTTAATCGTAACCCTTCCATTTCGCGTCTTA-

idx 7 locidx 370
6 A
11 (6, 5, 5, 0)
[ 0 23  0  0]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 23]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 23]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 23]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 23]
79 A
84 (79, 5, 5, 0)
[ 0 23  0  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 23]
85 T
90 (85, 5, 5, 0)
[ 0  0 23  0]
CGTAGTAGGTGCGAGCCCTCGGACAGCCTCGCATGGACCTGCCTAGCCGATGGTCTCCGCCCCCTAGCACGGCCGGGTGAATGGAT

idx 7 locidx 371
21 T
26 (21, 5, 5, 0)
[ 0  0 21  0]
48 C
53 (48, 5, 5, 0)
[21  0  0  0]
76 C
81 (76, 5, 5, 0)
[21  0  0  0]
CTCCCGCCTTAGTTGAGCGACTGTTTTGCTAGAGGTTCTCCAGACAACCTTTCCACGGCACGAAAGGCTAAGCGGGCGCTTCATGA

idx 7 locidx 372
34 T
39 (34, 5, 5, 0)
[ 0  0 21  0]
37 C
42 (37, 5, 5, 0)
[21  0  0  0]
56 C
61 (56, 5, 5, 0)
[21  0  0  0]
GCAACCGCCCTGGCGATTAGTAGTGGACATGATGTGCCCACAGTCAGCGTTCTTGCCCTGCCCTTGTAACGGGGTGTGGGCAACCA

idx 7 locidx 373
31 G
36 (31, 5, 5, 0)
[ 0  0  0 22]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 22]
80 C
85 (80, 5, 5, 0)
[22  0  0  0]
CGACGGAATTCATCATTCTGCCGGTATCGTAGCCCGAGCATCTGGTCGGACTTGAGTGTTAGATGCAGTGTCGATAGCCGCCGTAA

idx 7 locidx 374
11 A
16 (11, 5, 5, 0)
[ 0 19  0  0]
18 T
23 (18, 5, 5, 0)
[ 0  0 19  0]
71 C
76 (71, 5, 5, 0)
[19  0  0  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 19]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 19]
81 A
86 (81, 5, 5, 0)
[ 0 19  0  0]
CGCGATCTGATACCCTCGTGTGGAGCACGATGAAAAGAAACACCATCTAATACCAGAATGGCAAAGGCGCCCCAGAGCTAAATAGT

idx 7 locidx 375
0 T
5 (0, 5, 5, 0)
[ 0  0 20  0]
9 G
14 (9, 5, 5, 0)
[ 0  0  0 20]
11 T
16 (11, 5, 5, 0)
[ 0  0 20  0]
26 S
31 (26, 5, 5, 0)
[10  0  0 10]
63 G
68 (63, 5, 5, 0)
[ 0  0  0 20]
TGTGAACGTGTTGGGATGACGGTAACSCTCGAGTGTTGTGGGGATTGAAGAGCCGCGCTACTGGGATGGCGTACATCCTATCACTA

idx 7 locidx 376
9 T
14 (9, 5, 5, 0)
[ 0  0 17  0]
16 G
21 (16, 5, 5, 0)
[ 0  0  0 17]
38 G
43 (38, 5, 5, 0)
[ 0  0  0 17]
49 T
54 (49, 5, 5, 0)
[ 0  0 17  0]
67 C
72 (67, 5, 5, 0)
[17  0  0  0]
AAGCTCGAGTAGCGTAGTAGAAGCGTAATAACGCTCAAGACTACCTACATTCAAATAGACACTGAGGCATATGAAGGTAGTCTCGG

idx 7 locidx 377
5 G
10 (5, 5, 5, 0)
[ 0  0  0 18]
11 C
16 (11, 5, 5, 0)
[18  0  0  0]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 18]
45 T
50 (45, 5, 5, 0)
[ 0  0 18  0]
71 A
76 (71, 5, 5, 0)
[ 0 18  0  0]
75 R
80 (75, 5, 5, 0)
[0 9 0 9]
AACACGTCCTCCAGACGGTACTAAGTGACGTCATGCTCCGTGTGATGGTGTCTCGCGCTCTTACCATTGGAATCGRGTATGGTCGT

idx 7 locidx 378
2 T
7 (2, 5, 5, 0)
[ 0  0 29  0]
12 T
17 (12, 5, 5, 0)
[ 0  0 29  0]
14 T
19 (14, 5, 5, 0)
[ 0  0 29  0]
ATTGAACGGGTATCTAGACCGAGTTAGTTTCATCAGTGGGAAATATGCGCTAGGTCGGCGTTGCCATGGATTAGACGCGACGAAGT

idx 7 locidx 379
9 G
14 (9, 5, 5, 0)
[ 0  0  0 22]
38 A
43 (38, 5, 5, 0)
[ 0 22  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 22  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 22]
67 C
72 (67, 5, 5, 0)
[22  0  0  0]
AAATGGCCGGAGCGCTTATCTCTCGATATCAAATCGGGATTCCGGTGAAAAACTGTCAGGTTACCGTCCGGGCCCGCTTTCAGTCT

idx 7 locidx 380
51 G
56 (51, 5, 5, 0)
[ 0  0  0 18]
61 M
66 (61, 5, 5, 0)
[ 8 10  0  0]
84 A
89 (84, 5, 5, 0)
[ 0 18  0  0]
CCTACAGCTCTAAAGCCATCGGATGACTCTTAGGGTGCGCGATACGGTTACGCAAGTGGACMAATGATCCACGTATCATTCCCTAA

idx 7 locidx 381
15 G
20 (15, 5, 5, 0)
[ 0  0  0 18]
18 A
23 (18, 5, 5, 0)
[ 0 18  0  0]
71 C
76 (71, 5, 5, 0)
[18  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 18  0  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 18  0]
TAATTGTTAAGACTTGGAAGCGTAGGGAGACACCTCCCTAGTGGAAGGTGGCGCTACCTCAGGAGCCATATCAGGCATGGGTTGCG

idx 7 locidx 382
7 T
12 (7, 5, 5, 0)
[ 0  0 17  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 17]
55 C
60 (55, 5, 5, 0)
[17  0  0  0]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 17]
ACCATAATGGCATGGTGCCACAGCTAGGGACCGATCTCTTTCTAAACTACATCCCCTAGGTTGAGACCCATGCGTGCTCTAATTGG

idx 7 locidx 383
3 A
8 (3, 5, 5, 0)
[ 0 20  0  0]
41 C
46 (41, 5, 5, 0)
[20  0  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 20  0]
78 C
83 (78, 5, 5, 0)
[20  0  0  0]
GCGATATTGTATATCAATGGATAGAACTCCACATCCCCCCGCCCGCCGTTAGGCCTATTTTGGTGGGAAGACACTCTTCCCAGGCA

idx 7 locidx 384
10 A
15 (10, 5, 5, 0)
[ 0 22  0  0]
26 A
31 (26, 5, 5, 0)
[ 0 22  0  0]
31 T
36 (31, 5, 5, 0)
[ 0  0 22  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 22  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 22]
75 C
80 (75, 5, 5, 0)
[22  0  0  0]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 22]
ACACCAGTTGAGACCGGATAGCACATACGTGTGCCACACTGCGATTGAGGCACGTTTGAGGGCGTCTTTAACGCTCTTCCGACCCG

idx 7 locidx 385
5 C
10 (5, 5, 5, 0)
[21  0  0  0]
17 C
22 (17, 5, 5, 0)
[21  0  0  0]
18 C
23 (18, 5, 5, 0)
[21  0  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 21  0]
68 C
73 (68, 5, 5, 0)
[21  0  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 21  0]
GGTTTCTTTCTAAAGACCCACACCATGTCCACGGTCTATACAAGCCCGGTTCCGATTGGACGCTACCTCACATGAATCTAGCGGCT

idx 7 locidx 386
10 A
15 (10, 5, 5, 0)
[ 0 19  0  0]
25 A
30 (25, 5, 5, 0)
[ 0 19  0  0]
63 C
68 (63, 5, 5, 0)
[19  0  0  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 19]
75 C
80 (75, 5, 5, 0)
[19  0  0  0]
CCCAAGGAGTACAACATCTAGCTATAGATGAAACCAATTGGAGTTTGGTCCGTCGGCAGGTCACCGGATACCTGTCCGTTCGATCT

idx 7 locidx 387
20 G
25 (20, 5, 5, 0)
[ 0  0  0 17]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 17]
GGACCTCCCCACGCGTTTTGGTAAGATCAGGTTCAGTCAGAATTTGCCCAGGTGGAGTAGCGCCCGCATCAGTTCGTGCGATATGT

idx 7 locidx 388
9 G
14 (9, 5, 5, 0)
[ 0  0  0 18]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 18]
46 C
51 (46, 5, 5, 0)
[18  0  0  0]
61 C
66 (61, 5, 5, 0)
[18  0  0  0]
TACACAGAAGCAAAATGGGCTACACTGCACCTCTGGATCAAGCTTGCCCAATGACTGGTGTCACATTTCGAAAGGCTGCAATAGAC

idx 7 locidx 389
17 G
22 (17, 5, 5, 0)
[ 0  0  0 16]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 16]
63 A
68 (63, 5, 5, 0)
[ 0 16  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 16]
TCTGTTTCTGATGCTATGTTTGGCCTCTGGATAGACGTGCAGCCCGCGAGGTAGAAACCCAGGACCACGTGGTGTGAAACTGCACG

NOT HERE
idx 7 locidx 391
46 G
51 (46, 5, 5, 0)
[ 0  0  0 18]
50 A
55 (50, 5, 5, 0)
[ 0 18  0  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 18]
CCACCGTCGCTGGTAAATCAGATCGGTCGGCATCGCACATCCCGTGGACAAACGCGAAGCCCGAGAGGGCCCGAATTTGCGCACGC

idx 7 locidx 392
15 G
20 (15, 5, 5, 0)
[ 0  0  0 22]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 22]
26 T
31 (26, 5, 5, 0)
[ 0  0 22  0]
36 A
41 (36, 5, 5, 0)
[ 0 22  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 22  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 22]
GCTAAATCCATTGCAGAGTTGGCGTGTCCTTTTCCAATTTCATATTTGGAGGCGCAGCTTGTCCTTACGCGCATTGGACGCCGATG

idx 7 locidx 393
0 T
5 (0, 5, 5, 0)
[ 0  0 22  0]
10 A
15 (10, 5, 5, 0)
[ 0 22  0  0]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 22]
63 T
68 (63, 5, 5, 0)
[ 0  0 22  0]
69 A
74 (69, 5, 5, 0)
[ 0 22  0  0]
TAAGCGGGAGAACCCTCGGTGGTCCGCTTATGCCTGGTTTTGCTGTTGAATCTATGTGTTTCCTCCTATAGATTTGACTGATCGGT

idx 7 locidx 394
82 T
87 (82, 5, 5, 0)
[ 0  0 19  0]
GAAGACCGTCACGTCGGGCCCATCAGCGAGACACGCGCTTCCGAGAACTCCAGGTTCTCGGAGCATTGCCACGGCGAAATTCTTGG

idx 7 locidx 395
22 A
27 (22, 5, 5, 0)
[ 0 14  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 14  0]
56 C
61 (56, 5, 5, 0)
[14  0  0  0]
64 A
69 (64, 5, 5, 0)
[ 0 14  0  0]
TTGGGATGGCGATGCCGTACATAGGCGCATCCAGCCTCGGTCATTGTCGGAGATCTCACCTTTCAACGGTTGACGATGACAAGTGG

idx 7 locidx 396
37 G
42 (37, 5, 5, 0)
[ 0  0  0 19]
56 A
61 (56, 5, 5, 0)
[ 0 19  0  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 19  0]
TGGCGATGAGCCACAGCCCTTCTAGGCGGTCGAGGAGGTGACAACTTTTCCGTTATAACTCAGACCTGCCGTAGCACTGGAAGAAA

idx 7 locidx 397
10 T
15 (10, 5, 5, 0)
[ 0  0 20  0]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 20]
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
38 C
43 (38, 5, 5, 0)
[20  0  0  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 20]
ACTAGCCGTTTGAGCGAATTTTATCTGATAAGCAGGTCCCGCAGGATTCTCCCGCCCTGGTCTCGCGAGTCCACCTGAGTGGAGAC

idx 7 locidx 398
5 G
10 (5, 5, 5, 0)
[ 0  0  0 22]
30 A
35 (30, 5, 5, 0)
[ 0 22  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 22]
GCGAAGCCCAGCATGTAGTAGGCACTCCGGACGCGACCGGTTGTAATCTAGGACGCGTGAAATGGGCAATTATGGCCTGCCTCCGT

idx 7 locidx 399
38 C
43 (38, 5, 5, 0)
[19  0  0  0]
GTGATACCGCTGCGGACGCCACCAGCAAACGACGGTACCGGTTACGACGTGTTCTCTGAAAAGGGATGATTGGAGGAACCTGAAGA

idx 8 locidx 400
24 T
29 (24, 5, 5, 0)
[ 0  0 23  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 23  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 23]
43 T
48 (43, 5, 5, 0)
[ 0  0 23  0]
52 C
57 (52, 5, 5, 0)
[23  0  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 23]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 23]
GGTAGGCGAAAAGGTAAGCCCGCATACCTCTCAGCTGATCTTGTCTTTGGGTCCAATGCAGTAAGCTCAGTGGTCGTCCGAGAGGA

idx 8 locidx 401
37 A
42 (37, 5, 5, 0)
[ 0 16  0  0]
47 C
52 (47, 5, 5, 0)
[16  0  0  0]
53 C
58 (53, 5, 5, 0)
[16  0  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 16  0]
GTTAGAGCGGCAACATCAGCGAGTGCAGCCCCGGGCGAGCGCGTTCGCCGTGCCGTGGCCTCAGCCGGATGGGTCAAGATTTCTCC

idx 8 locidx 402
13 M
18 (13, 5, 5, 0)
[10  9  0  0]
40 C
45 (40, 5, 5, 0)
[19  0  0  0]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 19]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 19]
ACGCTTAGCCTTCMTGGGAGGCCTGAACTGGCCATTACGGCCAGTGAAAGATATAGCGCACCAGGCGTCCACGCACGCTGCCTGG-A

idx 8 locidx 403
8 C
13 (8, 5, 5, 0)
[18  0  0  0]
9 T
14 (9, 5, 5, 0)
[ 0  0 18  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 18  0]
26 A
31 (26, 5, 5, 0)
[ 0 18  0  0]
54 C
59 (54, 5, 5, 0)
[18  0  0  0]
AATGCGAACTCTCGAAAAGCCCTCAAAACCCCAAGCATTGATAAAGCCCATTTCCCCCCTTCAGGGATTACAAAAAAGTTCGAACT

idx 8 locidx 404
2 C
7 (2, 5, 5, 0)
[22  0  0  0]
TTCCGTCCTGAAATAATATGTCCTTCCATAGAATTTAAGTGTTGCTGGAAAACTGACGAAATCCTTGTTAACACAGGCGTCAGAAT

idx 8 locidx 405
11 G
16 (11, 5, 5, 0)
[ 0  0  0 23]
17 T
22 (17, 5, 5, 0)
[ 0  0 23  0]
21 C
26 (21, 5, 5, 0)
[23  0  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 23  0  0]
27 C
32 (27, 5, 5, 0)
[23  0  0  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 23]
CTCCTTTGCATGCTCCCTAGCCGAAAGCTAACCTCTCTATCTTACCCCATTCTACGTAGAGACAATTGAAATCACAACAACGTATG

idx 8 locidx 406
0 T
5 (0, 5, 5, 0)
[ 0  0 23  0]
37 A
42 (37, 5, 5, 0)
[ 0 23  0  0]
64 C
69 (64, 5, 5, 0)
[23  0  0  0]
TCAGATTTGTCGGCGGGTGATCCCTAGATCGGGTTACAGTATGGTACCTAATTCCACATCCAAACACTTAGGACTATTAATCAATG

idx 8 locidx 407
22 G
27 (22, 5, 5, 0)
[ 0  0  0 20]
36 A
41 (36, 5, 5, 0)
[ 0 20  0  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 20]
56 C
61 (56, 5, 5, 0)
[20  0  0  0]
AAACCGTTGCTGACGGCCGCCCGCCCGAACATCATCAAAACGTGGTATTCGCATGGCCGAGCCCAGTAAGCCGCCTACGTCTAGCT

idx 8 locidx 408
18 T
23 (18, 5, 5, 0)
[ 0  0 23  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 23  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 23]
57 T
62 (57, 5, 5, 0)
[ 0  0 23  0]
73 A
78 (73, 5, 5, 0)
[ 1 22  0  0]
TACCAAACAATGTACCACTAGGACACCTTGCGCTAGTGGTCCTCAAGTGCGGAGGCGTTCTCTAGAATGGTACAGATGTCGACACC

idx 8 locidx 409
6 G
11 (6, 5, 5, 0)
[ 0  0  0 26]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 26]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 26]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 26]
75 T
80 (75, 5, 5, 0)
[ 0  0 26  0]
76 C
81 (76, 5, 5, 0)
[26  0  0  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 26  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 26]
CATTAGGCTAAAAGTGTTACCTTGCGCGCTGGGTAGTGCAACACTAGTACAGCTGTGGCAGATATAACGGCATTGTCTCCGGGTCA

idx 8 locidx 410
35 C
40 (35, 5, 5, 0)
[21  0  0  0]
36 C
41 (36, 5, 5, 0)
[21  0  0  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 21]
66 T
71 (66, 5, 5, 0)
[ 0  0 21  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 21]
82 A
87 (82, 5, 5, 0)
[ 0 21  0  0]
GAGCGTAACGTTAGCATTGATTTACTCCTAGTGCACCTAGTCCCCTAGGGATCACCCGCGATGCAGTTCTTGAGGCGGGTGGACCA

idx 8 locidx 411
14 C
19 (14, 5, 5, 0)
[22  0  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 22  0  0]
19 C
24 (19, 5, 5, 0)
[22  0  0  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 22]
82 C
87 (82, 5, 5, 0)
[22  0  0  0]
AATTACTGGTGATCCGTAGCAAGAACTGCCCACTAGCAATACCCCTAGGACCCAGCACGGGTTGTTACTCCTGGTGACCAGTCCGC

idx 8 locidx 412
0 A
5 (0, 5, 5, 0)
[ 0 21  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 21  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 21]
62 A
67 (62, 5, 5, 0)
[ 0 21  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 21  0  0]
80 C
85 (80, 5, 5, 0)
[21  0  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 21  0]
ACTAGGCACCGATCAAGTGTGCTGGAGCGAGTGATAGCTTGTATCATAAAAGTGTATGCGCTACACCGATGAAGAATGAGCGCCTA

idx 8 locidx 413
8 T
13 (8, 5, 5, 0)
[ 0  0 20  0]
10 G
15 (10, 5, 5, 0)
[ 0  0  0 20]
16 G
21 (16, 5, 5, 0)
[ 0  0  0 20]
22 R
27 (22, 5, 5, 0)
[ 0  8  0 12]
64 C
69 (64, 5, 5, 0)
[20  0  0  0]
82 C
87 (82, 5, 5, 0)
[20  0  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 20  0  0]
TAATATGTTGGTTCAGGTTCTCRACTACGTGATGACTGACCGCTATATCTCTGTGCGAGGAAACCCATTCATAAAGGTGATGCCAA

idx 8 locidx 414
15 G
20 (15, 5, 5, 0)
[ 0  0  0 17]
26 A
31 (26, 5, 5, 0)
[ 0 17  0  0]
28 C
33 (28, 5, 5, 0)
[17  0  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 17]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 17]
GAGCGGTGCTACGTCGTGATGCCTTCACCCTCAATGTTAATAGCAGGTCAGGGCCTAATTTGATAATGACTAACCTGTAAACCTAC---

idx 8 locidx 415
6 C
11 (6, 5, 5, 0)
[19  0  0  0]
21 A
26 (21, 5, 5, 0)
[ 0 19  0  0]
CTCTAGCACATTCGATCGGATACCCCACCTTCCCTGGATTAGCGAAGTTGGGTCTCGGTGATAGACGTCATCCAAGGTGATCCGGG

idx 8 locidx 416
13 K
18 (13, 5, 5, 0)
[ 0  0 13  7]
32 C
37 (32, 5, 5, 0)
[20  0  0  0]
83 C
88 (83, 5, 5, 0)
[20  0  0  0]
ACGTTAAGGTATGKACCGCCCCACACCTGACGCGCGCGTATGGCACCCAAACGCTGGCACTCACCCAATCGGTCGAAATTCTCCGT

idx 8 locidx 417
64 W
69 (64, 5, 5, 0)
[ 0  9 12  0]
TAACGGATAGATGCGGTGTTTAGCGGCTTTGTATGCGAGATTCTGCGCGTACTACTTGTAAATCWGCTTCTGAAATTGGTCTTATC

idx 8 locidx 418
44 C
49 (44, 5, 5, 0)
[19  0  0  0]
CGAGCAGACTGCGTCTCGGTAGCATCGAAGCCAATCGTTTGAAGCCTAAGTTAGGAAATCGGGGCACAACGTAGATACCTATTTTA

idx 8 locidx 419
5 T
10 (5, 5, 5, 0)
[ 0  0 17  0]
49 C
54 (49, 5, 5, 0)
[17  0  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 17  0]
60 C
65 (60, 5, 5, 0)
[17  0  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 17  0  0]
73 T
78 (73, 5, 5, 0)
[ 0  0 17  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 17  0]
GTCTTTACGTCCCATTACGTCCACGTCAGAGTAGCTCAGAAGAAGCTTCCCACGTTGTTGCTACAATGCACATTATTCCGTCCCCA

idx 8 locidx 420
0 T
5 (0, 5, 5, 0)
[ 0  0 16  0]
45 A
50 (45, 5, 5, 0)
[ 0 16  0  0]
51 C
56 (51, 5, 5, 0)
[16  0  0  0]
68 A
73 (68, 5, 5, 0)
[ 0 16  0  0]
70 A
75 (70, 5, 5, 0)
[ 0 16  0  0]
82 T
87 (82, 5, 5, 0)
[ 0  0 16  0]
TACGTATACGGCATAGAAGATCGTGGGCTCATGGTGGTGTAAATAAAACGGCCTCGCTCGCTGGCGAAACATAGTTGGAGTCTACC

idx 8 locidx 421
15 C
20 (15, 5, 5, 0)
[16  0  0  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 16]
TACACACACTACGCTCGGCCTAACAGGATCTGCGTAACCCAATAACACGCTGGCCGTAAACGCGGCCCTGAAGTACGCACCTCTAC

idx 8 locidx 422
0 T
5 (0, 5, 5, 0)
[ 0  0 21  0]
5 T
10 (5, 5, 5, 0)
[ 0  0 21  0]
6 G
11 (6, 5, 5, 0)
[ 0  0  0 21]
10 A
15 (10, 5, 5, 0)
[ 0 21  0  0]
24 C
29 (24, 5, 5, 0)
[21  0  0  0]
25 A
30 (25, 5, 5, 0)
[ 0 21  0  0]
36 A
41 (36, 5, 5, 0)
[ 0 21  0  0]
TTGTGTGTAGATCAGACCCCCCCACAAAGACTTCAAATCTGGCTTAGGACTAAGAAGACAACACAACCAAGTTAATCACTCATCCT

idx 8 locidx 423
0 T
5 (0, 5, 5, 0)
[ 0  0 16  0]
26 C
31 (26, 5, 5, 0)
[16  0  0  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 16]
38 A
43 (38, 5, 5, 0)
[ 0 16  0  0]
TCACACTAGTAACCAGATATAGTGAACCGTGGTTCTCTAGTCGAGCCGTAGCACGGCGAGAAAGGCCTCAGGGTCCAGGCCTTGGA

idx 8 locidx 424
18 C
23 (18, 5, 5, 0)
[14  0  0  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 14]
57 C
62 (57, 5, 5, 0)
[14  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 14  0  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 14]
AAAGACCCTTTACCATTACCACCGCCACGCCACACCCCTGCCACTCTTTTTTGCAGGCATTGATATACTTAAAATTACATCATGGA

idx 8 locidx 425
12 A
17 (12, 5, 5, 0)
[ 0 18  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 18  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 18]
59 W
64 (59, 5, 5, 0)
[0 9 9 0]
63 T
68 (63, 5, 5, 0)
[ 0  0 18  0]
72 C
77 (72, 5, 5, 0)
[18  0  0  0]
74 C
79 (74, 5, 5, 0)
[18  0  0  0]
83 C
88 (83, 5, 5, 0)
[18  0  0  0]
TAAGAAGCAAGTACATAACGATTGTTGACATGCCGATCCGGCTCCTAGTAGAGTGGGCTWTGCTGCTCCACCCACGCTATGAGCAT

idx 8 locidx 426
8 G
13 (8, 5, 5, 0)
[ 0  0  0 21]
20 A
25 (20, 5, 5, 0)
[ 0 21  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 21  0  0]
76 C
81 (76, 5, 5, 0)
[21  0  0  0]
82 A
87 (82, 5, 5, 0)
[ 0 21  0  0]
CCCCGCACGCTCTCTCTGGTACATCCGCAAAATCATGCGAGGGGCCTAGATGGGTCTAAAACCGTTTAATAGCATGCAGGCGATGT

idx 8 locidx 427
4 G
9 (4, 5, 5, 0)
[ 0  0  0 21]
5 T
10 (5, 5, 5, 0)
[ 0  0 21  0]
9 A
14 (9, 5, 5, 0)
[ 0 21  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 21  0  0]
68 C
73 (68, 5, 5, 0)
[21  0  0  0]
73 A
78 (73, 5, 5, 0)
[ 0 21  0  0]
AAACGTAGCATGTAGACAACTCTTAGTTTGCCTTCTGTTTTCACATCCATGTACGACCGGAAAGCCTTCTAGCACGAGAAGTCAGT

idx 8 locidx 428
18 T
23 (18, 5, 5, 0)
[ 0  0 20  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 20  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 20]
78 C
83 (78, 5, 5, 0)
[20  0  0  0]
GCCAACCACTCCCTGAACTGTAAGTAGCGGACGGTCTTCGTTATATTTGCTGACACCACACGTTGTCAGGTTGGTCTTCTTCTCTC

idx 8 locidx 429
10 T
15 (10, 5, 5, 0)
[ 0  0 20  0]
12 C
17 (12, 5, 5, 0)
[20  0  0  0]
16 T
21 (16, 5, 5, 0)
[ 0  0 20  0]
25 A
30 (25, 5, 5, 0)
[ 0 20  0  0]
30 C
35 (30, 5, 5, 0)
[20  0  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 20]
66 C
71 (66, 5, 5, 0)
[20  0  0  0]
AGATTTCGGGTTCCTGTCGGCTTGCACGCCCGAAATAGGGTACTAGAGTGCAACCGACCTCCCTAACGCATGAATCTACCTCGGCT

idx 8 locidx 430
25 T
30 (25, 5, 5, 0)
[ 0  0 19  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 19]
58 T
63 (58, 5, 5, 0)
[ 0  0 19  0]
62 A
67 (62, 5, 5, 0)
[ 0 19  0  0]
71 C
76 (71, 5, 5, 0)
[19  0  0  0]
ACTGAATCCACAGCCTGTGTCGCCATAGAATTTCTGGTTTGACAGCTAGAGGAGTACGTCGTATTTCAGCCCGACACATGGCTCCC

idx 8 locidx 431
3 C
8 (3, 5, 5, 0)
[19  0  0  0]
21 C
26 (21, 5, 5, 0)
[19  0  0  0]
56 C
61 (56, 5, 5, 0)
[19  0  0  0]
81 C
86 (81, 5, 5, 0)
[19  0  0  0]
ACACATAAAGGTGATGAACTCCACGCCGGGGTGGGGTCAGTTGAGAGCTTGATTTTCACTTCGCATACCTCTTTCCACTACCGAGC

idx 8 locidx 432
22 G
27 (22, 5, 5, 0)
[ 0  0  0 22]
24 A
29 (24, 5, 5, 0)
[ 0 22  0  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 22]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 22]
39 A
44 (39, 5, 5, 0)
[ 0 22  0  0]
62 C
67 (62, 5, 5, 0)
[22  0  0  0]
70 A
75 (70, 5, 5, 0)
[ 0 22  0  0]
72 C
77 (72, 5, 5, 0)
[22  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 22]
CGGCTACGCTGAGTAAATACGTGGAGGAGGTCAGTGCTAATTATAGTTCGGCAGGTTAATAACCAAGTGCAACCGTTATCAGGGTC

idx 8 locidx 433
23 C
28 (23, 5, 5, 0)
[16  0  0  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 16  0]
56 A
61 (56, 5, 5, 0)
[ 0 16  0  0]
CCGAGACAGTAAGGCTGAAAGAACTCCGGGTCAGGGTCGCTATTGATACGCTGTCCAACCCCTAAGTACTTT-GCACAATACTAGC

idx 8 locidx 434
61 C
66 (61, 5, 5, 0)
[24  0  0  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 24  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 24]
ATGTAGTGTTTACAATCGGAAGCACTTCGCTTCAGGCTCTCTATCGGTGCGTGCCGAGTCCCTAAGTGTTAGGCTGGAAAGCATCT

idx 8 locidx 435
22 A
27 (22, 5, 5, 0)
[ 0 20  0  0]
23 C
28 (23, 5, 5, 0)
[20  0  0  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 20]
37 A
42 (37, 5, 5, 0)
[ 0 20  0  0]
49 A
54 (49, 5, 5, 0)
[ 0 20  0  0]
65 C
70 (65, 5, 5, 0)
[20  0  0  0]
CCCATCTCTAGATCGCAATCTCACATTCGTGGTGTGGAATGTGTCTACTACCTTGAATGTTAGGTCACTGGAAGACTTCGGGCAAT

idx 8 locidx 436
3 T
8 (3, 5, 5, 0)
[ 0  0 19  0]
12 T
17 (12, 5, 5, 0)
[ 0  0 19  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 19]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 19]
44 Y
49 (44, 5, 5, 0)
[ 8  0 11  0]
52 C
57 (52, 5, 5, 0)
[19  0  0  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 19  0]
67 T
72 (67, 5, 5, 0)
[ 1  0 18  0]
73 A
78 (73, 5, 5, 0)
[ 0 19  0  0]
CACTTCCCCCGGTAACTATTAGCAGCACATCTATCTGGTGAAACYCGTTCTTCCGGATTCTTCGTTCTGATACAGTGCACATCCAA

idx 8 locidx 437
16 G
21 (16, 5, 5, 0)
[ 0  0  0 22]
27 T
32 (27, 5, 5, 0)
[ 0  0 22  0]
58 C
63 (58, 5, 5, 0)
[22  0  0  0]
68 C
73 (68, 5, 5, 0)
[22  0  0  0]
AGTAGATCGCGCCTGAGTCGCCCTTAATCCTGATACGTTTCTACGGATGGGACCGAATCGGATCGGTGCGCCAATGGAGGTTAAAC

idx 8 locidx 438
21 T
26 (21, 5, 5, 0)
[ 0  0 20  0]
74 C
79 (74, 5, 5, 0)
[20  0  0  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 20]
81 C
86 (81, 5, 5, 0)
[20  0  0  0]
GCGTCCTGCCCATTTTGCAGATATTGAATATGAGTAGTTACCGTGGACTCGGTGTGAACCTAGTAACTGTCAAACGCGGCCCCTAG

idx 8 locidx 439
9 T
14 (9, 5, 5, 0)
[ 0  0 16  0]
15 A
20 (15, 5, 5, 0)
[ 0 16  0  0]
22 C
27 (22, 5, 5, 0)
[16  0  0  0]
37 A
42 (37, 5, 5, 0)
[ 0 16  0  0]
82 C
87 (82, 5, 5, 0)
[16  0  0  0]
TAGCCCTGCTCAAACAGACTGGCTCGCAGCATAATGCACCCAAATGGAGAATCGTTGGACACCCCGCACCAAGTACATTCCGCTTA

idx 8 locidx 440
0 G
5 (0, 5, 5, 0)
[ 0  0  0 15]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 15]
57 T
62 (57, 5, 5, 0)
[ 0  0 15  0]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 15]
84 A
89 (84, 5, 5, 0)
[ 0 15  0  0]
GCGGTGGTCCGGATAATCGTATATAGATCTACACTCCCTGGCGACAGGGCCTAGATGTGCGGTGACGCTTCTCATTTATTGACCAT

idx 8 locidx 441
7 C
12 (7, 5, 5, 0)
[17  0  0  0]
8 G
13 (8, 5, 5, 0)
[ 0  0  0 17]
11 G
16 (11, 5, 5, 0)
[ 0  0  0 17]
15 T
20 (15, 5, 5, 0)
[ 0  0 17  0]
32 A
37 (32, 5, 5, 0)
[ 0 17  0  0]
33 T
38 (33, 5, 5, 0)
[ 0  0 17  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 17  0]
TCGTTATCGTCGGTCTATTACGAGTACCGTCCATTGAAGCAGCGTTGCGGTCTGTTGACATGAGAGCGCCTATCTGTAATACTAAA

idx 8 locidx 442
2 C
7 (2, 5, 5, 0)
[21  0  0  0]
14 T
19 (14, 5, 5, 0)
[ 0  0 21  0]
29 W
34 (29, 5, 5, 0)
[ 0  9 12  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 21]
65 A
70 (65, 5, 5, 0)
[ 0 21  0  0]
79 A
84 (79, 5, 5, 0)
[ 0 21  0  0]
AACTTTTCCCTAGCTGATATTACTACATTWTATCCATTTCTCACACTCGCGCTCTGAAAGTCAGTATAAAGCCGAGCGTACGTACT

idx 8 locidx 443
70 A
75 (70, 5, 5, 0)
[ 0 22  0  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 22]
TTCGCATTCCATTGTGGTCCTAGTTTAATACTCGTACTCATACGTCGGTTACGATAACTGCCACCCGATAACTAGGACTGAAGCTA

idx 8 locidx 444
52 A
57 (52, 5, 5, 0)
[ 0 22  0  0]
78 K
83 (78, 5, 5, 0)
[ 0  0  9 13]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 22]
TGTTAATCACTGGCAGTAGGCGGGCAAAACGCGTGTAATTTCGCTTGCGCAGATGGGTGAATTGAAAACGCGACCATCKGTACCCA

idx 8 locidx 445
15 W
20 (15, 5, 5, 0)
[ 0 10  8  0]
31 T
36 (31, 5, 5, 0)
[ 0  0 18  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 18]
83 A
88 (83, 5, 5, 0)
[ 0 18  0  0]
ATCATAATACTCCCGWGGCGAGACGGGTTCATTACTACGTGAGACCGTTCGTTTTGGAAAACACAGGATCTCATTGACCTAGTACG

idx 8 locidx 446
5 T
10 (5, 5, 5, 0)
[ 0  0 19  0]
8 C
13 (8, 5, 5, 0)
[19  0  0  0]
18 C
23 (18, 5, 5, 0)
[19  0  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 19  0]
48 A
53 (48, 5, 5, 0)
[ 0 19  0  0]
ACGGTTATCGATAAGTGCCGACTCCTAGCTGCAATCCTTTGGATATACACTGCACCCGTTTTATACCCAGGTCCTCCTGCCGAGGA

idx 8 locidx 447
4 A
9 (4, 5, 5, 0)
[ 0 21  0  0]
6 T
11 (6, 5, 5, 0)
[ 0  0 21  0]
71 C
76 (71, 5, 5, 0)
[21  0  0  0]
AGAGAATGCGTCGATAATGGATCACACAGGGCTATAGATGTGAGCCTACTATAACAGAGTTTGGCGCGGAGCGGCAAGCTAGCACT

idx 8 locidx 448
17 C
22 (17, 5, 5, 0)
[20  0  0  0]
19 C
24 (19, 5, 5, 0)
[20  0  0  0]
26 C
31 (26, 5, 5, 0)
[20  0  0  0]
CAATGTCCGCGAGGACCCCCCCTAAACGACTCCAAGTTGTGAGCCCCAACCTCCTTCTTGCACGATAGAGTTCGCATGTCTCCTAG

idx 8 locidx 449
8 T
13 (8, 5, 5, 0)
[ 0  0 16  0]
21 A
26 (21, 5, 5, 0)
[ 0 16  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 16  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 16]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 16]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 16]
76 A
81 (76, 5, 5, 0)
[ 0 16  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 16  0  0]
AACGCCATTTTTGATGGGACAACACTGGCGGGCGTTGATTGGATTCTCGTTTAACGTGAAGGGAAGTGAGGGGACGAGTCAAAGGA

idx 9 locidx 450
34 G
39 (34, 5, 5, 0)
[ 0  0  0 20]
64 A
69 (64, 5, 5, 0)
[ 0 20  0  0]
GAAACTGTGTCCGTCGAGAGGTTGATCGTTCTTCGAAGTTATTTTAAATCAGGCGCCATAGCCTAATCCAAGGCGGTGATGCAGAT

idx 9 locidx 451
56 A
61 (56, 5, 5, 0)
[ 0 24  0  0]
70 C
75 (70, 5, 5, 0)
[23  1  0  0]
GGACCAGCTAACGGAACAATGGTAGGTTGCTAAGATGAGGGTCAGCCCTACAAAAGAATCTTAATTAGTCCGCAGCATCCCTAAAT

idx 9 locidx 452
5 T
10 (5, 5, 5, 0)
[ 0  0 23  0]
22 C
27 (22, 5, 5, 0)
[23  0  0  0]
63 C
68 (63, 5, 5, 0)
[23  0  0  0]
76 C
81 (76, 5, 5, 0)
[23  0  0  0]
TCAACTATGCGTGCACCCGTCACCGTGTGCACCTCGGGTGGTCTCTGAGACAGTATAGCAATTCCGGACACAAGGCCGCCATCAAC

idx 9 locidx 453
2 G
7 (2, 5, 5, 0)
[ 0  0  0 22]
3 G
8 (3, 5, 5, 0)
[ 0  0  0 22]
24 R
29 (24, 5, 5, 0)
[ 0  6  0 16]
47 T
52 (47, 5, 5, 0)
[ 0  1 21  0]
66 A
71 (66, 5, 5, 0)
[ 0 22  0  0]
68 C
73 (68, 5, 5, 0)
[22  0  0  0]
70 T
75 (70, 5, 5, 0)
[ 0  0 22  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 22  0]
ATGGCGGGTCAGCTAACGGACCGARGGCCGCCTTATTACCGTACTGCTGGGGTACCCTGATGAAGAATCGTATCGCTTCCTTCCTC

idx 9 locidx 454
16 C
21 (16, 5, 5, 0)
[19  0  0  0]
48 C
53 (48, 5, 5, 0)
[19  0  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 19  0]
72 C
77 (72, 5, 5, 0)
[19  0  0  0]
GAGCGACATGACCCGACTACTTCGGTAGTTGTCCTTTCATTTAGCTGACCTTGGATGATTCCCTATATAAAACATAGTTCGAAGAG

idx 9 locidx 455
8 C
13 (8, 5, 5, 0)
[20  0  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 20  0  0]
20 A
25 (20, 5, 5, 0)
[ 0 20  0  0]
72 C
77 (72, 5, 5, 0)
[20  0  0  0]
TCGAGACACCGTTATCTATCAATATTGTCCTAAGGTGGAAACGACTCTTTCTAGTGGACCGTCTACGCACGCCATGCCTGAAATAT

idx 9 locidx 456
17 C
22 (17, 5, 5, 0)
[22  0  0  0]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 22]
GGAATGGCGGCGTTATACCAACGGTCGCTTATAATACATGCAAGTGGAAGAGACATCTGTGAGTGACGCACAGAGAGAGACGCATT

idx 9 locidx 457
9 C
14 (9, 5, 5, 0)
[19  0  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 19  0  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 19  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 19  0]
CCCGAACTACGAGTCCTAGACCCTCAACAGACGCCGGGTGCAGGTTGGGTATCCCTGGTTGACGCGAGCCAAGGTGCGCCCATGAT

idx 9 locidx 458
1 T
6 (1, 5, 5, 0)
[ 0  0 22  0]
24 A
29 (24, 5, 5, 0)
[ 0 22  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 22  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 22]
74 A
79 (74, 5, 5, 0)
[ 0 22  0  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 22]
ATTAGCCTTCCTCCTGAGGACATTATTCACGCAATTCTGAGTCCAAGGCGAATCTTAGCACTAAGCGAAGCGGAAGCTGTATCTAT

idx 9 locidx 459
52 A
57 (52, 5, 5, 0)
[ 0 18  0  0]
ACTGACATCCAAAATAGATATGCCCCAAGATCTCTTGTACCGCCGTGCATTTAATCCAGTTTCCACCTTTGAACACTTATACGACA

idx 9 locidx 460
14 C
19 (14, 5, 5, 0)
[22  0  0  0]
25 T
30 (25, 5, 5, 0)
[ 0  0 22  0]
29 T
34 (29, 5, 5, 0)
[ 0  0 22  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 22  0]
ACGTGATGGCTATCCATAGAGCGCCTTATTTGCGGGTACGTACACCCATCATGTGCCCCGAAGACTGGGTGATTTCGCCCGAGCGT

idx 9 locidx 461
19 C
24 (19, 5, 5, 0)
[22  0  0  0]
TCGCCCCCAAACCTACTCACATAGGCTTCAGGTTGACCCATTTTATAGTGGACGGCCGAAGCGGGCGGTGATTCACGGATCGGAAT

idx 9 locidx 462
3 G
8 (3, 5, 5, 0)
[ 0  0  0 18]
9 C
14 (9, 5, 5, 0)
[18  0  0  0]
13 T
18 (13, 5, 5, 0)
[ 0  0 18  0]
38 C
43 (38, 5, 5, 0)
[18  0  0  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 18]
80 T
85 (80, 5, 5, 0)
[ 0  0 18  0]
GATGGTGCGCTGCTGTTATGATAACCTGAGTCGTTGACCCGCCTAAAAGGCAAGGGCGTTGGCCGGCTTTTCATTATTAGTCCAGC

idx 9 locidx 463
4 G
9 (4, 5, 5, 0)
[ 0  0  0 23]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 23]
GTTCGACGCCATATCTTGGGCTATTTACTACCAGTTTTGAGGTGAACTTGTCCAGATCGTGGAGTGACTAACAACCACGTTTGCGT

idx 9 locidx 464
36 G
41 (36, 5, 5, 0)
[ 0  0  0 23]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 23]
CTGTAGAACGGTGCCTCTTGAAAGAGGCGAGCGGACGAAATATGCTTCTAGAAACAATGTTTAATACTCCACGACCTGACGGGGCG

idx 9 locidx 465
5 T
10 (5, 5, 5, 0)
[ 0  0 15  0]
16 T
21 (16, 5, 5, 0)
[ 0  0 15  0]
22 C
27 (22, 5, 5, 0)
[15  0  0  0]
59 C
64 (59, 5, 5, 0)
[15  0  0  0]
GCTATTACGGGCCGGATCACCCCGGGTACTGTGACGAGCTTTGGTTATCACCGGCCTTCCTGGGGTGTCCAGCAACACACGTATAG

idx 9 locidx 466
38 G
43 (38, 5, 5, 0)
[ 0  0  0 21]
44 C
49 (44, 5, 5, 0)
[21  0  0  0]
82 C
87 (82, 5, 5, 0)
[21  0  0  0]
TGTGGTTAGGCGTCAGGCGAAAGGCCGAGCACGAGTGCGTTGAGCATGAGCCAAAATCATGTGCGGACGCCTGCCGGGTAATCGAA

idx 9 locidx 467
31 A
36 (31, 5, 5, 0)
[ 0 24  0  0]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 24]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 24]
75 A
80 (75, 5, 5, 0)
[ 0 24  0  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 24  0]
CAATGCTTCATTCTTCGTCGAGGCGGACAGTAGATGGTCACACCTGAGCCTGGTCTAGCGCTTTTAGGCCTCGATACGTTTCTTAC

idx 9 locidx 468
11 C
16 (11, 5, 5, 0)
[18  0  0  0]
33 A
38 (33, 5, 5, 0)
[ 0 18  0  0]
TTTGCTCCAAGCAATCAGGTGGAAATCCCAGTGATCGAGTAGGGATGCGACGGTAGGGAAAGTCTGAAGTTATAGTCACTCTCAAA

idx 9 locidx 469
3 G
8 (3, 5, 5, 0)
[ 0  0  0 17]
9 T
14 (9, 5, 5, 0)
[ 0  0 17  0]
54 T
59 (54, 5, 5, 0)
[ 0  0 17  0]
55 A
60 (55, 5, 5, 0)
[ 0 17  0  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 17]
84 T
89 (84, 5, 5, 0)
[ 0  0 17  0]
85 A
90 (85, 5, 5, 0)
[ 0 17  0  0]
TCGGACGTTTGATAATGGACGATCCCTTACCAGTCTACAATTCCTGGTCGCCAGTACACGCCTCAGATTATTTTGGCTCCCGCATA

idx 9 locidx 470
1 C
6 (1, 5, 5, 0)
[19  0  0  0]
66 C
71 (66, 5, 5, 0)
[19  0  0  0]
GCAAAGCACGGATCACCCCCGCCCATCTCCCAGGCTTAATTCCCACATCTACTGTGTTTAAGGTAGCACTTCCATGTTGAAATATC

idx 9 locidx 471
15 A
20 (15, 5, 5, 0)
[ 0 15  0  0]
55 C
60 (55, 5, 5, 0)
[15  0  0  0]
ATCAGTTATTCCTCCATTTCATCAAATTTAAAGCAGGGGACTCGTACTATCATTGCACTCCGCGGGACAGTAGTAGATAGGGCCGC-

idx 9 locidx 472
2 G
7 (2, 5, 5, 0)
[ 0  0  0 15]
35 A
40 (35, 5, 5, 0)
[ 0 15  0  0]
45 C
50 (45, 5, 5, 0)
[15  0  0  0]
47 C
52 (47, 5, 5, 0)
[15  0  0  0]
55 C
60 (55, 5, 5, 0)
[15  0  0  0]
57 C
62 (57, 5, 5, 0)
[15  0  0  0]
58 S
63 (58, 5, 5, 0)
[8 0 0 7]
62 A
67 (62, 5, 5, 0)
[ 0 15  0  0]
81 C
86 (81, 5, 5, 0)
[15  0  0  0]
AAGAACAATTACACCCATTATACGCCTTTATAAGCATCGTAAATTCTCAATCGGGCGCSACAAGTCACCAATCAGCGACCACTGGG

idx 9 locidx 473
2 A
7 (2, 5, 5, 0)
[ 0 19  0  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 19  0]
28 A
33 (28, 5, 5, 0)
[ 0 19  0  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
TGAACCTTTGACGTCCCTGTTGATCCCTAATTAGCTGGCTATGCCTGCTGCTTCAACATAACATGTGTGAATTTAGGTTTTGGTCG

idx 9 locidx 474
5 T
10 (5, 5, 5, 0)
[ 0  0 20  0]
13 C
18 (13, 5, 5, 0)
[20  0  0  0]
CGCGGTTCTCGAACACTGGAACGCGTCTCTAGTTTGGGTAGTTCTGAATGCGTAGGAAGGCTAGAACAGCGGCATGTTCATGTGCT

idx 9 locidx 475
29 C
34 (29, 5, 5, 0)
[25  0  0  0]
39 C
44 (39, 5, 5, 0)
[25  0  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 25  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 25]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 25]
60 A
65 (60, 5, 5, 0)
[ 0 25  0  0]
GCGACTCAACTACGTTGAACAATTGAGCTCAATCGTAGTCACCTGTAGGCTGCTCCCGCAATCAGATGACATGGTTTCGGCGCGCC

idx 9 locidx 476
10 A
15 (10, 5, 5, 0)
[ 0 25  0  0]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 25]
32 T
37 (32, 5, 5, 0)
[ 0  0 25  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 25  0]
TTGATACCATACAGGACTACCGATCTCGTCAATCAGTGCATTATCGCGAATATGTGAAACAGGACACAATCTTCTATCACACAAGT

idx 9 locidx 477
27 C
32 (27, 5, 5, 0)
[20  0  0  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 20  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 20]
73 T
78 (73, 5, 5, 0)
[ 0  0 20  0]
CAAGTTCCATGGGATCTCCGGGTTAAACTCTAAGCATGCATTCATTTGCACGCGCAAACGCGTCGCGTATCATTGGAATAGTGTGT

idx 9 locidx 478
15 A
20 (15, 5, 5, 0)
[ 0 15  0  0]
20 A
25 (20, 5, 5, 0)
[ 0 15  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 15  0  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 15]
CTATCGGCCCAGCTTATCGAAACGAAGTTTATGTTATCAACGGCTTACTGGTGACCACCACAAAGCTTCCGGGGGGTATGCGACAT

idx 9 locidx 479
2 G
7 (2, 5, 5, 0)
[ 0  0  0 20]
28 T
33 (28, 5, 5, 0)
[ 0  0 20  0]
61 A
66 (61, 5, 5, 0)
[ 0 20  0  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 20]
77 C
82 (77, 5, 5, 0)
[20  0  0  0]
81 A
86 (81, 5, 5, 0)
[ 0 20  0  0]
AAGCTATGTCGTCTTAGCCGATTTTCGCTCGGTTTCAGCATAAAATACTGATCTGACCATTAGACGCAACCCGCTCTCTCCAGATG

idx 9 locidx 480
8 A
13 (8, 5, 5, 0)
[ 0 15  0  0]
14 T
19 (14, 5, 5, 0)
[ 0  0 15  0]
19 C
24 (19, 5, 5, 0)
[15  0  0  0]
36 A
41 (36, 5, 5, 0)
[ 0 15  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 15]
GATTATAGACTGGATGTTCCCGTGCGAGCAATTATAAGCCGGCCTATGGAGCTCGCAAGTCTATGTGTGGAATATCTGCTCAACAC

idx 9 locidx 481
27 A
32 (27, 5, 5, 0)
[ 0 19  0  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 19  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 19  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 19]
TGTAACGTTCCCAGTACTTATGCCCCAAAGCTGAGCCTTTGTGTTGCCCGGCGCACCGCATAGCGAAGGACGTCAACCAATCATAC

idx 9 locidx 482
28 C
33 (28, 5, 5, 0)
[20  0  0  0]
38 A
43 (38, 5, 5, 0)
[ 0 20  0  0]
61 T
66 (61, 5, 5, 0)
[ 0  1 19  0]
63 C
68 (63, 5, 5, 0)
[20  0  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 20  0  0]
82 T
87 (82, 5, 5, 0)
[ 0  0 20  0]
83 C
88 (83, 5, 5, 0)
[20  0  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 20]
CTCCTCTTGCGTAGTTTGATCGGGCGTCCAGGGGTGATACTACGACGTAGTCCTCATTGACTACATTACCCAAAGGAGAGGATCCG

idx 9 locidx 483
1 C
6 (1, 5, 5, 0)
[17  0  0  0]
8 C
13 (8, 5, 5, 0)
[17  0  0  0]
31 C
36 (31, 5, 5, 0)
[17  0  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 17]
59 A
64 (59, 5, 5, 0)
[ 0 17  0  0]
GCAGTGAACACTAGACCCTTTCTGGACCGGTCGTTCAGGGACTCAGTTGTCGCTCCGCCATTCCCCTTGTCACATGCAAACATTCG

idx 9 locidx 484
18 T
23 (18, 5, 5, 0)
[ 0  0 25  0]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 25]
43 T
48 (43, 5, 5, 0)
[ 0  0 25  0]
59 C
64 (59, 5, 5, 0)
[25  0  0  0]
61 Y
66 (61, 5, 5, 0)
[14  0 11  0]
AGGCGAGCTCTACTTCCATCATAGAAGGTAGATATTAATCTTCTGTCCTATCTGTGGACCTYTAGCATGCTAACGCAATTTTCCAG

idx 9 locidx 485
14 T
19 (14, 5, 5, 0)
[ 0  0 17  0]
26 A
31 (26, 5, 5, 0)
[ 0 17  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 17]
57 C
62 (57, 5, 5, 0)
[17  0  0  0]
64 C
69 (64, 5, 5, 0)
[17  0  0  0]
81 R
86 (81, 5, 5, 0)
[0 8 0 9]
ATACTTCGCCCGGTTCTCCATACCCCATTCTTTGCTGCTTCTTCTGAGCGCACTCGACCTATGCCTAGTCGCACCTCGCATRTTTG

idx 9 locidx 486
10 T
15 (10, 5, 5, 0)
[ 0  0 18  0]
23 C
28 (23, 5, 5, 0)
[18  0  0  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 18]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 18]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 18]
TCGGGTGGTTTCAGGGTTCAGCGCCAGACACCCCTCAATCTTATTGCGCGGTCGCGAGAGACTCGTGGACCCGTCGCGAAATAGCT

idx 9 locidx 487
3 G
8 (3, 5, 5, 0)
[ 0  0  0 19]
16 G
21 (16, 5, 5, 0)
[ 0  0  0 19]
23 T
28 (23, 5, 5, 0)
[ 0  0 19  0]
24 C
29 (24, 5, 5, 0)
[19  0  0  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 19  0]
31 A
36 (31, 5, 5, 0)
[ 0 19  0  0]
76 C
81 (76, 5, 5, 0)
[19  0  0  0]
AGCGCAAGTTCGGGGAGTTAACATCTTATGAATTTGCGACCAATTACATTAGTAAACCCCCGGCGTCGTCAGTAGTCAATTTCTCC

idx 9 locidx 488
23 Y
27 (23, 5, 5, 1)
[14  0  7  0]
32 G
36 (32, 5, 5, 1)
[ 0  0  0 21]
39 T
42 (39, 5, 5, 2)
[ 0  0 21  0]
62 C
65 (62, 5, 5, 2)
[21  0  0  0]
TTACACATTACACCTCTGCGG-CYTGTTCGATGCATGA-TTGATGCCTGCAGCTTCCATGCCCCGGTTGTTTCTTTATCCTGACACTG

idx 9 locidx 489
0 T
5 (0, 5, 5, 0)
[ 0  0 20  0]
36 C
41 (36, 5, 5, 0)
[20  0  0  0]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 20]
62 C
67 (62, 5, 5, 0)
[20  0  0  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 20  0]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 20]
82 A
87 (82, 5, 5, 0)
[ 0 20  0  0]
TAAATCATGTCGTGGTGTGGTGTAGTACGGTCGGCGCATGAAACCGTGTCACAATACTGTCACCATATCACACGATACTGTGATGC

idx 9 locidx 490
30 C
35 (30, 5, 5, 0)
[16  0  0  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 16]
39 C
44 (39, 5, 5, 0)
[16  0  0  0]
46 C
51 (46, 5, 5, 0)
[16  0  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 16]
74 C
79 (74, 5, 5, 0)
[16  0  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 16  0  0]
GATTCTCTACGAAAGTGGGTCTTTATCGTTCGTTACGGGCCTTCGGCGTTTGTTGGGGAGTGAGACGCGAGTCCCACATTATCTCG

idx 9 locidx 491
36 T
41 (36, 5, 5, 0)
[ 0  0 21  0]
57 A
62 (57, 5, 5, 0)
[ 0 21  0  0]
65 R
70 (65, 5, 5, 0)
[ 0  9  0 12]
TAACTGTGAGTATCAGACGCTCGGTCGCTCAAGTACTGAGAAAGTGGACCGTCCCCTAGACTAACRAAGTTATCCCGATGAGCCAT

idx 9 locidx 492
29 C
34 (29, 5, 5, 0)
[21  0  0  0]
37 A
42 (37, 5, 5, 0)
[ 0 21  0  0]
46 A
51 (46, 5, 5, 0)
[ 1 20  0  0]
TTAACTCAAGCCAAGGGTATGCGCGCGGGCTCTCCTAATCCCGATGACGAGGCGGGGAAGACCATGCTGCTCGTTAAATGATGACT

idx 9 locidx 493
44 S
49 (44, 5, 5, 0)
[ 8  0  0 10]
46 T
51 (46, 5, 5, 0)
[ 0  0 18  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 18]
AGATAATCAATCGCCCGTCGCCAGATACATCGTATGGAGTTATTSGTTATAGAAGTTTGTATGTCGCAACTGACACCGAACTTAAC

idx 9 locidx 494
18 C
23 (18, 5, 5, 0)
[21  0  0  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 21]
72 C
77 (72, 5, 5, 0)
[21  0  0  0]
82 W
87 (82, 5, 5, 0)
[ 0 12  9  0]
AATTGACAATAATTACCTCTGATATCCAAGACTAGCTTATTAGTTATGGGTTATGACTAATGGCTCTATTGCCGCGCGTGAAWCTC

idx 9 locidx 495
34 G
39 (34, 5, 5, 0)
[ 0  0  0 18]
40 T
45 (40, 5, 5, 0)
[ 0  0 18  0]
55 A
60 (55, 5, 5, 0)
[ 0 18  0  0]
ATTGCTCAGAGCAAACTCACGTGTTGGTAGCTCCGAGGTTTATCCATGGATTGGTATAGTGAATTGGATTTGTCCATTTGTCACCT

idx 9 locidx 496
28 T
33 (28, 5, 5, 0)
[ 0  0 19  0]
55 C
60 (55, 5, 5, 0)
[19  0  0  0]
CATAATTCCGAGTAGACATTAACCATATTTCATAAGCTTAGTACATTACACGATCCCCACAGCTACATGAGGGCTCCAGGGCTTCT

idx 9 locidx 497
9 G
14 (9, 5, 5, 0)
[ 0  0  0 20]
12 T
17 (12, 5, 5, 0)
[ 0  0 20  0]
13 C
18 (13, 5, 5, 0)
[20  0  0  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 20]
39 A
44 (39, 5, 5, 0)
[ 0 20  0  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 20  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 20]
AATACAACAGCTTCTTGAGCTCCCGATGACTGAACTGGGAAGACCGCACAAGCAAACGTGTTGTTAGTGACGCCTACTCTCCATGT

idx 9 locidx 498
11 A
16 (11, 5, 5, 0)
[ 0 19  0  0]
50 A
55 (50, 5, 5, 0)
[ 0 19  0  0]
TGAAAACAAGTACACGTTCCCCTCCCCTCCGACAAAGGAGCTTGCCGCAGATGACGTCTTGTTTTGGGCCACCAGATTATTTTAGG

idx 9 locidx 499
6 C
11 (6, 5, 5, 0)
[17  0  0  0]
8 A
13 (8, 5, 5, 0)
[ 0 17  0  0]
55 C
60 (55, 5, 5, 0)
[17  0  0  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 17]
TGCTCCCGATATGCATGAACACTTGGAGGGAGGACTTCTCCGTGAGTTCAAGGCTCAGTCGGCAAGACGTCAATGAATATGCGGTC

idx 10 locidx 500
0 C
5 (0, 5, 5, 0)
[22  0  0  0]
9 K
14 (9, 5, 5, 0)
[ 0  0 11 11]
12 T
17 (12, 5, 5, 0)
[ 0  0 22  0]
14 A
19 (14, 5, 5, 0)
[ 0 22  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 22  0]
43 C
48 (43, 5, 5, 0)
[22  0  0  0]
54 T
59 (54, 5, 5, 0)
[ 0  0 22  0]
63 A
68 (63, 5, 5, 0)
[ 0 22  0  0]
CGCGACTATKAATCAAGTGTTTCGCAGGGGCCAGCACTTCGATCCCACCTCACGTTACGGCTGACGTCGTGTGAAGTAGCAACTTC

idx 10 locidx 501
16 G
21 (16, 5, 5, 0)
[ 0  0  0 18]
34 A
39 (34, 5, 5, 0)
[ 0 18  0  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 18]
76 C
81 (76, 5, 5, 0)
[18  0  0  0]
GTAAGACCCCAATATAGCCCTATATTACTACAGGATACTTGTTATGTAGTCGTGCCCAATTTAAAACTTCCCGTACCATCCGACCT

idx 10 locidx 502
2 T
7 (2, 5, 5, 0)
[ 0  0 20  0]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 20]
26 C
31 (26, 5, 5, 0)
[20  0  0  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 20]
67 A
72 (67, 5, 5, 0)
[ 0 20  0  0]
TCTACTTCGAACAGGTACAGCCTGTGCACGAGCTTTAGTATGATATCGGGGCCCCCCACAATTGATAACAGCCAGGTCAACCCCGC

idx 10 locidx 503
2 G
7 (2, 5, 5, 0)
[ 0  0  0 16]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 16]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 16]
78 A
83 (78, 5, 5, 0)
[ 0 16  0  0]
TAGACGAATTTCAGCATCGGTCACACAGACCGCTAGGGCGCCCGCTCATGTGTTTTGGCAGCCCGGCTGCTCGCATGCACCGCGAA

idx 10 locidx 504
1 T
6 (1, 5, 5, 0)
[ 0  0 21  0]
71 T
76 (71, 5, 5, 0)
[ 0  0 21  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 21  0]
ATGATGTGTCCCCTAGCCGCGGAGATTAACAACCTTCTATCTTTCGCCGGCCGTAGTACATCCCTGCTTAGTCTAGATCCAGATTA

idx 10 locidx 505
8 G
13 (8, 5, 5, 0)
[ 0  0  0 20]
12 T
17 (12, 5, 5, 0)
[ 0  0 20  0]
17 G
22 (17, 5, 5, 0)
[ 0  0  0 20]
19 T
24 (19, 5, 5, 0)
[ 0  0 20  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 20]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 20]
ATAACGAAGGTCTTACTGATCAAATTTAGTAGTGACAGGCAGTATCACCCTCAGGGAAGACAACCCCGGCGTCTCGCCAACATGTT

idx 10 locidx 506
66 C
71 (66, 5, 5, 0)
[19  0  0  0]
75 C
80 (75, 5, 5, 0)
[19  0  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 19]
CGGTCTATCGAGATACAGAGCTGTGCGTTAAATTGTAAGCAGTCTGCTTGGATGCCAAACCTGTTCCACACCACGCATCGTAGTGG

idx 10 locidx 507
32 A
37 (32, 5, 5, 0)
[ 0 18  0  0]
34 C
39 (34, 5, 5, 0)
[18  0  0  0]
TCGGAGCCGGAGCTCTGTATTTATGACTACAGAGCTCCTAGTATAAAGCTCCGACTGTGGGTATTCTCGTTCGCGTAACCTGCAAG

idx 10 locidx 508
0 C
5 (0, 5, 5, 0)
[22  0  0  0]
2 A
7 (2, 5, 5, 0)
[ 0 22  0  0]
22 T
27 (22, 5, 5, 0)
[ 0  0 22  0]
46 C
51 (46, 5, 5, 0)
[22  0  0  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 22  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 22  0]
62 M
67 (62, 5, 5, 0)
[11 11  0  0]
CAAATTTGCCAATACTAAGGAGTAGGAATGAGCTGGGGTTGCAAGTCTAAATAGAATCCTGTMTGCTGACCGCGTGGTTATGTCTC

idx 10 locidx 509
1 C
6 (1, 5, 5, 0)
[22  0  0  0]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 22]
18 T
23 (18, 5, 5, 0)
[ 0  0 22  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 22  0]
70 C
75 (70, 5, 5, 0)
[22  0  0  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 22  0]
CCATTCCCGCACTGCTCATGACTGGTCATAGAGATCCGAGAGCCGTCAGGGTCAGTACTCTGGTAATGCTCGCTGAGTCTGCTGGC

idx 10 locidx 510
12 T
17 (12, 5, 5, 0)
[ 0  0 20  0]
20 R
25 (20, 5, 5, 0)
[ 0  9  0 11]
40 G
45 (40, 5, 5, 0)
[ 0  0  1 19]
43 C
48 (43, 5, 5, 0)
[20  0  0  0]
56 A
61 (56, 5, 5, 0)
[ 0 20  0  0]
68 A
73 (68, 5, 5, 0)
[ 0 20  0  0]
GCCCAGCCGCCCTGAGCACCRTCCACCTAGTCAGCTAGCTGTACTAACCTGCCTAGAGACGAATTTTGAGGAAATAAGGCGCTTTC

idx 10 locidx 511
34 C
39 (34, 5, 5, 0)
[19  0  0  0]
37 A
42 (37, 5, 5, 0)
[ 0 19  0  0]
44 A
49 (44, 5, 5, 0)
[ 0 19  0  0]
58 R
63 (58, 5, 5, 0)
[ 0 10  0  9]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 19]
GTTTCTGCAGTTGGCGCTGACGCCGGGTCGATCCCGAATATAGGAGTAGACCCCCGTARGACGCAAAGCCATGCGTGCAAGGTTCA

idx 10 locidx 512
45 G
50 (45, 5, 5, 0)
[ 0  0  0 18]
63 T
68 (63, 5, 5, 0)
[ 0  0 18  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 18]
CTACTTGTAGTCTTTCCACCAGACGTTATATCCGCTGTTACCTGAGACGTAGCTGGACGATGATATAACGTAGACGGTCGATATTT

idx 10 locidx 513
1 A
6 (1, 5, 5, 0)
[ 0 19  0  0]
59 C
64 (59, 5, 5, 0)
[19  0  0  0]
66 T
71 (66, 5, 5, 0)
[ 0  0 19  0]
82 A
87 (82, 5, 5, 0)
[ 0 19  0  0]
GAGCGAAGCAAGGGGATAGTACTTGTACTCGCTAAGAGAGTCCCGCAATAAAATCCCATCTCCTGGTATTCTGTAACGTACCATCG

idx 10 locidx 514
22 C
27 (22, 5, 5, 0)
[18  0  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 18]
51 A
56 (51, 5, 5, 0)
[ 0 18  0  0]
52 C
57 (52, 5, 5, 0)
[18  0  0  0]
ACCTCCACACATCGTGGGACTTCCCAAGACTATCGAAAGTTGCCTGCGGCAACGAACTGTGAGATCCGCTGAGTCAGTAAGGAAGA

idx 10 locidx 515
30 C
35 (30, 5, 5, 0)
[20  0  0  0]
42 A
47 (42, 5, 5, 0)
[ 0 20  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 20]
GAGTTTTTAATCGAGTATGTAGCGCGGAAGCAATCCCGCCTAAACTGGGCTATACAATGCGGGATTTTTACGATGATACGCTCAAC

idx 10 locidx 516
6 G
11 (6, 5, 5, 0)
[ 0  0  0 24]
20 T
25 (20, 5, 5, 0)
[ 0  0 24  0]
25 C
30 (25, 5, 5, 0)
[24  0  0  0]
68 T
73 (68, 5, 5, 0)
[ 0  0 24  0]
CTAAGCGGGACAGCACGGCCTACGCCAGTTCAGCGTAACTGAACACACTCTTTGCTAGCCATCGTCGCTTAGAGCGTTTGCACGTA

idx 10 locidx 517
25 G
30 (25, 5, 5, 0)
[ 0  0  0 19]
29 A
34 (29, 5, 5, 0)
[ 0 19  0  0]
30 T
35 (30, 5, 5, 0)
[ 0  0 19  0]
33 T
38 (33, 5, 5, 0)
[ 0  0 19  0]
48 T
53 (48, 5, 5, 0)
[ 0  0 19  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 19]
TGTTGGTTTAATGTTACACGCAGTAGAATATGGTAAGAGCGTGCCTGATCAACAGCATGAAGGCGGAGATTTTTCTACATTATTTA

idx 10 locidx 518
25 A
30 (25, 5, 5, 0)
[ 0 20  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 20]
69 A
74 (69, 5, 5, 0)
[ 0 20  0  0]
CATAGAAGAGTTAGCGACGGATTGTAACGTTACAGCAGTTAGAAACCTCGTACGTTCCGAGTCCCCCCTAATACGAGCTATCCCGG

idx 10 locidx 519
10 T
15 (10, 5, 5, 0)
[ 0  0 21  0]
31 T
36 (31, 5, 5, 0)
[ 0  0 21  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 21]
75 A
80 (75, 5, 5, 0)
[ 0 21  0  0]
GCAGAACAGCTGGCCTACCAGGACTTCCGCTTAACCTAATCGCCCCCATCGGGTCTACTCACGCAACCCCAATGAAACGATCCCTA

idx 10 locidx 520
55 A
60 (55, 5, 5, 0)
[ 0 21  0  0]
57 C
62 (57, 5, 5, 0)
[21  0  0  0]
CAGGCTAAAAATAGTGACTAATGCGGGTCGAAGGGGCCACGACCTCTAGTCTACAACCGAGCAACGATCAGAGAGCTACTTCGATC

idx 10 locidx 521
28 C
33 (28, 5, 5, 0)
[20  0  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 20  0]
GGATATACGGCGTTAATTAATCAGAATTCATGTGGCGACAGACTTGCTATGGCTGCGCAAGACACAACGTTTATCGGGGACTGCAG

idx 10 locidx 522
9 T
14 (9, 5, 5, 0)
[ 0  0 17  0]
20 T
25 (20, 5, 5, 0)
[ 0  0 17  0]
55 A
60 (55, 5, 5, 0)
[ 0 17  0  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 17]
CGCCTAGACTTGCGGCAATCTGGCCGGTGCCCTACACTCAAAATACGTCCCTCCCATTGTTGTCCCGATAGTCCGGGTCTTTCGAG

idx 10 locidx 523
7 G
12 (7, 5, 5, 0)
[ 0  0  0 16]
9 A
14 (9, 5, 5, 0)
[ 0 16  0  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 16]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 16]
81 T
86 (81, 5, 5, 0)
[ 0  0 16  0]
TTAGGCCGAACTATGCTACGTTTCTGGGTGGGCTCTAAAAAAGGTCTTACCGATGTACGTTGCTTCCGCACCGCTGCAGACTCGCT

idx 10 locidx 524
67 T
72 (67, 5, 5, 0)
[ 0  0 14  0]
85 A
90 (85, 5, 5, 0)
[ 0 14  0  0]
GGGGAGCGCCCTTTTCTCTGACTAGGTCTGCCAAAATCTGTTAATAATCGATCGATCTACCCATACGTAGAGGGATGGGTGGTTAA

idx 10 locidx 525
30 A
35 (30, 5, 5, 0)
[ 0 19  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 19  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 19]
TCTATTCTAGTGCATCAAACAGAGTTCGGGACAGTGAGCGAGCATCTATCTGCCCGGATCGCGAGGTACGACAATCTCATTTCCTG

idx 10 locidx 526
17 C
22 (17, 5, 5, 0)
[11  0  0  0]
36 C
41 (36, 5, 5, 0)
[11  0  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 11  0  0]
CGCGATTCCACAAATCTCCGTATATTTAGAACTCAGCTAAATAGTAACTTCCCCCGTAGTACCTTGAAATAACGTGACGCTGATGG

idx 10 locidx 527
9 C
14 (9, 5, 5, 0)
[19  0  0  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 19  0]
54 C
59 (54, 5, 5, 0)
[19  0  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 19  0  0]
62 A
67 (62, 5, 5, 0)
[ 0 19  0  0]
CGAGCGCTGCTAGTCGGGAACTCCTCTTCCGTGTGCACTAGCTTGTTGTCTCTCCATCAGAGATTGTTCCTGCTACCCGCATTAAG

idx 10 locidx 528
35 T
40 (35, 5, 5, 0)
[ 0  0 18  0]
56 C
61 (56, 5, 5, 0)
[18  0  0  0]
CTACACTCGGATAAAGCCGCGCTCCCGGCAATTGGTGGGTGGAACAACATAACCTTCTCTCGGTATTGATTTGCCCCGATTATCCC

idx 10 locidx 529
2 Y
7 (2, 5, 5, 0)
[10  1  9  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 20]
75 A
80 (75, 5, 5, 0)
[ 0 20  0  0]
AGYCCTAGGTTAAGACTCACCTCGGATGCACGGACGATAGATTTCTAATGCCGAACTAGATGGTATGGACCTAACAACACGGTTAG

idx 10 locidx 530
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
45 C
50 (45, 5, 5, 0)
[20  0  0  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 20]
67 T
72 (67, 5, 5, 0)
[ 0  0 20  0]
72 C
77 (72, 5, 5, 0)
[20  0  0  0]
79 A
84 (79, 5, 5, 0)
[ 0 20  0  0]
CATGAGTAACCCCCCCCTCTCCGGCTAGCCTGCGATATAGCATGACATTTACAGAATGGTGGCGGTATTTGCCACGGAGAGTGCTA

idx 10 locidx 531
37 A
42 (37, 5, 5, 0)
[ 0 17  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 17  0  0]
55 C
60 (55, 5, 5, 0)
[17  0  0  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 17  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 17]
72 A
77 (72, 5, 5, 0)
[ 0 17  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 17  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 17  0]
CGCCGGTCAGGGTCTTTCGTTGAAACCGTCAGGCATGAAATCCCCCTACAGAGGTCCGCTTTTCTGACTGCTAAGTTCTGAGTAGG

idx 10 locidx 532
24 C
29 (24, 5, 5, 0)
[16  0  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 16]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 16]
33 A
38 (33, 5, 5, 0)
[ 0 16  0  0]
40 T
45 (40, 5, 5, 0)
[ 0  0 16  0]
56 C
61 (56, 5, 5, 0)
[16  0  0  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 16  0]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 16]
CGGTTACACAACAACAAAATAGATCGGTAAGTAATCTATATCGCAAACCCAAAGGGCAACTCTGCGGCATACCTAGGCTCATGGGT

idx 10 locidx 533
9 C
14 (9, 5, 5, 0)
[19  0  0  0]
14 G
19 (14, 5, 5, 0)
[ 0  0  0 19]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 19]
37 W
42 (37, 5, 5, 0)
[ 0  9 10  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 19]
54 C
59 (54, 5, 5, 0)
[19  0  0  0]
56 Y
61 (56, 5, 5, 0)
[ 9  0 10  0]
81 W
86 (81, 5, 5, 0)
[ 0  9 10  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 19]
84 A
89 (84, 5, 5, 0)
[ 0 19  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 19]
GCATGTGAGCGAGGGAATCCTTAAGTGTCTCGGGGCCWGAATTTATGGGCACGCCAYTGCTGTGCATTAGTAAACCGGCTGWGAAG

idx 10 locidx 534
65 G
70 (65, 5, 5, 0)
[ 0  0  0 22]
TGAACCTGCTGGCAAACCAGTCCGTACCGTCACCAAAGTCACGTAAAGGTAGATCTATAATACCTGCCCTTAATACGTGAGCGGTG

idx 10 locidx 535
1 S
6 (1, 5, 5, 0)
[ 7  0  0 10]
4 C
9 (4, 5, 5, 0)
[17  0  0  0]
7 Y
12 (7, 5, 5, 0)
[ 7  0 10  0]
20 C
25 (20, 5, 5, 0)
[17  0  0  0]
24 C
29 (24, 5, 5, 0)
[17  0  0  0]
35 C
40 (35, 5, 5, 0)
[17  0  0  0]
49 T
54 (49, 5, 5, 0)
[ 0  0 17  0]
55 C
60 (55, 5, 5, 0)
[17  0  0  0]
60 A
65 (60, 5, 5, 0)
[ 0 17  0  0]
71 C
76 (71, 5, 5, 0)
[17  0  0  0]
CSTCCATYAAACAATAGTTACAGTCATTATAGAGCCTTGGGGCCCTCGCTCGCACCGACGACAAACCTGTCCTCGCACCCGGAGCG

idx 10 locidx 536
33 G
38 (33, 5, 5, 0)
[ 0  0  0 25]
36 C
41 (36, 5, 5, 0)
[25  0  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 25  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 25]
79 T
84 (79, 5, 5, 0)
[ 0  0 25  0]
ACGAGACCGACCGAGGTTGACTATCTAACTGGGGTGCGTATTGACGGCCTAGCAGTACCCACATCGCCCAATGCCTGGCTATCCTA

idx 10 locidx 537
18 C
23 (18, 5, 5, 0)
[20  0  0  0]
50 C
55 (50, 5, 5, 0)
[20  0  0  0]
63 C
68 (63, 5, 5, 0)
[20  0  0  0]
70 T
75 (70, 5, 5, 0)
[ 0  0 20  0]
79 A
84 (79, 5, 5, 0)
[ 0 20  0  0]
GACCAGGAGGGTTAGTTTCCTCTCGCTTTAAGGCGCCACGTCGAGCAAATCGCGAATACCGGACGCTTCGTCCTATGCGACCCTCG

idx 10 locidx 538
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
33 C
38 (33, 5, 5, 0)
[20  0  0  0]
TATAGATGCGGTGGCCGCTATCGAAACTGGCAGCTAGTTTAGATCCCCCCGCAACTA-CTTCGGTAACACCTAGTTCAAAAAGCTTT

idx 10 locidx 539
52 G
57 (52, 5, 5, 0)
[ 0  0  0 17]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 17]
70 T
75 (70, 5, 5, 0)
[ 0  0 17  0]
AGAAACATTTATAAACAAATGACAGCTCTATACTGTAGTTACATCAGTAGGCGACAGGGGAGTCTAATTGTGCTTGGGGCCTGACT

idx 10 locidx 540
16 A
21 (16, 5, 5, 0)
[ 0 21  0  0]
17 G
22 (17, 5, 5, 0)
[ 0  0  0 21]
21 T
26 (21, 5, 5, 0)
[ 0  0 21  0]
37 C
42 (37, 5, 5, 0)
[21  0  0  0]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 21]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
TTAAGCACAGCAACACAGTCGTTAGCTCGTTAATGTCCTCATGTTGTAGGCGGTTAATTTCCATTTGCTTGAGAAAGCCGTGACCC

idx 10 locidx 541
56 T
61 (56, 5, 5, 0)
[ 0  0 23  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 23  0]
GTGACAGACGCGGCCTCCTGCGTCAACGGCCGATTGTTCAGTGTCCAGCGGCTACTTCATATTAGAATGACAAGGAATGTTATTTT

idx 10 locidx 542
13 C
18 (13, 5, 5, 0)
[21  0  0  0]
20 A
25 (20, 5, 5, 0)
[ 0 21  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 21  0]
48 T
53 (48, 5, 5, 0)
[ 0  0 21  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 21]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 21]
TCGCTACTAGCTACCGATGAAATTCACGTGAGGCTCATGTTGGCTTTATGATAGATTCCGTATCGGTCTATCGGGGAAGTACGTGA

idx 10 locidx 543
62 G
67 (62, 5, 5, 0)
[ 0  0  0 21]
65 A
70 (65, 5, 5, 0)
[ 0 21  0  0]
CTGCGGTAGTTAACGAACAGCCTGTCTTGTCTAAAGGGTTAAAAATCAGGTCCGGTGTACAGGCGACGATAGAGAACCCCGGCCTA

idx 10 locidx 544
0 C
5 (0, 5, 5, 0)
[20  0  0  0]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 20]
30 A
35 (30, 5, 5, 0)
[ 0 20  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 20  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 20  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 20  0]
CCAACTGGGCGTCGCCATGTTCCTGATGTGAGTATAAACTGAGGAAAATTCCAGTTGATCGCACGCTACAAACCAAAAGTATAGTT

idx 10 locidx 545
57 A
62 (57, 5, 5, 0)
[ 0 17  0  0]
60 C
65 (60, 5, 5, 0)
[17  0  0  0]
TTCCGCTCACACGATATTAGAGGGGCCGTGCCCGCCTAAACTCCGGTAGAGTACCCTACGCTTTATCTACCCTTGGTTATTCCGAC

idx 10 locidx 546
44 A
49 (44, 5, 5, 0)
[ 0 23  0  0]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 23]
CTACTTAAAACCAACACTTTTCTTCGGGGCACACTGCAGCATCGAAGCCGCTACACCCACGGCCGGAACTTTGAAAGGTGGCGACC

idx 10 locidx 547
25 A
30 (25, 5, 5, 0)
[ 0 21  0  0]
33 M
38 (33, 5, 5, 0)
[13  8  0  0]
49 C
54 (49, 5, 5, 0)
[21  0  0  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 21]
67 A
72 (67, 5, 5, 0)
[ 0 21  0  0]
ACTTGACGTTGAGATGGTGGGACGTATGGTACGMACACAATCCAAAAAACGTCGAGGATTCGGTACTATGGCTTTCTAGCAGCACC

idx 10 locidx 548
27 C
32 (27, 5, 5, 0)
[23  0  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 23  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 23]
72 C
77 (72, 5, 5, 0)
[23  0  0  0]
GTGTGGTGTATGTACGTGAGGCCATTTCTTAAGCTACAAGGTGTTAAGACGAGCGCGGAATTCAACCTTGGACTTATTGCAGCAGT

idx 10 locidx 549
13 C
18 (13, 5, 5, 0)
[19  0  0  0]
14 A
19 (14, 5, 5, 0)
[ 0 19  0  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 19]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 19]
CGCCCCCAAATTGCAGCGTACGGGGCCATGGCCGATGCTTGAACATGATCAGCGGTATTTAAGTAAGAATTTAACGATGCCCTGGC

idx 11 locidx 550
5 C
10 (5, 5, 5, 0)
[16  0  0  0]
23 A
28 (23, 5, 5, 0)
[ 0 16  0  0]
38 G
43 (38, 5, 5, 0)
[ 0  0  0 16]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 16]
81 A
86 (81, 5, 5, 0)
[ 0 16  0  0]
TAAGGCAGTCATCTTTTTCAGCAACCCTCCGAGCCGAAGCAGTTCTCTCAATTATTGGTACTGAGCAATTGAGAGGCATCCACCCT

idx 11 locidx 551
40 G
45 (40, 5, 5, 0)
[ 0  0  0 21]
52 T
57 (52, 5, 5, 0)
[ 0  0 21  0]
GGAGTTGTTTGCTAATCCTCACGCTGTTGTCCGCTTTAGTGTCTTCAACGATTCCGGCCTAATTGCCCTGACGACATGCCGTCGCC

idx 11 locidx 552
29 C
34 (29, 5, 5, 0)
[16  0  0  0]
41 T
46 (41, 5, 5, 0)
[ 0  0 16  0]
65 A
70 (65, 5, 5, 0)
[ 0 16  0  0]
ATTACCGAAGCTCCTGGGAGACTGAACCACCAAGAAAGCGATCCGAAAACATTGGGGCGTGGGATAAACCAATGTTTGAACCGTTG

idx 11 locidx 553
3 T
8 (3, 5, 5, 0)
[ 0  0 23  0]
4 A
9 (4, 5, 5, 0)
[ 0 23  0  0]
21 T
26 (21, 5, 5, 0)
[ 0  0 23  0]
38 A
43 (38, 5, 5, 0)
[ 0 23  0  0]
65 A
70 (65, 5, 5, 0)
[ 0 23  0  0]
CATTAATAACACAAGACCCCATAGTCATATCCGAAGTTAAGCAATCGTTAGGTGCTTATTGCAGAATCGCATTTTGGATCTTCTCG

idx 11 locidx 554
2 C
7 (2, 5, 5, 0)
[19  0  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 19  0]
81 A
86 (81, 5, 5, 0)
[ 0 19  0  0]
TACAGGGCTGCATGTGGAGGCTAGGGGACAGAGGTACCCGCGAATTACAGCGAATTTATCCTGAGCTTGGCCCGGGTGAGCAAGAC

idx 11 locidx 555
7 T
12 (7, 5, 5, 0)
[ 0  0 18  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 18  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 18]
CTACCGGTCAGTTGCACATCCGTCTATGTAATGTAGCGAATTTCATGAATCTAATCGTCCGCCCCTACGGATTAAAGGTTTATAGT

idx 11 locidx 556
26 A
31 (26, 5, 5, 0)
[ 0 22  0  0]
69 C
74 (69, 5, 5, 0)
[22  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 22  0  0]
CTGAAACATACGTTAGTTCCAAACTCAGTATAATGATAGATTAAATGTTGTAATGGACCTAGGTCACGGCACACTACGGCGCTCGT

idx 11 locidx 557
32 A
37 (32, 5, 5, 0)
[ 0 21  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 21  0  0]
AGGCCTGTCAAGCAGCTGGGTACCGCATTTAGAACCGGGTGTTCCCAGCGAACGCTTAAACCTGCCGCCAGAATGACAAGTAAGTA

idx 11 locidx 558
32 G
37 (32, 5, 5, 0)
[ 0  0  0 18]
57 C
62 (57, 5, 5, 0)
[18  0  0  0]
61 A
66 (61, 5, 5, 0)
[ 0 18  0  0]
78 C
83 (78, 5, 5, 0)
[18  0  0  0]
CAGTTCAAGGAGTAGCATATCGTAAAGTCTCTGGGTTAGGCCTTGAAGTTCCCGATGCGTAACTTACCTCTTGTATCCCAGAAGGG

idx 11 locidx 559
41 T
46 (41, 5, 5, 0)
[ 0  0 23  0]
57 A
62 (57, 5, 5, 0)
[ 0 23  0  0]
CAAGAGAGTTCTGTCTGGGCCGGAAGGTCCCCTGAACAGCCTGGAAGAGAAGGTACGACCTTGTAGTAATCACACAAGGGATAGTT

idx 11 locidx 560
16 G
21 (16, 5, 5, 0)
[ 0  0  0 18]
33 A
38 (33, 5, 5, 0)
[ 0 18  0  0]
72 R
77 (72, 5, 5, 0)
[ 0 11  0  7]
77 T
82 (77, 5, 5, 0)
[ 0  0 18  0]
ACGAAATTGCAGGAGTGCTGCTGTAGTATCGTAAGCATCCGCAACCAGCAGACCGAAAGATATGCTGGACATRATTGTATTGATGG

idx 11 locidx 561
11 G
16 (11, 5, 5, 0)
[ 0  0  0 22]
18 A
23 (18, 5, 5, 0)
[ 0 22  0  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 22]
41 A
46 (41, 5, 5, 0)
[ 0 22  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 22  0  0]
66 T
71 (66, 5, 5, 0)
[ 0  0 22  0]
81 C
86 (81, 5, 5, 0)
[22  0  0  0]
GAGTCGGCCTAGGCAGCTATTAGAGCAACGCAATCTTGGCGACTCAATTCCCCTGGCCCCACTATGTACGATCGCACGAGCCGGAT

idx 11 locidx 562
25 C
30 (25, 5, 5, 0)
[22  0  0  0]
49 C
54 (49, 5, 5, 0)
[22  0  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 22  0]
54 C
59 (54, 5, 5, 0)
[22  0  0  0]
ATACAGCGTATCACAGTGTAGATCACGAAGGACTTCTTACTCGAGTACTCATTCCCCGATTCTAGTTGTTCGTGCGGCCGGACGGA

idx 11 locidx 563
27 A
32 (27, 5, 5, 0)
[ 0 17  0  0]
32 T
37 (32, 5, 5, 0)
[ 0  0 17  0]
45 A
50 (45, 5, 5, 0)
[ 0 17  0  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 17]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 17]
83 T
88 (83, 5, 5, 0)
[ 0  0 17  0]
AGCCTAACGATGCCGTATCCTAGCTAAATTCGTCGTGTGATCGCGAGTGCTTCCAACGGAGTATGCCTGGGTCTTAGACAAGCTTA

idx 11 locidx 564
1 T
6 (1, 5, 5, 0)
[ 0  0 19  0]
28 A
33 (28, 5, 5, 0)
[ 0 19  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 19  0  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 19]
CTGGGATCAGGCAATAGAACGGTTCAAAAGTCGTATATTCTAAATCGCGAACGGTTCATGATATTGGGGCTTAACGTCAGTGATTG

idx 11 locidx 565
59 T
64 (59, 5, 5, 0)
[ 0  0 19  0]
AGTGTATTCGAGCCTAACGAATAGATGCAGGAACGTCTTCTTGTCGGTGCTCAACCGGTTCCGGCACCTCGCCACACAAGAGGAGT

idx 11 locidx 566
11 G
16 (11, 5, 5, 0)
[ 0  0  0 19]
13 A
18 (13, 5, 5, 0)
[ 0 19  0  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 19]
42 T
47 (42, 5, 5, 0)
[ 0  0 19  0]
50 T
55 (50, 5, 5, 0)
[ 0  0 19  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 19  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 19]
78 T
83 (78, 5, 5, 0)
[ 0  0 19  0]
AAAGGACCTCGGAATTTAGCGTGATTGTAGGTCAACAAGTTATAGTTGTGTTTGCCACGTCGGCGGACGCGAGTATCTTCGAGACA

idx 11 locidx 567
1 T
6 (1, 5, 5, 0)
[ 0  0 18  0]
55 C
60 (55, 5, 5, 0)
[18  0  0  0]
ATGCTGAGTTCGGCCGGTTCCCTCTCTCAAATAATAAAGTCGCAGTAGCCTGCACCCCTCATTGCAAGCTTGCCAATCGTTGCTCT

idx 11 locidx 568
0 T
5 (0, 5, 5, 0)
[ 0  0 14  0]
8 C
13 (8, 5, 5, 0)
[14  0  0  0]
16 C
21 (16, 5, 5, 0)
[14  0  0  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 14]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 14]
43 C
48 (43, 5, 5, 0)
[14  0  0  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 14]
67 A
72 (67, 5, 5, 0)
[ 0 14  0  0]
TCTGTACTCTACAATACCCCGGATACAGGTGCACATAAACAGCCTATGCTGATCTACTGGATCTGAGAGCCATAACCCAAATGACG

idx 11 locidx 569
18 G
23 (18, 5, 5, 0)
[ 0  0  0 21]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 21]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 21]
58 C
63 (58, 5, 5, 0)
[21  0  0  0]
CGCAGAACCAGATAACGGGCAGGACACTCGAGCCACTGAATAATGTGGATGAGCCTCTCTCAACCCGCTGATTCGTGATCATACGC

idx 11 locidx 570
10 T
15 (10, 5, 5, 0)
[ 0  0 20  0]
20 A
25 (20, 5, 5, 0)
[ 0 20  0  0]
CTAATAGGTTTGTTGCAAACATCCTTCATTCTTCTGTAGTGTCAATCCTCACAGTAGCACCTGGGGAGCTGGCGAATACATATTTG

idx 11 locidx 571
45 C
50 (45, 5, 5, 0)
[19  0  0  0]
CTGAGGATGTCAGGGGCGGTAACTATGTTTTTCGTCGCGTAAGTGCGAATGCGCGTCAACGACCCTACGATGACGAGATAGGAGTC

idx 11 locidx 572
4 A
9 (4, 5, 5, 0)
[ 0 21  0  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 21]
51 A
56 (51, 5, 5, 0)
[ 0 21  0  0]
CGCCAGGCTGCTCCGTCGCTTTAGAGGGCCGCGAGCTCGTCCGAGCTCGTTACATTAGTCCTAGTGCATCAAGAAGCAACTAGCAA

idx 11 locidx 573
21 A
26 (21, 5, 5, 0)
[ 0 19  0  0]
GGTCGGCCCCCCTTCCTTTAAACGTATGTGGACCGAGGAGGTAGCTTGAATTGCATTAGCGTAGAGAAGATTCGTGGGAAGGGTCA

idx 11 locidx 574
5 C
10 (5, 5, 5, 0)
[21  0  0  0]
6 T
11 (6, 5, 5, 0)
[ 0  0 21  0]
34 A
39 (34, 5, 5, 0)
[ 0 21  0  0]
TTATTCTGAGGCACGCGAAAGAGTATTGTGGATTATAAGGTGTTCAGTGTTTGACCACTGTGTGGCGAATAGCAACTTAATATTCG

idx 11 locidx 575
3 A
8 (3, 5, 5, 0)
[ 0 18  0  0]
7 A
12 (7, 5, 5, 0)
[ 0 18  0  0]
40 A
45 (40, 5, 5, 0)
[ 0 18  0  0]
41 C
46 (41, 5, 5, 0)
[18  0  0  0]
GGGATATAAGGTGTAGGTATGTTGTTCTTCTTCATTAGTTACTCTGCCCCCTAAGTAGTCAGAGGGCCTCAGGGCCCGACGTTCGG

idx 11 locidx 576
9 A
14 (9, 5, 5, 0)
[ 0 24  0  0]
38 C
43 (38, 5, 5, 0)
[24  0  0  0]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 24]
49 A
54 (49, 5, 5, 0)
[ 0 24  0  0]
ACCGCATTCATGTTCTCAGCGTCGCTTACGGAGCCTGCCGGCTTGTGTGACCATAAGTGGCTCCCTTACTCGTAAGCTTATTTAGA

idx 11 locidx 577
1 G
6 (1, 5, 5, 0)
[ 0  0  0 22]
TGTGACCCCCACGTTAACCTACGTATTGCGCTGCTCTAGTACCGTGGCATGTGTGAAGGGTATTATGATTGATGGATTGCAAGACA

idx 11 locidx 578
28 G
33 (28, 5, 5, 0)
[ 0  0  0 20]
GCTCGAACTTGTACCCTCATTTCGAGCCGATTTCCCCCTCAAGTAGTAGAGTCTGGAGTACGCACGAGAAAGCTCTAGTATAGGTC

idx 11 locidx 579
3 G
8 (3, 5, 5, 0)
[ 0  0  0 16]
20 T
25 (20, 5, 5, 0)
[ 0  0 16  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 16]
64 C
69 (64, 5, 5, 0)
[16  0  0  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 16  0]
GCGGGTTATGTACCACCCTTTGGAAACTTTCTAGGTCATGCCGTGCGGAGCTCAGATCACGTACCCGAGGCCCTGAGTCTTTCTGC

idx 11 locidx 580
3 A
8 (3, 5, 5, 0)
[ 0 21  0  0]
23 C
28 (23, 5, 5, 0)
[21  0  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 21  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 21  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 21]
TGCACACCACCATCCGTGTCAACCTGATCCGTTATAGGGTTTTTTGCGTAAAAGCGGTAGTGCGTCCACCCGCCGTAGGACTCTAA

idx 11 locidx 581
48 A
53 (48, 5, 5, 0)
[ 0 19  0  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 19]
84 A
89 (84, 5, 5, 0)
[ 0 19  0  0]
CTGACCATATAGTAATTTCCCCAAGGATAAGAGGTTATGGCACACGTCACCTTAAGACTATACAAATGCGAACAGTTAGCCTCAAT

idx 11 locidx 582
3 T
8 (3, 5, 5, 0)
[ 0  0 24  0]
40 C
45 (40, 5, 5, 0)
[24  0  0  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 24  0]
57 T
62 (57, 5, 5, 0)
[ 0  0 24  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 24  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 24]
65 T
70 (65, 5, 5, 0)
[ 0  0 24  0]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 24]
81 T
86 (81, 5, 5, 0)
[ 0  0 24  0]
GGCTATCGTTCAAGGTTAGCCGGTTAATGTGTTTGCTAGTCCCAATTCTTAACGGATTTTTGAAATTGTTGCGGATAGACGTTGTT

idx 11 locidx 583
10 C
15 (10, 5, 5, 0)
[18  0  0  0]
20 C
25 (20, 5, 5, 0)
[18  0  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 18]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 18]
CCCGACCAGACTTGGTGCCCCTGTTTGTTAAGTACTGCGAGCGATGACCGTTCCTGGTAGCAACGATAGCGATTATGCGCACCTCA

idx 11 locidx 584
26 A
31 (26, 5, 5, 0)
[ 0 18  0  0]
72 S
77 (72, 5, 5, 0)
[11  0  0  7]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 18]
CGCGTCTAGAAAGCCAAATAAAACTGATTTAGTGACAAGTTCGCTATGGGCTGTCTAGCAACATATGTAACASGCACAAGTAAGTC

idx 11 locidx 585
35 C
40 (35, 5, 5, 0)
[18  0  0  0]
48 C
53 (48, 5, 5, 0)
[18  0  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 18  0]
CCCGACACTGTCTCATAGATCACAGCTTAATCAGCCCGGTAACATAGTCTCATGCCTTCAAGGTAAAAACTAAGATCTGTGTAAGT

idx 11 locidx 586
35 A
40 (35, 5, 5, 0)
[ 0 24  0  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 24]
82 T
87 (82, 5, 5, 0)
[ 0  0 24  0]
TGTCCCTATGTATCGGGCTGGTCAGTCGTCATCGAAGTGCCGGGGTTGGCGTCTTTCCTCCGTAACCGACGGATACACGGTTTTTG

idx 11 locidx 587
9 T
14 (9, 5, 5, 0)
[ 0  0 23  0]
36 T
41 (36, 5, 5, 0)
[ 0  0 23  0]
79 A
84 (79, 5, 5, 0)
[ 0 23  0  0]
81 T
86 (81, 5, 5, 0)
[ 0  0 23  0]
GGTCTGCGCTCATCCATCGATATCACGCCTTACTAGTTGAAAATAACGATGATAAACGGTCGTTCCCCACGGTCAGTTAAATGGAA

NOT HERE
idx 11 locidx 589
3 G
8 (3, 5, 5, 0)
[ 0  0  0 14]
11 T
16 (11, 5, 5, 0)
[ 0  0 14  0]
15 T
20 (15, 5, 5, 0)
[ 0  0 14  0]
33 C
38 (33, 5, 5, 0)
[14  0  0  0]
45 C
50 (45, 5, 5, 0)
[14  0  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 14  0]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 14]
CTAGTACGTTATACGTAGCCAATGGGAACCTGGCCGTCCGTTGCACGTGACTACAATGCTATCTTCTCAAATAACGTGTGATACAG

idx 11 locidx 590
5 T
10 (5, 5, 5, 0)
[ 0  0 18  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 18  0]
49 C
54 (49, 5, 5, 0)
[18  0  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 18  0  0]
GCGTCTTGTGATGTTACTATTATTTTTTGTCAGATGGGCTCTGATTACACAGGTGCTCCTAGAATAGGGTTAAGATCGCATAGTGA

idx 11 locidx 591
15 A
20 (15, 5, 5, 0)
[ 0 20  0  0]
47 C
52 (47, 5, 5, 0)
[20  0  0  0]
64 K
69 (64, 5, 5, 0)
[ 0  0 11  9]
GCTTGCCTATTAATCAACAAACGGAGTACAGGTACCACCGAACTTGCCATTCCTAAATATGAGTKTACGAGCGGAGAGAACTCCAA

idx 11 locidx 592
12 T
17 (12, 5, 5, 0)
[ 0  0 19  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 19]
78 C
83 (78, 5, 5, 0)
[19  0  0  0]
79 C
84 (79, 5, 5, 0)
[19  0  0  0]
TGACAGGGCTCATCGGAGGTTTAGTTCCGTGTGCTTGGTCACGTCGATACCTCTATGCCAGCTGTAAGCTCAGGTTATCCTCTCCG

idx 11 locidx 593
6 C
11 (6, 5, 5, 0)
[24  0  0  0]
13 G
18 (13, 5, 5, 0)
[ 0  0  0 24]
18 T
23 (18, 5, 5, 0)
[ 0  0 24  0]
25 T
30 (25, 5, 5, 0)
[ 0  0 24  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 24  0]
80 A
85 (80, 5, 5, 0)
[ 0 24  0  0]
CGGACGCCAGCGTGTCGTTGCCCACTGTGCTGATGAACCACTGGACATGGTAGCTGCGAGTCGGGTATCGACGTGGGACAAACTCG

idx 11 locidx 594
28 T
33 (28, 5, 5, 0)
[ 0  1 16  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 17]
ACGATTACAGGCAGTGTTAAACGCTACTTACTGGATTACAACTGATCGCCTAAGACGTTGATCAGATGGGTCACATATTCAGGGCC

idx 11 locidx 595
23 G
28 (23, 5, 5, 0)
[ 0  0  0 17]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 17]
65 C
70 (65, 5, 5, 0)
[17  0  0  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 17]
TTATGCTTCATGAAGCAAAGTAAGTATAGCCGGACCCTTGGCCTAGGAGAACGATCAGCCACGATCGGACACTACTACGATGGACA

idx 11 locidx 596
4 G
9 (4, 5, 5, 0)
[ 0  0  0 22]
19 T
24 (19, 5, 5, 0)
[ 0  0 22  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 22  0]
71 C
76 (71, 5, 5, 0)
[22  0  0  0]
GGTGGAGCTGCCTATCAATTCGGTATAGATCGGGTCGAGTAGAGAAGCACAGTAAGACCCTAATATTACAGCACGCTCTTAGCCGG

idx 11 locidx 597
7 A
12 (7, 5, 5, 0)
[ 0 27  0  0]
22 C
27 (22, 5, 5, 0)
[27  0  0  0]
37 C
42 (37, 5, 5, 0)
[27  0  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 27  0]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 27]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 27]
70 T
75 (70, 5, 5, 0)
[ 0  0 27  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 27]
GGAGGAGAGCTTAAGTTGAGCGCAATCGTCCTCCGCACTGGTCTCGACCTCCCCCGAACTCTAGTTCTGATTCAAAGGTCCTCGTG

idx 11 locidx 598
20 C
25 (20, 5, 5, 0)
[18  0  0  0]
25 C
30 (25, 5, 5, 0)
[18  0  0  0]
29 A
34 (29, 5, 5, 0)
[ 0 18  0  0]
36 T
41 (36, 5, 5, 0)
[ 0  0 18  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 18]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 18]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 18]
84 C
89 (84, 5, 5, 0)
[18  0  0  0]
AGTTAGGTATGTTGAGTTAACCTGCCCCAAGACATATGAACGAACTGTCCTGTTTCTGGGTAGTATGGGACGTGGCTAGATTGCCT

idx 11 locidx 599
25 C
30 (25, 5, 5, 0)
[21  0  0  0]
45 M
50 (45, 5, 5, 0)
[11 10  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 21]
66 C
70 (66, 5, 5, 1)
[21  0  0  0]
AGCAGTTAACAGCTGTAAACTCTCACCCCATGCTGAGGCTGGCATMCACGTGGATAGAGTGAT-ACCGCTAATGGCGTTGTATCAT

idx 12 locidx 600
22 A
27 (22, 5, 5, 0)
[ 0 23  0  0]
37 A
42 (37, 5, 5, 0)
[ 0 23  0  0]
53 C
58 (53, 5, 5, 0)
[23  0  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 23  0]
TAACTTAGACGGGCATTGCACGATCTTTAGTACTGTGAGCAGCTTCCCTACACCCAGTACCGGAAGTAGTTCTTCCTGTGTTTAGC

idx 12 locidx 601
16 C
21 (16, 5, 5, 0)
[22  0  0  0]
26 T
31 (26, 5, 5, 0)
[ 0  0 22  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 22]
67 T
72 (67, 5, 5, 0)
[ 0  0 22  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 22  0]
TTACGACGGTATGTGGCCCGTTGTTATGAAATGGCGGCAGGTTAGCATTACGGGGGCCTCGAGTATATTAATATTTTCCTTCGTAA

idx 12 locidx 602
8 T
13 (8, 5, 5, 0)
[ 0  0 10  0]
10 C
15 (10, 5, 5, 0)
[10  0  0  0]
25 A
30 (25, 5, 5, 0)
[ 0 10  0  0]
AGGCATTTTCCAGTAACGGAGCCAGATATTGGAATAGGAGAGAGCCACTCCAATCTGGGTCAGTTGCAGACGTTTTCCTGGCTTCC

idx 12 locidx 603
11 T
16 (11, 5, 5, 0)
[ 0  0 24  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 24  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 24]
CGAGCTGTGTGTTCTCTGGAACCGGCCTTGGCCTGATGAGGTGACTACGGGATCTTGATGTCTGCTTCTCTAGTCGAAGAGGTGAG

idx 12 locidx 604
4 C
9 (4, 5, 5, 0)
[20  0  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 20  0]
CGGTCAGCCCCCCCGTCATAACGGGTCTGAGCTTGGCTCATGTTGAGGCTTGGAACTCACAATTTAGGGCTACACTGAGTTAGTGA

idx 12 locidx 605
5 G
10 (5, 5, 5, 0)
[ 0  0  0 25]
6 A
11 (6, 5, 5, 0)
[ 0 25  0  0]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 25]
63 C
68 (63, 5, 5, 0)
[25  0  0  0]
67 C
72 (67, 5, 5, 0)
[25  0  0  0]
CTAACGAACGCGCCTGAGGGCTTGGGGCTTTCGATGTGGGGGGGTCCCCTTGGTCGCCGTGGTCGTACTTCGTGGCTACCGCCCGG

idx 12 locidx 606
28 C
33 (28, 5, 5, 0)
[18  0  0  0]
55 C
60 (55, 5, 5, 0)
[18  0  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 18  0  0]
AAGGTTTCCCACGTATTTCGGGCCGAGGCTCCGAGATATTCCGAGATCACGAACACGGTAATTTGCTGAAGAGCCCCTGTAAAGTA

idx 12 locidx 607
12 G
17 (12, 5, 5, 0)
[ 0  0  0 17]
22 C
27 (22, 5, 5, 0)
[17  0  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 17  0  0]
30 T
35 (30, 5, 5, 0)
[ 0  0 17  0]
80 C
85 (80, 5, 5, 0)
[17  0  0  0]
TGCCGGGTACTAGGACTGTTCTCTAGCATATCGGTGTTTGGTCCTCACAGAGCACCAAAGGTAGGCGGCCAGACCTCATCCTTACG

idx 12 locidx 608
7 G
12 (7, 5, 5, 0)
[ 0  0  0 21]
17 T
22 (17, 5, 5, 0)
[ 0  1 20  0]
38 C
43 (38, 5, 5, 0)
[21  0  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 21  0]
55 C
60 (55, 5, 5, 0)
[21  0  0  0]
69 A
74 (69, 5, 5, 0)
[ 0 21  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 21  0  0]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
ACGTAACGATTCAATGTTCGCCTTGCCTTTCGTCAGACCTAACCGTACCGGAAACCGACCGATAGAATTATGGCATTTGGAACTCT

idx 12 locidx 609
45 C
50 (45, 5, 5, 0)
[20  0  0  0]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 20]
67 A
72 (67, 5, 5, 0)
[ 0 20  0  0]
75 C
80 (75, 5, 5, 0)
[20  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 20]
TCACCAAAGTTTCATAGAGACAGTCGATTTGAACCCTGGGCATGACCCACCATTTAGAGTGGGTAGCAAACCCGACCACACGTGGA

idx 12 locidx 610
3 T
8 (3, 5, 5, 0)
[ 0  0 17  0]
7 T
12 (7, 5, 5, 0)
[ 0  0 17  0]
17 G
22 (17, 5, 5, 0)
[ 0  0  0 17]
18 C
23 (18, 5, 5, 0)
[17  0  0  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 17  0]
29 A
34 (29, 5, 5, 0)
[ 0 17  0  0]
51 A
56 (51, 5, 5, 0)
[ 0 17  0  0]
68 T
73 (68, 5, 5, 0)
[ 0  0 16  1]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 17]
AGTTTCCTAAACCCCAGGCTTTGGTTAAGATGCGGTCCGCGATCGCCGAGAAGTTGCCAAAGCGTAGCTAGCGGATCCGAGCATTC

idx 12 locidx 611
7 A
12 (7, 5, 5, 0)
[ 0 17  0  0]
26 A
31 (26, 5, 5, 0)
[ 0 17  0  0]
28 A
33 (28, 5, 5, 0)
[ 0 17  0  0]
49 C
54 (49, 5, 5, 0)
[17  0  0  0]
CACTCGCAGGCGGTATATCGGGGTGTAAAATCACCAAATGGTGGATATTCTATAGCATTTGGTTAGTAGAATGGCGACGTAACGCA

idx 12 locidx 612
7 A
12 (7, 5, 5, 0)
[ 0 21  0  0]
25 T
30 (25, 5, 5, 0)
[ 0  0 21  0]
35 C
40 (35, 5, 5, 0)
[21  0  0  0]
41 T
46 (41, 5, 5, 0)
[ 0  0 21  0]
53 C
58 (53, 5, 5, 0)
[21  0  0  0]
ACCCGTTACACTACCGCATATTACTTGGCCAGGAACGTTGGTGGAAGGACGCACGCACGGTAGTTTCAAATACCTGAAGTGATCAC

idx 12 locidx 613
28 T
33 (28, 5, 5, 0)
[ 0  0 26  0]
44 C
49 (44, 5, 5, 0)
[26  0  0  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 26]
61 C
66 (61, 5, 5, 0)
[26  0  0  0]
GGTAGTACGAGGCTTATGGGGACGTTGATACCCGAGCGGACGTCCCGTCTGGAGGTAGAGTCATGCCCCGGAGCGCATATTCAGGC

idx 12 locidx 614
25 C
30 (25, 5, 5, 0)
[20  0  0  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 20]
43 C
48 (43, 5, 5, 0)
[20  0  0  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 20  0]
GCGTCGGGCGTCATACTTATGCGTTCCATCTCTGAATTAGCACCATCGCTACCCCCTTTATTGATATTCTCGGTTCGTGCCGACCT

idx 12 locidx 615
30 T
35 (30, 5, 5, 0)
[ 0  0 21  0]
35 T
40 (35, 5, 5, 0)
[ 0  0 21  0]
57 C
62 (57, 5, 5, 0)
[21  0  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 21  0]
CTAAGCGAGAAGGGGCAATGATAGTGCCACTTTAATCAAAGGGCTTCATTTAGGGTCCGACACAGCCCTGATTTACTGAGATTAGC

idx 12 locidx 616
24 C
29 (24, 5, 5, 0)
[20  0  0  0]
41 C
46 (41, 5, 5, 0)
[20  0  0  0]
60 T
65 (60, 5, 5, 0)
[ 0  0 20  0]
65 A
70 (65, 5, 5, 0)
[ 0 20  0  0]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 20]
77 C
82 (77, 5, 5, 0)
[20  0  0  0]
CCCTCCCTGAGAGCGATGGCGCCTCTAACCTAGCTGAAGGCCGCTCAGCTCAAGGGGTGTTGTTAAAGCAGAGCTTGCATGGTTCT

idx 12 locidx 617
19 A
24 (19, 5, 5, 0)
[ 0 20  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 20  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 20]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 20]
74 C
79 (74, 5, 5, 0)
[20  0  0  0]
81 C
86 (81, 5, 5, 0)
[20  0  0  0]
CTCCCAGGTCATTTTGAGGAGAGAGGTACCCAAACTGGCGTAGTTGTAATCTGTCACGCCGGCATTTACGGTGTCCCAGATCTGAC

idx 12 locidx 618
11 G
16 (11, 5, 5, 0)
[ 0  0  0 18]
33 C
38 (33, 5, 5, 0)
[18  0  0  0]
83 A
88 (83, 5, 5, 0)
[ 0 18  0  0]
TTGACGCAGATGCTCCTTCTCGATCTAAAACGGCCAAAATTTAACCCTCCTAATATTCAGCTCCCTATGCGCAAGATTAATTTAAC

idx 12 locidx 619
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
61 C
66 (61, 5, 5, 0)
[20  0  0  0]
78 A
83 (78, 5, 5, 0)
[ 0 20  0  0]
TCACCCCGACAATGTCGGGCAGTTCCGATGGGCAAGAGCGCTGTGACCCGCGGCATGAGAGCCGTGTCGTGACTCAGTATGCTATG

idx 12 locidx 620
15 G
20 (15, 5, 5, 0)
[ 0  0  0 20]
27 A
32 (27, 5, 5, 0)
[ 0 20  0  0]
49 T
54 (49, 5, 5, 0)
[ 0  0 20  0]
CGTTAACCTCTGTCGGGACGCTGAAAGAGCGAGGCCGCGCTTTTAGTTATCTGGAAGTCCATAGCATCGGCAAGAAATATACTGTT

idx 12 locidx 621
29 C
34 (29, 5, 5, 0)
[19  0  0  0]
31 C
36 (31, 5, 5, 0)
[19  0  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 19  0  0]
TAGATGGGGTAGCCCTCACTTTGACGTAGCCCGTTCACCCAGTTTTTCTGTATTCCCATTCGCAACCCTGCTCCGGCGGAGATACG

idx 12 locidx 622
4 T
9 (4, 5, 5, 0)
[ 0  0 18  0]
6 T
11 (6, 5, 5, 0)
[ 0  0 18  0]
11 A
16 (11, 5, 5, 0)
[ 0 18  0  0]
70 A
75 (70, 5, 5, 0)
[ 0 18  0  0]
GAGCTTTACGCATCAGGTCATGAACCATGGAGCTTATGGTTACTTGTGATACTTGCCTATGCTCTGCCCTATCTTATATAAACGAT

idx 12 locidx 623
56 C
61 (56, 5, 5, 0)
[23  0  0  0]
71 A
76 (71, 5, 5, 0)
[ 0 23  0  0]
78 C
83 (78, 5, 5, 0)
[22  1  0  0]
CTTAAAAATGGACGTATAACGGCCAGACAGCCGGCTAGGATCGCTGGACGACGCATCGCCATACCATGTGAAGTCGGGCGAATCTC-

idx 12 locidx 624
11 C
16 (11, 5, 5, 0)
[20  0  0  0]
13 C
18 (13, 5, 5, 0)
[20  0  0  0]
21 T
26 (21, 5, 5, 0)
[ 0  0 20  0]
40 A
45 (40, 5, 5, 0)
[ 0 20  0  0]
AAAGGTCGGAACACTTGCAGATACCCCGTTGAACACTAAGAGACGCGCGGGGCGGGCGTCTAACGGGGGGAGACGGCTTCTCAAAG

idx 12 locidx 625
23 A
28 (23, 5, 5, 0)
[ 0 20  0  0]
30 A
35 (30, 5, 5, 0)
[ 0 20  0  0]
33 C
38 (33, 5, 5, 0)
[20  0  0  0]
44 C
49 (44, 5, 5, 0)
[20  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 20  0]
CACACATGACTCCTAGGCTATATACCCATAACCCTGGTGCGTGGCCGAACACCTGAGTATGACAAATTCTCGCCTTACTCGATTAG

idx 12 locidx 626
24 A
29 (24, 5, 5, 0)
[ 0 19  0  0]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 19]
70 A
75 (70, 5, 5, 0)
[ 0 19  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 19  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
82 A
87 (82, 5, 5, 0)
[ 0 19  0  0]
CGAACGCTGGGAACGCATCGCCGGAAGCGGAATACTGAGAGATTGCAACAATGCTCATGACGGTCTGACAATCCGATTATAGACAA

idx 12 locidx 627
12 A
17 (12, 5, 5, 0)
[ 0 23  0  0]
78 C
83 (78, 5, 5, 0)
[23  0  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 23  0  0]
CCTCGAGTACCTACATCGAAGAAAAGATAATGCTAAAATTATGAGCCCTATACTGCTGAATGCCCGTTGGCTAGGGAACCACTTGT

idx 12 locidx 628
5 T
10 (5, 5, 5, 0)
[ 0  0 18  0]
10 T
15 (10, 5, 5, 0)
[ 0  0 18  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 18  0]
59 C
64 (59, 5, 5, 0)
[18  0  0  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 18  0]
TCCCGTTCGCTTGACAGAGCGGCGTGTTCGTTTGCCGCACAAAATCGTATGATCTTGAACGTGCAACATGTCCAATGTATGAACCT

idx 12 locidx 629
0 A
5 (0, 5, 5, 0)
[ 0 22  0  0]
3 C
8 (3, 5, 5, 0)
[22  0  0  0]
19 C
24 (19, 5, 5, 0)
[22  0  0  0]
32 C
37 (32, 5, 5, 0)
[22  0  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 22  0  0]
68 C
73 (68, 5, 5, 0)
[22  0  0  0]
AGTCGCAGCTCCCTTATTCCGTGTACCGATCCCGGAGCCTGAAGCGGTAGGTAAATGATACCAGGCGTCGGATACTTTTTTCAAAC

idx 12 locidx 630
4 G
9 (4, 5, 5, 0)
[ 0  0  0 23]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 23]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 23]
67 A
72 (67, 5, 5, 0)
[ 0 23  0  0]
GACTGAAGCACCCCGGACTTATACATAGTGTCGACCATGGCAAGAAGTGTATGGCTTGAGCGGAGATACATTCAGGGACCCGTCGC

idx 12 locidx 631
48 T
53 (48, 5, 5, 0)
[ 0  0 20  0]
81 A
86 (81, 5, 5, 0)
[ 0 20  0  0]
TTAGTTCTTAGACTATTCGTTAACTCGAGGCGAGTGCCCTAAGCGCTATACGTGGCAGGACCTGTTGGAAAAACACGCAGAAAGGA

idx 12 locidx 632
11 A
16 (11, 5, 5, 0)
[ 0 21  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 21]
58 A
63 (58, 5, 5, 0)
[ 0 21  0  0]
60 G
65 (60, 5, 5, 0)
[ 0  0  0 21]
TGGCGGACTAAAAGGAAGCGCAACACTCACATCGATTGATCGGATGCTGAACTACCCGAGGATTTACCAACATCTGTCATAGTTCC

idx 12 locidx 633
25 T
30 (25, 5, 5, 0)
[ 0  0 21  0]
30 C
35 (30, 5, 5, 0)
[21  0  0  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 21]
AGTTTTTTCCAGACCCCGTTGGGTATCTGACGAAACTAACCCGTTAAACTACTTTATAGCAGCCTCTTGCTCCTGGAAGGGTCGTA

idx 12 locidx 634
2 T
7 (2, 5, 5, 0)
[ 0  0 21  0]
17 C
22 (17, 5, 5, 0)
[21  0  0  0]
25 C
30 (25, 5, 5, 0)
[21  0  0  0]
CGTGAAACCTTTTAGTTCTTTTCGCCTAGACACGACATTCTGGCTGCTCGTCGTGTTTTTACTGTATATACACGCCCTATGCGTCA

idx 12 locidx 635
14 A
19 (14, 5, 5, 0)
[ 0 15  0  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 15  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 15]
GGATACTTGTCTTGAAGTATTGAAATTTCCGGGATGCTTCGCGCTTGTATTCCCAGAGCTTACTAGGCTATGCTCCTAGAAAACGT

idx 12 locidx 636
0 T
5 (0, 5, 5, 0)
[ 0  0 22  0]
2 G
7 (2, 5, 5, 0)
[ 0  0  0 22]
33 T
38 (33, 5, 5, 0)
[ 0  0 22  0]
36 C
41 (36, 5, 5, 0)
[22  0  0  0]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 22]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 22]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 22]
68 T
73 (68, 5, 5, 0)
[ 0  0 22  0]
70 C
75 (70, 5, 5, 0)
[22  0  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 22  0]
76 G
81 (76, 5, 5, 0)
[ 0  0  0 22]
82 T
87 (82, 5, 5, 0)
[ 0  0 22  0]
TGGATACCCGGTTCTACCCATACCACTATCAAGTGGCCTTTGCTGGACAAAGATTCGAAGGTGGCGGGTCCGCTCTGGGTATTCTG

idx 12 locidx 637
11 C
16 (11, 5, 5, 0)
[19  0  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 19  0  0]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 19]
32 T
37 (32, 5, 5, 0)
[ 0  0 19  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 19  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 19  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
GGATCGAGCCTCAGGGCAGAGGTGCACCATTATAAACGCTCCTCCGTAAACGGCGATAGTGTGGTAGAGGGAAACCTATAGGGTAC

idx 12 locidx 638
0 G
5 (0, 5, 5, 0)
[ 0  0  0 20]
16 C
21 (16, 5, 5, 0)
[20  0  0  0]
28 A
33 (28, 5, 5, 0)
[ 0 20  0  0]
83 A
88 (83, 5, 5, 0)
[ 0 20  0  0]
GCGAGGCAAACGTTCACGTGAACACAAAATGAGGTGAACTTCACGGCTCCGGTGAGCGACATTGCTAACGACAGAAATACTCTACA

idx 12 locidx 639
2 R
7 (2, 5, 5, 0)
[ 0 11  0 10]
7 G
12 (7, 5, 5, 0)
[ 0  0  0 21]
10 T
15 (10, 5, 5, 0)
[ 0  0 21  0]
25 A
30 (25, 5, 5, 0)
[ 0 21  0  0]
GTRACGTGGCTGCTCGACACGCCAGACGGGCGCACTCAAAACAGGCTTAGGCTTTCGGCGGAAAACGAGCTTTGGAAACGTGCATT

idx 12 locidx 640
4 C
9 (4, 5, 5, 0)
[15  0  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 15  0  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 15]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 15]
66 A
71 (66, 5, 5, 0)
[ 0 15  0  0]
77 C
82 (77, 5, 5, 0)
[15  0  0  0]
CTAACGTAGAAGCGGTAAGTATTACTGGAGAGGGATTAGACATCAAAAGAGCGTACTGTGAAAAGGATGCGTCACAGCCTGTTTAT

idx 12 locidx 641
54 T
59 (54, 5, 5, 0)
[ 0  0 15  0]
ACCAAAAATCACTCAGTACGAACCTCGACGATGGTCAGTGTTAAATGTTGCAACTACCCGTTCAGAATAGATTATCTGCTTAGCTT

idx 12 locidx 642
0 C
5 (0, 5, 5, 0)
[23  0  0  0]
10 A
15 (10, 5, 5, 0)
[ 0 23  0  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 23  0]
16 C
21 (16, 5, 5, 0)
[23  0  0  0]
72 A
77 (72, 5, 5, 0)
[ 0 23  0  0]
73 C
78 (73, 5, 5, 0)
[23  0  0  0]
CGAAGGTTGTATGTGCCTATATCAAGCACGAAACATCCTACCAAGAGGTCTAGCTATAGCGCGGCAATAATAACACTCATGCTCTG

idx 12 locidx 643
6 A
11 (6, 5, 5, 0)
[ 0 20  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 20  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 20  0]
CTCAGTATCGCCATCGGGTCCTATCCTATTCATTAGAGGCACTGTTCCCCGCGTCGGTTTGATGCGCAATAAGTGACGAGTAGGAT

idx 12 locidx 644
6 C
11 (6, 5, 5, 0)
[18  0  0  0]
12 G
17 (12, 5, 5, 0)
[ 0  0  0 18]
45 T
50 (45, 5, 5, 0)
[ 0  0 18  0]
81 A
86 (81, 5, 5, 0)
[ 0 18  0  0]
GTTAAACTCGTGGTCCTATGGGGAGCCCATGTAGCATATGAATACTGCCCTCACTCGATTGCCTCATTTGCTGTAGGTATCACTGC

idx 12 locidx 645
21 T
26 (21, 5, 5, 0)
[ 0  0 19  0]
28 C
33 (28, 5, 5, 0)
[19  0  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 19  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 19]
CATAAGACGCTAGTGGCGACATAGTGCGCGATCCGGGCAAATTAAGAGAGGGGGTCAGAAAGTGAGTGTCAGCGGGTACGCCTCAG

idx 12 locidx 646
44 A
49 (44, 5, 5, 0)
[ 0 17  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 17]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 17]
74 A
79 (74, 5, 5, 0)
[ 0 17  0  0]
TGCTAGTATTGAAGATTTATACCAAGGGTTTTCGTGAGGCCCTAAGTCAGGTGTTGTTGTGGTCCAACGCTGGCAACGGAAGCAGT

idx 12 locidx 647
14 T
19 (14, 5, 5, 0)
[ 0  0 24  0]
40 S
45 (40, 5, 5, 0)
[12  0  0 12]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 24]
77 C
82 (77, 5, 5, 0)
[24  0  0  0]
CCGCTGTTAATAAGTTTGTAGAGTTCAGTTAGCGTCGTTTSTCTGCCCGGCAGAGCGTTCGTCTCCTGGGGCACATACTGGGGGTA

idx 12 locidx 648
19 A
24 (19, 5, 5, 0)
[ 0 22  0  0]
22 T
27 (22, 5, 5, 0)
[ 0  0 22  0]
79 C
84 (79, 5, 5, 0)
[22  0  0  0]
ATCGCGGATCGTCTGACCGAGATTCCTCCAAGCAGAGAATATGGCGGCGTCTGTTCAAATCTAATGGAGTGGCGGGGGTCCTCCAT

idx 12 locidx 649
21 T
26 (21, 5, 5, 0)
[ 0  0 18  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 18]
40 M
45 (40, 5, 5, 0)
[9 9 0 0]
46 Y
51 (46, 5, 5, 0)
[9 0 9 0]
81 C
86 (81, 5, 5, 0)
[18  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 18  0]
CCCGTAGCCTACACAAGGAGCTTGAACTTTGGGAGTGCACMAGTGGYAAATAAACTATAGCCAACTAGGTTGTCGCGGCTGCGTGA

idx 13 locidx 650
1 A
6 (1, 5, 5, 0)
[ 0 22  0  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 22  0]
47 C
52 (47, 5, 5, 0)
[22  0  0  0]
TATTAGGTTTCTCCGCGGTAATGAAGGTTGCGTCGGATACGCTATGGCCCTTCGTTGTGACTCTGCCTATCGGGAACGATCATGTC

idx 13 locidx 651
6 C
11 (6, 5, 5, 0)
[18  0  0  0]
46 -
51 (46, 5, 5, 0)
[18  0  0  0]
54 T
58 (54, 5, 5, 1)
[ 0  0 18  0]
71 A
75 (71, 5, 5, 1)
[ 0 18  0  0]
75 T
79 (75, 5, 5, 1)
[ 0  0 18  0]
GGTCCCCAGTGGTAAAGTCAGGTTGTTACATCGACCATGTAATCGC-CAGTGCCTCAGACATAAGTCCAACACTATCTTCGGGTTA

idx 13 locidx 652
23 T
28 (23, 5, 5, 0)
[ 0  0 22  0]
36 A
41 (36, 5, 5, 0)
[ 0 22  0  0]
47 C
52 (47, 5, 5, 0)
[22  0  0  0]
80 C
85 (80, 5, 5, 0)
[22  0  0  0]
TTAACGCAAGACCCATGTTACCCTGGCAAGTTTCGCAACGGATACCACACGTCCCTGGAACCGGCTGTTGGTGACCCCGACTGCAG

idx 13 locidx 653
9 W
14 (9, 5, 5, 0)
[0 7 7 0]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 14]
43 A
48 (43, 5, 5, 0)
[ 0 14  0  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 14]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 14]
TTGACACCGWTCCGCGGAACCATCCGCACTCGCGGGACAGTTGAGGCAATGAAGGATGACCCGAGGCGTTCACTAGATGTTCCTCT

idx 13 locidx 654
20 C
25 (20, 5, 5, 0)
[18  0  0  0]
40 A
45 (40, 5, 5, 0)
[ 0 18  0  0]
52 A
57 (52, 5, 5, 0)
[ 0 18  0  0]
84 C
89 (84, 5, 5, 0)
[18  0  0  0]
AAAATGCGGAAATCGCCCTCCGGTTCCTCAAATAGAGATCATACCAATTAGTACAATGATATACATTGCCGGCGTCGTTAGGAGCC

idx 13 locidx 655
2 G
7 (2, 5, 5, 0)
[ 0  0  0 22]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 22]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 22]
85 A
90 (85, 5, 5, 0)
[ 0 22  0  0]
ATGTCTTAGTGTTTACGTTAGATTGACCCGGTTAGGCGTAGTTACTGAGGTTAAACCCACTCTAAGTCGATGTGATAAGCCCTCGA

idx 13 locidx 656
11 G
16 (11, 5, 5, 0)
[ 0  0  0 20]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 20]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 20]
77 T
82 (77, 5, 5, 0)
[ 0  0 20  0]
CCTCTTGTAACGTTTCGAGTGTTTTTGGGAGTAGATGCGTGATCAATCTGTTAGTTGACCCGTCCTGAGAGTGATAGTTCCGTTTA

idx 13 locidx 657
22 C
27 (22, 5, 5, 0)
[21  0  0  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 21]
75 T
80 (75, 5, 5, 0)
[ 0  0 21  0]
83 C
88 (83, 5, 5, 0)
[21  0  0  0]
CCGGTCAGGTCGCGGATCCTAACGTCCATCACTAATGCCCATTTGTGCTCCCAGTACTAGCGCATCTTTTCTACTTAGCTATGCTG

NOT HERE
idx 13 locidx 659
2 C
7 (2, 5, 5, 0)
[26  0  0  0]
4 G
9 (4, 5, 5, 0)
[ 0  0  0 26]
25 C
30 (25, 5, 5, 0)
[26  0  0  0]
27 C
32 (27, 5, 5, 0)
[26  0  0  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 26]
58 T
63 (58, 5, 5, 0)
[ 0  0 26  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 26]
GGCCGGAGCGAAGTATGTACTTCACCACAGACTGTTAACTGACATATGGAGCGGCTATTCACATTATACATCCGCGGTCTTCAAGA

idx 13 locidx 660
6 A
11 (6, 5, 5, 0)
[ 0 16  0  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 16  0]
58 T
63 (58, 5, 5, 0)
[ 0  0 16  0]
AGTATGATACCCCGGCACCTTAACAACGGTCAACGGTAAAAACGGTATCAGCGTCCAGTCCAGGTATTACCAAGGGGTCCGCTGTT

idx 13 locidx 661
58 S
63 (58, 5, 5, 0)
[12  0  0 13]
68 T
73 (68, 5, 5, 0)
[ 0  0 25  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 25  0]
CGTTGGCCTGAGCTCAAACTCTCGCGGAAACTCGATCGACGCTCCGGATCGGATCAGASGGGTCGACATCGTAACTGTGTCAACTT

idx 13 locidx 662
8 A
13 (8, 5, 5, 0)
[ 0 23  0  0]
20 A
25 (20, 5, 5, 0)
[ 0 23  0  0]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 23]
44 C
49 (44, 5, 5, 0)
[23  0  0  0]
49 C
54 (49, 5, 5, 0)
[23  0  0  0]
GCGACTCTATGGAGGAAGGCACACCCGCCATTGCAGGTCATCAACTATACTGAGTGCCGTGTTGGCACCATCCAGTGTGAATTACA

idx 13 locidx 663
1 A
6 (1, 5, 5, 0)
[ 0 18  0  0]
23 T
28 (23, 5, 5, 0)
[ 0  0 18  0]
27 T
32 (27, 5, 5, 0)
[ 0  0 18  0]
GACAAGATAGGAACCAGGATAGATCAGTCAGCTCCGATGTATGTAGACCGGGTACATTCCTATTAACGCAGCGCCCACTCCGTATC

idx 13 locidx 664
5 W
10 (5, 5, 5, 0)
[ 0  9 10  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 19  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 19]
33 A
38 (33, 5, 5, 0)
[ 0 19  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 19]
77 C
82 (77, 5, 5, 0)
[19  0  0  0]
TCGGAWAGTAGTAACTCGAGACGCTGCCTGGGTACTAGAGAGCCTCGGCGAGTCTATGGTAGTAGGGGCCCACTTGGCTTCATGAC

idx 13 locidx 665
18 A
23 (18, 5, 5, 0)
[ 0 16  0  1]
44 T
49 (44, 5, 5, 0)
[ 0  0 17  0]
55 C
60 (55, 5, 5, 0)
[17  0  0  0]
70 C
75 (70, 5, 5, 0)
[17  0  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 17  0]
82 C
87 (82, 5, 5, 0)
[17  0  0  0]
AAGCTTGCAGGCTTTCACATAAATCTGTACAAGATATTGCTTTCTGGTCAGTTAGCGAGAGACTCTTTTGCCTTTGCTCGCCCCTA

idx 13 locidx 666
17 G
22 (17, 5, 5, 0)
[ 0  0  0 18]
46 T
51 (46, 5, 5, 0)
[ 0  0 18  0]
49 A
54 (49, 5, 5, 0)
[ 0 18  0  0]
GAGCGAAACCGGCCGGCGCGCGTGGCTAACGTTCCTATCGCTTGCTTGTAGCGCAATCGGAATCTAAGTGGCGGCCTCCTCCAATC

idx 13 locidx 667
8 C
13 (8, 5, 5, 0)
[22  0  0  0]
11 A
16 (11, 5, 5, 0)
[ 0 22  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 22  0  0]
30 C
35 (30, 5, 5, 0)
[22  0  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 22  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 22  0]
CTACATGACTTAACTGAATCCGGAGTTCCTCTTAGATGTGCGTTTTGTTAGGAGATAGGCACACTGCACCAGGCGGGTGGGTAAGC

idx 13 locidx 668
0 C
5 (0, 5, 5, 0)
[20  0  0  0]
7 G
12 (7, 5, 5, 0)
[ 0  0  0 20]
40 A
45 (40, 5, 5, 0)
[ 0 20  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 20]
58 T
63 (58, 5, 5, 0)
[ 0  0 20  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 20  0]
75 A
80 (75, 5, 5, 0)
[ 0 20  0  0]
CGTCGAGGCGATTCGTTGGAAACTTGCACGGCTTCTCCTGAGACCCGGCGTTGCCTATTGTGGATAGCTGTAGCAAGGCATGAGGG

idx 13 locidx 669
40 G
45 (40, 5, 5, 0)
[ 0  0  0 21]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 21]
GAAGAGGTCCGGTATGCCATGAATCCGCTGCTAGATAACAGAGATGGGTTTATTGCGTGCTCTTCAGCAATAGAATTAGTAGGGGA

idx 13 locidx 670
0 A
5 (0, 5, 5, 0)
[ 0 24  0  0]
6 A
11 (6, 5, 5, 0)
[ 0 24  0  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 24]
32 C
37 (32, 5, 5, 0)
[24  0  0  0]
34 A
39 (34, 5, 5, 0)
[ 0 24  0  0]
50 C
55 (50, 5, 5, 0)
[24  0  0  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 24  0]
60 C
65 (60, 5, 5, 0)
[24  0  0  0]
84 C
89 (84, 5, 5, 0)
[24  0  0  0]
AAGTGAAAAACAACTCAGCGCTGGATTCCATCCCAGGCACTACCTCCTAGCTGGAAGGGTCCTCGAATGAGTAGTATTACTGACCC

idx 13 locidx 671
14 T
19 (14, 5, 5, 0)
[ 0  0 18  0]
43 A
48 (43, 5, 5, 0)
[ 0 18  0  0]
79 S
84 (79, 5, 5, 0)
[ 8  0  0 10]
CTCAAGACTTAGGATCTGTGCTCTACTTGTTCCACATTGTGACAAGCGCGGACTTACCACATCCAATCCTCCTCGGTACSAAATAT

idx 13 locidx 672
2 T
7 (2, 5, 5, 0)
[ 0  0 21  0]
15 C
20 (15, 5, 5, 0)
[21  0  0  0]
42 W
47 (42, 5, 5, 0)
[ 0 10 11  0]
CTTCCCTAACCTCCCCGAATTCTGCTCGCGTGCCAAGTTCGTWCTTGGCAAAGCCACGGCATGTCCTCGTAAAGCTGTAGATGGTT

idx 13 locidx 673
13 C
18 (13, 5, 5, 0)
[21  0  0  0]
15 A
20 (15, 5, 5, 0)
[ 0 21  0  0]
32 T
37 (32, 5, 5, 0)
[ 0  0 21  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 21  0]
48 T
53 (48, 5, 5, 0)
[ 0  0 21  0]
52 A
57 (52, 5, 5, 0)
[ 0 21  0  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 21]
73 T
78 (73, 5, 5, 0)
[ 0  0 21  0]
TCCCGGCGCTCTTCTACTCATACCTCCACTTCTACGTTTAGCGCATGTTGGGAGGTCCGATGAAGAGAGTGCGTCGTATCTCCAAT

idx 13 locidx 674
21 T
26 (21, 5, 5, 0)
[ 0  0 26  0]
75 A
80 (75, 5, 5, 0)
[ 0 26  0  0]
ATCCTCTGCTCCAGTCACTTGTACAGATCATGTCGTGGGCCGACATGTACAACAGTCATGGAGTTATAAAGGTAAAAACGGCCCAA

idx 13 locidx 675
2 T
7 (2, 5, 5, 0)
[ 0  0 12  0]
5 G
10 (5, 5, 5, 0)
[ 0  0  0 12]
12 T
17 (12, 5, 5, 0)
[ 0  0 12  0]
13 A
18 (13, 5, 5, 0)
[ 0 12  0  0]
28 C
33 (28, 5, 5, 0)
[12  0  0  0]
38 W
43 (38, 5, 5, 0)
[0 5 7 0]
84 T
89 (84, 5, 5, 0)
[ 0  0 12  0]
CTTCTGAAGCCTTAAATCCTCACGTCAACATGATGCCTWCATGAATCATATACTGTTTATATTATCCTTATACACAAAAGAGCCTA

idx 13 locidx 676
2 C
7 (2, 5, 5, 0)
[22  0  0  0]
19 C
24 (19, 5, 5, 0)
[22  0  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 22  0]
54 A
59 (54, 5, 5, 0)
[ 0 22  0  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 22  0]
AACGTCAAGGACCTAATTGCGGGCAATGGACCCGTGAACTCACGTTTCTGCTTGAGCAATAGCAGGTGTAATTTGTAGTCTAAATA

idx 13 locidx 677
72 C
77 (72, 5, 5, 0)
[20  0  0  0]
CACACCGCGCACACGCCGACGCTTCCACGATAAGCCCACTTACCTGTGCACGACCTGTGTATGGGCGCGGATCAAGCGCCGCACTT

idx 13 locidx 678
7 A
12 (7, 5, 5, 0)
[ 0 21  0  0]
84 A
89 (84, 5, 5, 0)
[ 0 21  0  0]
TACAAGAAAGCGAGATCTCGACTTTACGGATTGCGCCGTCTAGAGGATTGGTCATTGTTTGACAGATCTGTGAGACAGATACTGAC

idx 13 locidx 679
20 T
25 (20, 5, 5, 0)
[ 0  0 19  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 19  0]
46 A
51 (46, 5, 5, 0)
[ 0 19  0  0]
GGGGTCGTCACTACAAAACGTAAACATGTAACATCGGGGTAGTGATATCTTAGCCCGCTCATAATTGTAACCGGTTCTATACTGGC

idx 13 locidx 680
28 C
33 (28, 5, 5, 0)
[24  0  0  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 24  0]
81 C
86 (81, 5, 5, 0)
[24  0  0  0]
AAATGATATTCATGGCGAAGGTGTGTCTCTGCGACTTGCTTCAATCGAGAGGACTCTGGTTTATTTTGGGAAGCATACTGCCTAAG

idx 13 locidx 681
9 T
14 (9, 5, 5, 0)
[ 0  0 20  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 20]
GACATTAGATATCCGACTAAAGGTATCTTAAGTTCTTAATAGATACCGCAAAACTCACGAGTGGTTTTCCTCATCGGATGCTTCCC

idx 13 locidx 682
11 A
16 (11, 5, 5, 0)
[ 0 19  0  0]
59 A
64 (59, 5, 5, 0)
[ 0 19  0  0]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 19]
78 C
83 (78, 5, 5, 0)
[19  0  0  0]
83 C
88 (83, 5, 5, 0)
[19  0  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 19  0  0]
87 -
91 (87, 5, 5, 1)
[0 0 0 0]
TTTTATGTACGACGCGTCGTGGACCACTGCATAAATCAAGCTTACCTTAATTAGGCGGAAGCCAGGCCCGTTTGCGTACAACACAA--

idx 13 locidx 683
26 C
31 (26, 5, 5, 0)
[20  0  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 20]
68 A
73 (68, 5, 5, 0)
[ 0 20  0  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 20  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 20  0]
83 A
88 (83, 5, 5, 0)
[ 0 20  0  0]
AATTGCGACAAACGCTATCTAGCTTTCTGCAGGCGGAAATTTTTCGGCACTCATGTAAATCCAGCTCGAGGGTCGCTTTTCCCAAC

idx 13 locidx 684
17 C
22 (17, 5, 5, 0)
[14  0  0  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 14  0]
44 A
49 (44, 5, 5, 0)
[ 0 14  0  0]
60 C
65 (60, 5, 5, 0)
[14  0  0  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 14]
CTATGCTCAAAAGGCTCCCGAGATCGTTGTTGAGGCCTCGATCAAACTATAGCGTTTCAACGGAGCCTTCTCATACACAAGTAGAC

idx 13 locidx 685
51 A
56 (51, 5, 5, 0)
[ 0 25  0  0]
TATAGTTTCATTTTACCGGAGATACAGGGCCGAATTCATTGGCGCCGCTGTAGACGGCCTTTAACTCTCGTAACCGGTAGCAAGTT

idx 13 locidx 686
13 G
18 (13, 5, 5, 0)
[ 0  0  0 19]
18 A
23 (18, 5, 5, 0)
[ 0 19  0  0]
19 T
24 (19, 5, 5, 0)
[ 0  0 19  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 19  0]
80 A
85 (80, 5, 5, 0)
[ 0 19  0  0]
GATACAAGTAGAGGACTTATGTCCCGCTATCGAGCCGAAAACGGACCTTGCGAAAGTACCGGTCTTTTATGGCGGAAAAAAGGGTC

idx 13 locidx 687
0 G
5 (0, 5, 5, 0)
[ 0  0  0 20]
22 A
27 (22, 5, 5, 0)
[ 0 20  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 20]
GTCTCACGGCGATGATCAGCCCAGTAGCTACAAACCAATTCTAAGATCAGGTGTAGCCAGCGATTCTAGAGGCGCGAGTTCTGGCG

idx 13 locidx 688
4 C
9 (4, 5, 5, 0)
[22  0  0  0]
13 C
18 (13, 5, 5, 0)
[22  0  0  0]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 22]
28 G
33 (28, 5, 5, 0)
[ 0  0  0 22]
29 A
34 (29, 5, 5, 0)
[ 0 22  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 22  0  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 22]
56 T
61 (56, 5, 5, 0)
[ 0  0 22  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 22]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 22]
81 C
86 (81, 5, 5, 0)
[22  0  0  0]
GAGGCGTATAAGCCGCGTATGTAGGCTTGATGGGCGGCTAAACAACTTTTGGAGTCTCCAGTATACCTTCGAACGATTGGCCTATC

idx 13 locidx 689
0 T
5 (0, 5, 5, 0)
[ 0  0 18  0]
35 A
40 (35, 5, 5, 0)
[ 0 18  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 18]
73 C
78 (73, 5, 5, 0)
[18  0  0  0]
TCAAGTGCGCGTGAGTCTTCACCTATAGGCGGACCAGGCAAAAGGGTGGTAGCAAAAGACTTTTGTGATTGCACAGTTATTCACAC

idx 13 locidx 690
6 G
11 (6, 5, 5, 0)
[ 0  0  0 20]
36 M
41 (36, 5, 5, 0)
[10 10  0  0]
46 C
51 (46, 5, 5, 0)
[20  0  0  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 20]
85 A
90 (85, 5, 5, 0)
[ 0 20  0  0]
GTCCATGACACGGACCCAAATTCAAGTTTTACCTGAMTTTGGTAATCGAGTAACCGCGCTCCGACTTAATCACTCCAATCTACGCA

idx 13 locidx 691
57 A
62 (57, 5, 5, 0)
[ 0 16  0  0]
59 C
64 (59, 5, 5, 0)
[16  0  0  0]
61 A
66 (61, 5, 5, 0)
[ 0 16  0  0]
CAGGTCACGAAACACGCATTATTGCATGTCGTATGATTACTAGCAGGGCTATTATGTAACCATATATCGCCCCCCCCCGAACCTCA

idx 13 locidx 692
45 G
50 (45, 5, 5, 0)
[ 0  0  0 23]
68 T
73 (68, 5, 5, 0)
[ 0  1 22  0]
79 A
84 (79, 5, 5, 0)
[ 0 23  0  0]
CTCCGTAACCAAGTGGGAACTCTATACGTACAACTATGTGACCCAGGCGTAAGCATTCAGCACCACCGTTGGTGTAGGCAGACATT

idx 13 locidx 693
0 A
5 (0, 5, 5, 0)
[ 0 22  0  0]
26 C
31 (26, 5, 5, 0)
[22  0  0  0]
31 C
36 (31, 5, 5, 0)
[22  0  0  0]
35 A
40 (35, 5, 5, 0)
[ 0 22  0  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 22  0]
85 C
90 (85, 5, 5, 0)
[22  0  0  0]
AGGCCGACTAGCGTTGCAAAATGTGACTACTCTAAAGATTCTGGCAATTGTATTGAGCACTGGTTGGGACCCACCACCCCAACTTC

idx 13 locidx 694
8 A
13 (8, 5, 5, 0)
[ 0 18  0  0]
25 C
30 (25, 5, 5, 0)
[18  0  0  0]
48 C
53 (48, 5, 5, 0)
[18  0  0  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 18]
84 C
89 (84, 5, 5, 0)
[18  0  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 18  0  0]
GCCGGGAAATGGTCCGCAGGCGCGTCTTTTGCGCTTCGCGGGGTGCATCAGTATTCGCCGCGTATGAAGATGAATCATAAGCCCCA

idx 13 locidx 695
4 A
9 (4, 5, 5, 0)
[ 0 22  0  0]
9 C
14 (9, 5, 5, 0)
[22  0  0  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 22  0]
29 A
34 (29, 5, 5, 0)
[ 0 22  0  0]
TTTAAGGAGCGCATACTTTGGATATGTCGAAGGGCAACTCTGCATTCTACCTAGAGCGCTACCGCAGGCATACGCATTGCTGGGTG

idx 13 locidx 696
24 C
29 (24, 5, 5, 0)
[21  0  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 21]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 21]
AATAAAGAATCGTACCTCCCAAATCGCTATCACAAGTCGTCGCGATATAGATCCCGGAAGTGCGTGTTGAACGCGATCGCGTAGAC

idx 13 locidx 697
28 G
33 (28, 5, 5, 0)
[ 0  0  0 19]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 19]
40 A
45 (40, 5, 5, 0)
[ 0 19  0  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 19]
76 A
81 (76, 5, 5, 0)
[ 0 19  0  0]
TCTATGGGAGAATCTAGAGCATTAGCAGGCGGTTGCCGTCAGGCTAGTTGTGTACGTAACACTTCCCGTGCGAGTAATCAAAACTC

idx 13 locidx 698
36 T
41 (36, 5, 5, 0)
[ 0  0 24  0]
41 G
46 (41, 5, 5, 0)
[ 0  0  0 24]
43 T
48 (43, 5, 5, 0)
[ 0  0 24  0]
62 S
67 (62, 5, 5, 0)
[12  0  0 12]
GTTTCGATCTTTTATGCCTTTTTTTAGTACCGACAATAGTTGCTAAGTCAGAGGGGAAGGTGSGAGCTCGACCGTTAACCCTTCGC

idx 13 locidx 699
25 C
30 (25, 5, 5, 0)
[19  0  0  0]
56 Y
61 (56, 5, 5, 0)
[ 8  0 11  0]
77 T
82 (77, 5, 5, 0)
[ 0  0 19  0]
78 C
83 (78, 5, 5, 0)
[19  0  0  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 19]
CGGCTTTTGATTCCAGCTATGGGCTCCATTTTTGTAATATCAGGGTCCTCGAGGCAYAGGTATCATAACATACTGGTTCCTCCAGC

idx 14 locidx 700
30 A
35 (30, 5, 5, 0)
[ 0 21  0  0]
42 A
47 (42, 5, 5, 0)
[ 0 21  0  0]
48 A
53 (48, 5, 5, 0)
[ 0 21  0  0]
67 W
72 (67, 5, 5, 0)
[ 0  8 13  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 21]
AGGTCGAAGGGGGGTATTGTACTTAGTTCAATTACGCAATGAAATGCCAGAGGTCAATGCAAGGTAAWTTTGAGGAGGCGTATTTG

idx 14 locidx 701
2 G
7 (2, 5, 5, 0)
[ 0  0  0 18]
10 T
15 (10, 5, 5, 0)
[ 0  0 18  0]
41 A
46 (41, 5, 5, 0)
[ 0 18  0  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 18]
85 A
90 (85, 5, 5, 0)
[ 0 18  0  0]
CAGTAATCTCTGCCCAGATTTAGAAACGTGCCAGCAAAGCCAACACATAACGCGGTGATCCGGCTGTTTACGGACCGTCAGGATCA

idx 14 locidx 702
6 C
11 (6, 5, 5, 0)
[20  0  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 20  0  0]
82 A
87 (82, 5, 5, 0)
[ 0 20  0  0]
GGGCCCCTGTGACAAAGCCTGTATAGCAGTTAAAATACGCGATTACACTACATATCTGAAGACTTCACTCCTCGGGGACAAAAT-TC

idx 14 locidx 703
9 A
14 (9, 5, 5, 0)
[ 0 21  0  0]
16 C
21 (16, 5, 5, 0)
[21  0  0  0]
27 C
32 (27, 5, 5, 0)
[21  0  0  0]
82 T
87 (82, 5, 5, 0)
[ 0  0 21  0]
ACGCATTAGATGTACCCATTGGAACCGCGACGTATATGGCCTGTACGAACGGCTTCACGGTAGTTGGCAATTACTGCATAATTCTC

idx 14 locidx 704
22 G
27 (22, 5, 5, 0)
[ 0  0  0 17]
46 T
51 (46, 5, 5, 0)
[ 0  0 17  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 17]
72 T
77 (72, 5, 5, 0)
[ 0  0 17  0]
CCCAGTAACCAATGAGGTCTCCGGCAGTCTGACCCGCTGCTGGGAGTTGGTACCTAGTCGGCTCCGGTAAGATCGTAATTAGTATC

idx 14 locidx 705
2 A
7 (2, 5, 5, 0)
[ 0 21  0  0]
4 A
9 (4, 5, 5, 0)
[ 0 21  0  0]
7 G
12 (7, 5, 5, 0)
[ 0  0  0 21]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 21]
50 A
55 (50, 5, 5, 0)
[ 0 21  0  0]
56 C
61 (56, 5, 5, 0)
[21  0  0  0]
57 C
62 (57, 5, 5, 0)
[21  0  0  0]
66 A
71 (66, 5, 5, 0)
[ 0 21  0  0]
CAAAACCGACTCAATCTAGTACCTGATTCTGTACATGGTCAGTTACAATTAGTATACCCACCGATTAATAAGATCGAGTAAGCAAG

idx 14 locidx 706
11 C
16 (11, 5, 5, 0)
[22  0  0  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 22]
42 A
47 (42, 5, 5, 0)
[ 0 22  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 22]
68 C
73 (68, 5, 5, 0)
[22  0  0  0]
GTTACTGACGGCGGTAAGGAATCGACCGCACGTGCAAACTGGAAATGGAAAACAAGGATTGGAAATGTCGAAGCCCACCGTCGCAT

idx 14 locidx 707
60 A
65 (60, 5, 5, 0)
[ 0 22  0  0]
73 C
78 (73, 5, 5, 0)
[21  1  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 22  0  0]
ATTGCAGATCATATGGGCAGTAACCCGACCCGAGAGTGTGCCCGCACTAAGGTGGTATGGAAAACCCCGCTCCCTAAGGGCCATGA

idx 14 locidx 708
29 C
34 (29, 5, 5, 0)
[22  0  0  0]
GGCATCTTGTGAGGAGGGCGTCAGTGGTCCGAATTTACCTCTAAAGATATCACCTACGGCCCGCTCCGCTTAGGCTGGTTTTAATC

idx 14 locidx 709
9 T
14 (9, 5, 5, 0)
[ 0  0 22  0]
15 T
20 (15, 5, 5, 0)
[ 0  0 22  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 22  0]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 22]
60 C
65 (60, 5, 5, 0)
[22  0  0  0]
77 A
82 (77, 5, 5, 0)
[ 0 21  0  1]
TTCCGAGTCTTACTGTCCCAACGCTAGAAACAGGAGCCAACGCCATACACTAATAGCCGGCCGGAGCACCGCCCGTTACCGACGAT

idx 14 locidx 710
22 A
27 (22, 5, 5, 0)
[ 0 21  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 21  0]
45 A
50 (45, 5, 5, 0)
[ 0 21  0  0]
50 A
55 (50, 5, 5, 0)
[ 0 21  0  0]
GGTACGACCAATCTAGCAAGCGAGGGTAGTTACGTCTACCCTCCCAAGCAAGACTCAAACAGACAAGACTTTCGACTGCATGTCCC

idx 14 locidx 711
4 T
9 (4, 5, 5, 0)
[ 0  0 23  0]
17 C
22 (17, 5, 5, 0)
[23  0  0  0]
50 A
55 (50, 5, 5, 0)
[ 0 23  0  0]
GCGTTCAAGAAGATTAACCTTAAGCATGCAACACGCACGCACGAAACCGAATGGTCAGTTGGCCCTAAATGCGCTTAGTTACGACC

idx 14 locidx 712
0 C
5 (0, 5, 5, 0)
[21  0  0  0]
2 A
7 (2, 5, 5, 0)
[ 0 21  0  0]
8 C
13 (8, 5, 5, 0)
[21  0  0  0]
26 C
31 (26, 5, 5, 0)
[21  0  0  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 21]
38 C
43 (38, 5, 5, 0)
[21  0  0  0]
53 C
58 (53, 5, 5, 0)
[21  0  0  0]
CAAGATCACGGCGGACAGAACCGCCCCTTTTCTTGTTGCTGGTTAACTTCACGCCGTCATGGTTAGTGGTCAGGCTTTACAGGTCC

idx 14 locidx 713
2 G
7 (2, 5, 5, 0)
[ 0  0  0 19]
10 T
15 (10, 5, 5, 0)
[ 0  0 19  0]
22 S
27 (22, 5, 5, 0)
[10  0  0  9]
24 G
29 (24, 5, 5, 0)
[ 0  0  0 19]
44 A
49 (44, 5, 5, 0)
[ 0 19  0  0]
48 w
53 (48, 5, 5, 0)
[ 0  9 10  0]
TAGATCGTGGTTGGCGCGGCAASTGGTACGACGGATACCCAGGCAGGGwTTTACAGCGTGCTGTCATCGCCAGAGGTTGGGAGCAT

idx 14 locidx 714
33 C
38 (33, 5, 5, 0)
[23  0  0  0]
55 C
60 (55, 5, 5, 0)
[23  0  0  0]
GAGCCACCGGATAAAGGCTGTATACTACCGGAACCTATGTTCGCACCTGGGGCAGCAGGGATTTGTTTTCGAATAATAGAAAGTTT

idx 14 locidx 715
38 T
43 (38, 5, 5, 0)
[ 0  0 21  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 21]
41 C
46 (41, 5, 5, 0)
[21  0  0  0]
52 C
57 (52, 5, 5, 0)
[21  0  0  0]
56 A
61 (56, 5, 5, 0)
[ 0 21  0  0]
71 T
76 (71, 5, 5, 0)
[ 0  0 21  0]
GCCGTGCCAGGACACACTCAAGGGTCATCTGTTGCGAATTGCCAATGTGCTGCGGCATGAAACGTACTCACTTGGTCAAGCCGCTT

idx 14 locidx 716
28 C
33 (28, 5, 5, 0)
[17  0  0  0]
29 C
34 (29, 5, 5, 0)
[17  0  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 17  0]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 17]
80 A
85 (80, 5, 5, 0)
[ 0 17  0  0]
GTTCTACCGATAGTCGGTAATTCTATGGCCGAGTTGTTTTAACGTTCGTTTAATTGTCTGGCCGGAGCTGCCGATTCTCCACCAAG

idx 14 locidx 717
2 T
7 (2, 5, 5, 0)
[ 0  0 16  0]
8 T
13 (8, 5, 5, 0)
[ 0  0 16  0]
15 G
20 (15, 5, 5, 0)
[ 0  0  0 16]
24 G
29 (24, 5, 5, 0)
[ 0  0  0 16]
32 A
37 (32, 5, 5, 0)
[ 0 16  0  0]
39 C
44 (39, 5, 5, 0)
[16  0  0  0]
62 A
67 (62, 5, 5, 0)
[ 0 16  0  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 16  0]
CCTTGGGGTAAAGAAGGTCTAAAGGAATCACCACCCTCACTCCCTGAGAGTACGAAATGGAGACGAGCCTTTAATCTTCGTAGAGA

idx 14 locidx 718
27 T
32 (27, 5, 5, 0)
[ 0  0 23  0]
63 A
68 (63, 5, 5, 0)
[ 0 23  0  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 23]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 23]
AGACGCTCAGGTTGGAATCGACGGGTGTCGAGTCCTCGTCTCCTGAACTAAGTATCTAGTACTAACGATACGAAGGCAAGAGAGTG

idx 14 locidx 719
11 G
16 (11, 5, 5, 0)
[ 0  0  0 18]
21 T
26 (21, 5, 5, 0)
[ 0  0 18  0]
30 C
35 (30, 5, 5, 0)
[18  0  0  0]
51 T
56 (51, 5, 5, 0)
[ 0  0 18  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 18]
67 A
72 (67, 5, 5, 0)
[ 0 18  0  0]
GCACGAAGCTCGAACACGCGCTCCCTCGACCCGGATTCACGCTGGCCACAGTTGGCTTCTCGTTACGAGCATGTATTACGTAACTG

idx 14 locidx 720
49 G
54 (49, 5, 5, 0)
[ 0  0  0 20]
57 A
62 (57, 5, 5, 0)
[ 0 20  0  0]
77 S
82 (77, 5, 5, 0)
[11  0  0  9]
CAACCATGATTCCGAGATACAGTGCTTGAGTTCTTTCTCATGTCTGGGTGCGATAGGAATGAAGTTTTGGCCCTGGTSTGGCCTTC

idx 14 locidx 721
19 C
24 (19, 5, 5, 0)
[16  0  0  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 16]
ACAACCACGAAGGTTAGGACCAGTTAGCATGAATCTACATTTTCTTTCGTCCTACGTCATAATATACAACCCCGGGAATCTGCCGT

idx 14 locidx 722
78 T
83 (78, 5, 5, 0)
[ 0  0 20  0]
TAGGGTTCGAGCGTTTGTATCCGGCGTTTGCGCCTCTAAGACCTATTGTCCAGGATTTGCTACTCCGTTAAAACCGGGTGGTTTGT

idx 14 locidx 723
7 G
12 (7, 5, 5, 0)
[ 0  0  0 20]
28 A
33 (28, 5, 5, 0)
[ 0 20  0  0]
31 T
36 (31, 5, 5, 0)
[ 0  0 20  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 20  0]
GTGTAAGGACTGATGCATCTACCGTTTAACCTCGATTTGGTTGGGGTAAAACCAACCATGCACTCTCGTTGCTGAGCGTTCGGTAC

idx 14 locidx 724
7 G
12 (7, 5, 5, 0)
[ 0  0  0 17]
37 T
42 (37, 5, 5, 0)
[ 0  0 17  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 17]
64 C
69 (64, 5, 5, 0)
[17  0  0  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 17]
TCGAGTAGGGCAGGGACGCTCTAAAACCCTGATCAACTGCAGAGATCGGCAAGCCAACGCCGTGCAATTTGTGTGCATCATTTCAA

idx 14 locidx 725
9 A
14 (9, 5, 5, 0)
[ 0 17  0  0]
15 C
20 (15, 5, 5, 0)
[17  0  0  0]
25 K
30 (25, 5, 5, 0)
[ 0  0 10  7]
29 C
34 (29, 5, 5, 0)
[17  0  0  0]
78 C
83 (78, 5, 5, 0)
[17  0  0  0]
84 A
89 (84, 5, 5, 0)
[ 0 17  0  0]
CCGCCCTGCACAGATCCTGAGTCGGKCATCCAGCAAGTATGATGAAGGATACAGCTGCATTGAAAACGGCGATAATGACTTTTAAG

idx 14 locidx 726
22 G
27 (22, 5, 5, 0)
[ 0  0  0 16]
24 T
29 (24, 5, 5, 0)
[ 0  0 16  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 16]
AGCTGACCAAGATTCATACTAGGATGTGGAGAACCGTATTTTTGGTGAAAGACAAAAGACGTGCTGTACACATACCCGTTGCATGC

idx 14 locidx 727
4 A
9 (4, 5, 5, 0)
[ 0 19  0  0]
18 C
23 (18, 5, 5, 0)
[19  0  0  0]
25 C
30 (25, 5, 5, 0)
[19  0  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 19]
75 C
80 (75, 5, 5, 0)
[19  0  0  0]
TATGACAGCTTCGCCAGGCTTCGATCTGCTCCTCGACACGACCCTAGCGAATACACACCTCTTGCAACCTAGTTGCTATGTTTGCT

idx 14 locidx 728
4 G
9 (4, 5, 5, 0)
[ 0  0  0 21]
5 A
10 (5, 5, 5, 0)
[ 0 21  0  0]
16 C
21 (16, 5, 5, 0)
[21  0  0  0]
18 A
23 (18, 5, 5, 0)
[ 0 21  0  0]
22 T
27 (22, 5, 5, 0)
[ 0  0 21  0]
35 T
40 (35, 5, 5, 0)
[ 0  0 21  0]
ATCAGAATATGGTATGCGACGATCACCACGGAAGATCTCGGTGACGTGAACTGACGGAGACGCGTGAGGTAATCTATTCGAGACTA

idx 14 locidx 729
1 T
6 (1, 5, 5, 0)
[ 0  0 19  0]
32 A
37 (32, 5, 5, 0)
[ 0 19  0  0]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 19]
63 R
68 (63, 5, 5, 0)
[ 0 14  0  5]
66 A
71 (66, 5, 5, 0)
[ 0 19  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 19  0]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 19]
ATTTTTCACCAGTCCGCCATCGATTACGTCTGAGGTGAGTATTACAGTTCACCGGGAGCCCGTRAGAGCGGGGCATTAAGGTAGCT

idx 14 locidx 730
5 T
10 (5, 5, 5, 0)
[ 0  0 20  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 20]
40 A
45 (40, 5, 5, 0)
[ 0 20  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 20  0]
61 C
66 (61, 5, 5, 0)
[20  0  0  0]
TGCACTGTTTCGTTTTTCGAGTATTCATGATGAAGGCACAACCTGGTATGATCACATTGGGCGCTTAATCGGGCCACTCACCGAGA

idx 14 locidx 731
9 A
14 (9, 5, 5, 0)
[ 0 22  0  0]
12 C
17 (12, 5, 5, 0)
[22  0  0  0]
71 C
76 (71, 5, 5, 0)
[22  0  0  0]
75 C
80 (75, 5, 5, 0)
[22  0  0  0]
82 C
87 (82, 5, 5, 0)
[22  0  0  0]
84 C
89 (84, 5, 5, 0)
[22  0  0  0]
GCAGAGGTCAAACAAGAGGTAATTGATGTCAAATTCAAACGCAATGTCATTGGTTCTGCTTGTGCGTCTTTCCCCCCTTAAGCGCA

idx 14 locidx 732
19 C
24 (19, 5, 5, 0)
[20  0  0  0]
43 A
48 (43, 5, 5, 0)
[ 0 20  0  0]
49 T
54 (49, 5, 5, 0)
[ 0  0 20  0]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 20]
85 T
90 (85, 5, 5, 0)
[ 0  0 20  0]
AGATGGGCCCATATGGCCTCTCCAAGATCAGCAATTTGAAGGCATGGGCTATGATACTGCTCCTGGGCGCGGGATTAACAAAGCGT

idx 14 locidx 733
6 A
11 (6, 5, 5, 0)
[ 0 20  0  0]
63 A
68 (63, 5, 5, 0)
[ 1 19  0  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 20  0]
AAACTTAGCCGGAACGCTATCGCCCGAATGACTCTCGGTGGGATGTGGTGCGCGTGAGTACAAACTAGCTCGAAAGAGAGTGCCGT

idx 14 locidx 734
3 C
8 (3, 5, 5, 0)
[19  0  0  0]
21 T
26 (21, 5, 5, 0)
[ 0  0 19  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 19  0]
AACCGTTTAGGAGGAGACTATTCGAGTAAGGACTCGTCCCCTTCTATCAGTACGTCTACGAGTCCAACACCTGGAGCAATATCCAC

idx 14 locidx 735
0 G
5 (0, 5, 5, 0)
[ 0  0  0 22]
4 A
9 (4, 5, 5, 0)
[ 0 22  0  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 22]
77 C
82 (77, 5, 5, 0)
[22  0  0  0]
GTCCAACGAACTTAAAGGACCCTAGAAAGTCGTTAGTGTACAACCCCCTTACTTTATGGGGGAAGCAATCTTATATGCATTAAACC

idx 14 locidx 736
13 T
18 (13, 5, 5, 0)
[ 0  0 26  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 26]
48 T
53 (48, 5, 5, 0)
[ 0  0 26  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 26]
GTGTCCTGCCCTGTTTGCAGTTAATATAACGTGGGTACCAGATGTACATGTAATCCTACACGCGAGGAGTACAACGTTGGCAGGGC

idx 14 locidx 737
38 C
43 (38, 5, 5, 0)
[16  0  0  0]
51 G
56 (51, 5, 5, 0)
[ 0  0  0 16]
60 C
65 (60, 5, 5, 0)
[16  0  0  0]
ACCGGATTCAAGAGATACAGACAATAGAAAGTCTGAGCCCGCGGTCGTTGAGAGTCTGGTCCTTGAGTTTCACTTCGGGCTAAACC

idx 14 locidx 738
29 C
34 (29, 5, 5, 0)
[24  0  0  0]
32 C
37 (32, 5, 5, 0)
[24  0  0  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 24]
57 A
62 (57, 5, 5, 0)
[ 0 24  0  0]
TCAGGTGATATTTGTTGTACCACGTGACGCCGCTCCATCTCAAGAACTTGTATTTCTATACTCTTAAGAAGTGGGTAAAACCCTCG

idx 14 locidx 739
26 G
31 (26, 5, 5, 0)
[ 0  0  0 20]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 20]
63 G
68 (63, 5, 5, 0)
[ 0  0  0 20]
65 A
70 (65, 5, 5, 0)
[ 0 20  0  0]
GATGGAGACCCCGGGGTTTCTCAGCGGCATAGGTCCATTTGTCAATGAGGTTAAATGCTTCGAGCAGATACGTGCACGCTTCCCAA

idx 14 locidx 740
58 A
63 (58, 5, 5, 0)
[ 0 17  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 17  0  0]
CCTGCAGGTTTAGCCTATTTGATTGCCGGACCCGATGCGGTGAACCGAATTTGAGTGCACAGGGGAGGATCAGGAGGTTCTATCAC

idx 14 locidx 741
12 G
17 (12, 5, 5, 0)
[ 0  0  0 23]
19 A
24 (19, 5, 5, 0)
[ 0 23  0  0]
20 C
25 (20, 5, 5, 0)
[23  0  0  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 23]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 23]
AGCCTAATGAACGGCTTGCACATCAAGTCTGCACTATCTGCACCATAACGTCTGTATGGTACATTACATATAATATTGCAGGTGCT

idx 14 locidx 742
8 T
13 (8, 5, 5, 0)
[ 0  0 22  0]
25 C
30 (25, 5, 5, 0)
[22  0  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 22]
TGTATTGTTATAGTCTGGAAGACAGCTGGTATCAGATCTGATGCTTTCCTACGAAGCACATATGTACGGTAGCCGGTGGGGCATTG

idx 14 locidx 743
3 C
8 (3, 5, 5, 0)
[18  0  0  0]
18 T
22 (18, 5, 5, 1)
[ 0  0 18  0]
29 A
33 (29, 5, 5, 1)
[ 0 18  0  0]
57 T
60 (57, 5, 5, 2)
[ 0  0 18  0]
TCTCCTG-AATGCGGCGCTAAGTATAAGCAACCGCGTAAGTCA-TTGACCGTTCAAATTTCAAGCATGTCACACGCCGCACTTCGGGC

idx 14 locidx 744
10 G
15 (10, 5, 5, 0)
[ 0  0  0 22]
58 A
63 (58, 5, 5, 0)
[ 0 22  0  0]
78 A
83 (78, 5, 5, 0)
[ 0 22  0  0]
GTACGGACCAGAAATTGATTCGTGGCGACACCGGGGCGGGTCGGCCAAGATTCAACGCAGGGGCCTAAAGCGCACAAAACGTTTTC

idx 14 locidx 745
7 A
12 (7, 5, 5, 0)
[ 0 19  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 19]
37 A
42 (37, 5, 5, 0)
[ 0 19  0  0]
44 C
49 (44, 5, 5, 0)
[19  0  0  0]
51 T
56 (51, 5, 5, 0)
[ 0  0 19  0]
54 T
59 (54, 5, 5, 0)
[ 0  0 19  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 19  0]
57 G
62 (57, 5, 5, 0)
[ 0  0  0 19]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 19]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 19]
CGCCCGGACAAAATGGTAGTCTATCGGTCCACCCAAGAAGGTATCATGCTATAATTTGTCAGACAGGGTCTCGAGGCCGATTTTCG

idx 14 locidx 746
6 G
11 (6, 5, 5, 0)
[ 0  0  0 26]
37 T
42 (37, 5, 5, 0)
[ 0  0 26  0]
41 T
46 (41, 5, 5, 0)
[ 0  0 26  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 26  0]
57 A
62 (57, 5, 5, 0)
[ 0 26  0  0]
68 C
73 (68, 5, 5, 0)
[26  0  0  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 26]
TAGGTTGTGGGGCCATATCCTATTGCATCGGGTTGTCTGAGTAGCATACGGCATAGTAAAGCTGAAACCCGGGAAGGCGGTATCCA

idx 14 locidx 747
31 A
36 (31, 5, 5, 0)
[ 0 22  0  0]
GACTGTCTCGTTGCCTAGCAAAATGAGCGTTACCTGATATCCATAGCCATCTTGCGAATTCTACCTGTTTCGGGGTGTCGTACATC

idx 14 locidx 748
15 T
20 (15, 5, 5, 0)
[ 0  0 23  0]
30 T
35 (30, 5, 5, 0)
[ 0  0 23  0]
43 A
48 (43, 5, 5, 0)
[ 0 23  0  0]
60 A
65 (60, 5, 5, 0)
[ 0 23  0  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 23]
74 A
79 (74, 5, 5, 0)
[ 0 23  0  0]
TTGCACCGCCGGTCGTCTGGCTAGTAACTATACAAACAACGTCATCCAATCAGTTTTACTATTACGATAGTGGTATAGAGAATCTC

idx 14 locidx 749
44 T
49 (44, 5, 5, 0)
[ 0  0 22  0]
76 C
81 (76, 5, 5, 0)
[22  0  0  0]
78 T
83 (78, 5, 5, 0)
[ 0  1 21  0]
GTTTCTGCGAGAAACAGCTCGTATCACGACCCTTTGGCTGCCGGTTCTTAGCATGCAATATGTGGGCATAACTTCTCCTACCTTCT

idx 15 locidx 750
19 G
24 (19, 5, 5, 0)
[ 0  0  0 22]
71 T
76 (71, 5, 5, 0)
[ 0  0 22  0]
GCCATACACTAGTCCAAAAGGGTGTGAACCAGTGCCTATAAACAGCATGTCTGATATTTTGGAAGCTTTCTTAAAGGCAATAACTA

idx 15 locidx 751
1 C
6 (1, 5, 5, 0)
[21  1  0  0]
7 S
12 (7, 5, 5, 0)
[14  0  0  8]
GCACCACSGAGATTGTGGATGGGCTATTGGCCAGTAATCTTATCACCCCAATTCAATGATAAACAAAATTTACCGCGTGCGCAGGA

idx 15 locidx 752
7 T
12 (7, 5, 5, 0)
[ 0  0 18  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 18  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 18]
30 T
35 (30, 5, 5, 0)
[ 0  0 18  0]
32 C
37 (32, 5, 5, 0)
[18  0  0  0]
63 G
68 (63, 5, 5, 0)
[ 0  0  0 18]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 18]
AATGTCGTCCGACGAGGTGTCACACGGGTGTACGCGCCCGCCTCTGTTCACAGCGCGTGGTTGGACAGGGAAGCCTTTCCCCTCGC

idx 15 locidx 753
38 C
43 (38, 5, 5, 0)
[12  0  0  0]
63 G
68 (63, 5, 5, 0)
[ 0  0  0 12]
78 T
83 (78, 5, 5, 0)
[ 0  0 12  0]
79 A
84 (79, 5, 5, 0)
[ 0 12  0  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 12]
AAGATACATTGAGCGTAAGAAACCTCAAGGCCATGGCCCCTCATAGTAGGCACTGCCCTCAGGGACGTTAGAACTCCGTAGAGGCT

idx 15 locidx 754
15 A
20 (15, 5, 5, 0)
[ 0 15  0  0]
19 T
24 (19, 5, 5, 0)
[ 0  0 15  0]
27 A
32 (27, 5, 5, 0)
[ 0 15  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 15  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 15  0]
62 C
67 (62, 5, 5, 0)
[15  0  0  0]
76 A
81 (76, 5, 5, 0)
[ 0 15  0  0]
81 C
86 (81, 5, 5, 0)
[15  0  0  0]
CCCATTACCAACGAGAGACTGCGCACTAAAGGTCTAAACAATCCTGCCACTGAGCGGCACATCGATGGGATGTAGTATTACCTTTT

idx 15 locidx 755
24 A
29 (24, 5, 5, 0)
[ 0 17  0  0]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 17]
33 T
38 (33, 5, 5, 0)
[ 0  0 17  0]
73 A
78 (73, 5, 5, 0)
[ 0 17  0  0]
AAGACACGGGACTTCCGCCCGGGAAAAGGGCAATCTTCTACAGTGAGCCGCTGCAGCAACTACTAGCGCGGCAAAAGACCGAGGAA

idx 15 locidx 756
11 A
16 (11, 5, 5, 0)
[ 0 19  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 19  0  0]
41 C
46 (41, 5, 5, 0)
[19  0  0  0]
43 Y
48 (43, 5, 5, 0)
[ 7  0 12  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 19]
76 A
81 (76, 5, 5, 0)
[ 0 19  0  0]
84 C
89 (84, 5, 5, 0)
[19  0  0  0]
TCGTTATTAAAACTAATACAAGACATGCCACGTAAAGCACCCTYCACCGGTCTGACGAGATTATGAAATTACACCTAGATCACCCG

idx 15 locidx 757
1 G
6 (1, 5, 5, 0)
[ 0  0  0 18]
12 G
17 (12, 5, 5, 0)
[ 0  0  0 18]
34 A
39 (34, 5, 5, 0)
[ 0 18  0  0]
62 A
67 (62, 5, 5, 0)
[ 0 18  0  0]
83 C
88 (83, 5, 5, 0)
[18  0  0  0]
TGATTTCGATCGGCATCCACCCTTTAGAACCAGCAGAAGCCGGCCTACGCATTAGGGCAACAACACCGATGCAAAGTGCTGGCCGT

idx 15 locidx 758
12 A
17 (12, 5, 5, 0)
[ 1 19  0  0]
55 A
60 (55, 5, 5, 0)
[ 0 20  0  0]
GATGGCCGAGTAAAGAATGAGGTTCACAAATTTTATCACCACAAATCTTAAGAGAACATGGCATATCAAATTGAGGAGTCATCCTG-

idx 15 locidx 759
0 T
5 (0, 5, 5, 0)
[ 0  0 22  0]
1 A
6 (1, 5, 5, 0)
[ 0 22  0  0]
23 G
28 (23, 5, 5, 0)
[ 0  0  0 22]
39 G
44 (39, 5, 5, 0)
[ 0  0  0 22]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 22]
TAAAAGTACGAGTCGGCTATAAGGTTAAGCGTGAAAGATGGGGGTGACATCTTGTAAACGCCACGTAATGCTGAGGTCATTTAAAA

idx 15 locidx 760
14 T
19 (14, 5, 5, 0)
[ 0  0 23  0]
31 A
36 (31, 5, 5, 0)
[ 0 23  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 23]
76 T
81 (76, 5, 5, 0)
[ 0  0 23  0]
84 R
89 (84, 5, 5, 0)
[ 0 12  0 11]
85 w
90 (85, 5, 5, 0)
[ 0 11 12  0]
CCGCTCGGCCAATATCCTAATAATATTCATTAGATGCCACTAACTGTCCACCATCTTGTATTGGTATACTGCAAGTTGGAGGCARw

idx 15 locidx 761
51 G
56 (51, 5, 5, 0)
[ 0  0  0 15]
64 A
69 (64, 5, 5, 0)
[ 0 15  0  0]
70 T
75 (70, 5, 5, 0)
[ 0  0 15  0]
83 A
88 (83, 5, 5, 0)
[ 0 15  0  0]
TATCACCACGTATCTTTCTGAGTATAATCTCTTGCCATGGCCGAATCGAGTGGGTACGGGGAGAAACGCATGATCTTATTAATAGA

idx 15 locidx 762
15 A
20 (15, 5, 5, 0)
[ 0 20  0  0]
21 S
26 (21, 5, 5, 0)
[12  0  0  8]
35 T
40 (35, 5, 5, 0)
[ 0  0 20  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 20]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 20]
59 T
64 (59, 5, 5, 0)
[ 0  0 20  0]
66 A
71 (66, 5, 5, 0)
[ 0 20  0  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 20  0]
75 C
80 (75, 5, 5, 0)
[20  0  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 20  0]
81 A
86 (81, 5, 5, 0)
[ 0 20  0  0]
AGGTCTATTTGATAAATAAAASAACGAGTTGGAGATTTTACTGCATACTAGTGATTTTCTGCGTCAATCTGGGTGCTTATAAAGCG

idx 15 locidx 763
15 C
20 (15, 5, 5, 0)
[18  0  0  0]
44 A
49 (44, 5, 5, 0)
[ 0 18  0  0]
76 C
81 (76, 5, 5, 0)
[18  0  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 18  0  0]
TCCGTTATACGACTTCGGTTCGAGGGCTGATCTCCAAGCAGGAAACATAGTGGAGCGCGAGGTATCATCCAAGGCTCAAGATCGCT

idx 15 locidx 764
2 G
7 (2, 5, 5, 0)
[ 0  0  0 23]
36 T
41 (36, 5, 5, 0)
[ 0  0 23  0]
50 A
55 (50, 5, 5, 0)
[ 0 23  0  0]
GGGTCTATAACCCGTAGAGCGGTTCTCCGCGCTGTCTCAAAAACTTGCGTAGAGCCGGTCCTGATCTGTACGTAGCATTATGAATC

idx 15 locidx 765
13 A
18 (13, 5, 5, 0)
[ 0 20  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 20  0  0]
29 A
34 (29, 5, 5, 0)
[ 0 20  0  0]
37 C
42 (37, 5, 5, 0)
[20  0  0  0]
60 C
65 (60, 5, 5, 0)
[20  0  0  0]
TCAATAACATGTAATCAGCTGATAATAACATAGAATACGGATTCCATCAGCACTTGAGAGCGCCCCGAAGATAGATAGAGCCCCAC

idx 15 locidx 766
1 T
6 (1, 5, 5, 0)
[ 0  0 20  0]
51 C
56 (51, 5, 5, 0)
[20  0  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 20  0]
83 A
88 (83, 5, 5, 0)
[ 0 20  0  0]
GTCGAGTGCAGCGTTGGTTGAAGGCGCTACCCGAGTACAGGTTAATACGTTCTACGGCTTAAGCGTCCTTCCTATGTGTCTTCACA

idx 15 locidx 767
2 A
7 (2, 5, 5, 0)
[ 0 19  0  0]
4 G
9 (4, 5, 5, 0)
[ 0  0  0 19]
5 C
10 (5, 5, 5, 0)
[19  0  0  0]
14 A
19 (14, 5, 5, 0)
[ 0 19  0  0]
49 C
54 (49, 5, 5, 0)
[19  0  0  0]
ACATGCCAAAAACCACAACTAGATACCGTTGAGTAGACCAGCGTGCAATCAGGTCCACGTCAAATAAGACGAAAATAGTCGGTATC

idx 15 locidx 768
57 G
62 (57, 5, 5, 0)
[ 0  0  0 19]
58 C
63 (58, 5, 5, 0)
[19  0  0  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
AAATACCCAGTCGCTTACCCTGTTGAGGTATGCAGGTTAAAAACACAGTGTGGGGGTGCATGACGAGCATATGGGGGGAGGGATAA

idx 15 locidx 769
1 T
6 (1, 5, 5, 0)
[ 0  0 17  0]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 17]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 17]
TTCAATGTGTTCCTTACCCCCGTCTTGTTTCTGTCTTAGGATACTCCATACCTCCCGCGCAATCCGTGTCGCACTGTCACACTGGG

idx 15 locidx 770
32 G
37 (32, 5, 5, 0)
[ 0  0  0 17]
34 T
39 (34, 5, 5, 0)
[ 0  0 17  0]
51 T
56 (51, 5, 5, 0)
[ 0  0 17  0]
60 C
65 (60, 5, 5, 0)
[17  0  0  0]
GCGAGTCGCTGTTGTCCTTAAGCCCGATATAAGATAAGTGTCACGATACTCTTGTATACACGGACTGCTACGTGGACGGAATATCG

idx 15 locidx 771
20 G
25 (20, 5, 5, 0)
[ 0  0  0 23]
85 T
90 (85, 5, 5, 0)
[ 0  0 23  0]
CCGCTTGAACAAACCTTTCTGATTGTTACTCCGGCTCATATTGTGCAAGGAGGGGCTATGTAGCGCTTGTACGGTTTAGGGGTGGT

idx 15 locidx 772
85 T
89 (85, 5, 5, 1)
[ 0  0 20  0]
TTCGGCGGTGACATACAATCACTCCGCGACAGCAGGCAGTGGTGCCAAACCGAATCGGGGATGGCTCGGCGCTAACTACCTGA-GTG

idx 15 locidx 773
7 A
12 (7, 5, 5, 0)
[ 0 21  0  0]
11 C
16 (11, 5, 5, 0)
[21  0  0  0]
50 S
55 (50, 5, 5, 0)
[12  0  0  9]
54 A
59 (54, 5, 5, 0)
[ 0 21  0  0]
66 C
71 (66, 5, 5, 0)
[21  0  0  0]
CCTCACTACTGCTTGACGGACCACAACAGAAACTTTATGGCAGCGCTCGCSAATAGGCGCAGGGCTCAAGATTCGGGTATGGTACC

idx 15 locidx 774
22 C
27 (22, 5, 5, 0)
[23  0  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 23  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 23  0]
63 C
68 (63, 5, 5, 0)
[23  0  0  0]
81 T
86 (81, 5, 5, 0)
[ 0  0 23  0]
AGACCTCTGGCAGAGCCTCTGCCTAGGCGCCACGTCCATTAGTGACGGTTTTACACAGTTTAACGTATCAGGGGACTATGCTATCG

idx 15 locidx 775
55 A
60 (55, 5, 5, 0)
[ 0 21  0  0]
GGCGAACAACGTGCTCCCATTACACGGGATTAGCGGAGAACTTTCAGACCGTCCTATAAAAAGGCTCTTACGCGAATGTCGGATTT

idx 15 locidx 776
27 A
32 (27, 5, 5, 0)
[ 0 18  1  0]
50 G
55 (50, 5, 5, 0)
[ 0  0  0 19]
53 T
58 (53, 5, 5, 0)
[ 0  0 19  0]
CGGAAATCAATTAGCTACTGATCTGACAGTTGCCCCCGTTCGTGTACGTAGTGTTTAGAGGGTGTAACTTATATTACCAGATTGTT

idx 15 locidx 777
11 A
16 (11, 5, 5, 0)
[ 0 18  1  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 19  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 19  0]
TTTCTTCTCACAGTTAATACAGTCCTGTTGTTCAGGTCAGACTATCCGGGGCCGGGCTCACGGGTAAAACATTTCCGCGCACTTTG

idx 15 locidx 778
4 C
9 (4, 5, 5, 0)
[21  0  0  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 21]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 21]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 21]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 21]
64 T
69 (64, 5, 5, 0)
[ 0  0 21  0]
TTGTCGGCGTGGCGAAAGACGGGCCGAGTTTGGATTAACAGAGATCCGGACCATACGCAGAGGGTTGGCGCTCGTCCCATGGTTAT

idx 15 locidx 779
2 T
7 (2, 5, 5, 0)
[ 0  0 23  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 23]
46 A
51 (46, 5, 5, 0)
[ 0 23  0  0]
79 A
84 (79, 5, 5, 0)
[ 0 23  0  0]
GCTTTGGCTCGGCATCTCTACCGGGACCATCAAAGTTGACTCACTTAAGGTTAACCCACGCTCTCCCTAGTGGAGAAGTACTAAAC

idx 15 locidx 780
46 A
51 (46, 5, 5, 0)
[ 0 25  0  0]
49 A
54 (49, 5, 5, 0)
[ 0 25  0  0]
TTCAGTTTGGGTCCACTTTACTCTCTGGGCATTCTGTGACCTCCCAAGGAGCGTCATCGACCCCTTTGCGGGAGCTGCCGTTCCAG

idx 15 locidx 781
6 G
11 (6, 5, 5, 0)
[ 0  0  0 16]
20 T
25 (20, 5, 5, 0)
[ 0  0 16  0]
21 T
26 (21, 5, 5, 0)
[ 0  0 16  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 16]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 16]
83 C
88 (83, 5, 5, 0)
[16  0  0  0]
CACTAGGACCCCCATATAGGTTATAGGGTTGCTATGTATAAGCCGTCGGCAAATTCCGCGAACGCTGTCGCGTCCAGCTTAATCAC

idx 15 locidx 782
10 A
15 (10, 5, 5, 0)
[ 0 21  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 21]
ATCTGATAATATTGCGGATCTTACGCATGTTCACAGTGGACACTCATTTTGAATCAAACACGATATCGTTTGACGAACTACTATAA

idx 15 locidx 783
3 T
8 (3, 5, 5, 0)
[ 0  0 18  0]
30 G
34 (30, 5, 5, 1)
[ 0  0  0 18]
41 A
44 (41, 5, 5, 2)
[ 0 18  0  0]
48 -
51 (48, 5, 5, 2)
[18  0  0  0]
52 G
54 (52, 5, 5, 3)
[ 0  0  0 18]
60 T
62 (60, 5, 5, 3)
[ 0  0 18  0]
CTCTGGAGGTACTTAATGACAGCCCG-GGGGTGC-CTTCGGACAAATT-CAGGTTCGACGTGTGTGGAACCGGAGCTGATAATTTC

idx 15 locidx 784
20 C
25 (20, 5, 5, 0)
[25  0  0  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 25]
50 A
55 (50, 5, 5, 0)
[ 0 25  0  0]
TTTGATCAACATTGTACCTGCAAGTTCTGCCAAGCTACAAGACGGGGACTAGCCAGGATAGACTATTGAGAACTTATATAAGGGTG

idx 15 locidx 785
18 T
23 (18, 5, 5, 0)
[ 0  0 20  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 20  0]
66 A
71 (66, 5, 5, 0)
[ 0 20  0  0]
TGCTATGTTTGTTGACGATGTAATTTATTCCGTAACCACTCCTGTAGGGACTCGATCGAGCAAGATAGCCTCTGCGAGAATTAGAA

idx 15 locidx 786
36 A
41 (36, 5, 5, 0)
[ 0 24  0  0]
44 C
49 (44, 5, 5, 0)
[24  0  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 24  0  0]
65 A
70 (65, 5, 5, 0)
[ 0 24  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 24  0]
TGTACATGGGGCCAACCGGCCAAGCCTGTTCGAATCAGGCCCCTCGCAGGGTGAATTGGTCAAAGATCCCAATTGTTCCTGCGGTA

idx 15 locidx 787
35 T
40 (35, 5, 5, 0)
[ 0  0 21  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 21]
CGTGGCGGGGTCCAGGGTACGCGTATCAGCGTTAATTGGAATTTCAAAGGGGCCCAAGCCGTCCATCACAGCATCTTCCGGGAGTA

idx 15 locidx 788
2 C
7 (2, 5, 5, 0)
[18  0  0  0]
15 S
20 (15, 5, 5, 0)
[10  0  0  8]
21 R
26 (21, 5, 5, 0)
[ 0 10  0  8]
24 G
29 (24, 5, 5, 0)
[ 0  0  0 18]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 18]
33 A
38 (33, 5, 5, 0)
[ 0 18  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 18  0  0]
53 r
58 (53, 5, 5, 0)
[ 0  8  0 10]
GACAAGAGCGAACTASAAGCTRGAGGTGAGGTAACAGCGTTATTCCAGATATCrCCGCAAGCCGAGCAGTAGACGCCTGGCATATC

idx 15 locidx 789
9 G
14 (9, 5, 5, 0)
[ 0  0  0 21]
16 T
21 (16, 5, 5, 0)
[ 0  0 21  0]
41 A
46 (41, 5, 5, 0)
[ 0 21  0  0]
44 T
49 (44, 5, 5, 0)
[ 0  0 21  0]
CCTCGATTTGGCCATCTAGTCCCATGGGATACACGCCTCCTAACTTTAGGGAATGCCTGCACTAGCTGACCCTACTCGGATTGGCG

idx 15 locidx 790
45 G
50 (45, 5, 5, 0)
[ 0  0  0 22]
52 A
57 (52, 5, 5, 0)
[ 0 22  0  0]
58 T
61 (58, 5, 5, 2)
[ 0  0 22  0]
68 G
71 (68, 5, 5, 2)
[ 0  0  0 22]
82 A
84 (82, 5, 5, 3)
[ 0 22  0  0]
ATATTCGTGCTAATATAGTCGTCGCCAGCTCCAACCGATGTTGCTGATCGTAAAGA--TGACTCACGGGTTG-TCAGATATGAGCAGGT

idx 15 locidx 791
35 G
40 (35, 5, 5, 0)
[ 0  0  0 22]
38 C
43 (38, 5, 5, 0)
[22  0  0  0]
43 C
48 (43, 5, 5, 0)
[22  0  0  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 22]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 22]
ATGCATGACCAGAGTTGCACGACTGGTAACCCATCGGACATCACCAATTGAACGTTTCTAGCGAGAGCAAGCTCTCTGTGGACAGT

idx 15 locidx 792
0 G
5 (0, 5, 5, 0)
[ 1  0  0 20]
35 T
40 (35, 5, 5, 0)
[ 0  0 21  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 21  0]
54 A
59 (54, 5, 5, 0)
[ 0 21  0  0]
73 A
78 (73, 5, 5, 0)
[ 0 21  0  0]
80 C
85 (80, 5, 5, 0)
[21  0  0  0]
GATGGGTCTAGGATGACCGTCGTGTACTAGCTAAGTTGTGGTAACTTTGTACTCAAAGAGGGCGACCGCTCACATCGTGTCTACTA

idx 15 locidx 793
0 T
5 (0, 5, 5, 0)
[ 0  0 16  0]
84 C
89 (84, 5, 5, 0)
[16  0  0  0]
TGAATCCAGGTCACTCCCTTCGAGGCGAGCGTTAATGGTGGGCTCTAAGCTGGATCCTATGCCGGCTGTTGGGGCACGCCCATTCG

idx 15 locidx 794
1 A
6 (1, 5, 5, 0)
[ 0 21  0  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 21]
66 T
71 (66, 5, 5, 0)
[ 0  0 21  0]
70 T
75 (70, 5, 5, 0)
[ 0  0 21  0]
82 T
87 (82, 5, 5, 0)
[ 0  0 21  0]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
GAAACGTAATTATCGCTCGCCAGTCTTTATTCCTATATGGCAGGGGCGCAGCTATATGGTAGTACATCCTTTGACATAATTGTACC

idx 15 locidx 795
17 G
22 (17, 5, 5, 0)
[ 0  0  0 22]
18 T
23 (18, 5, 5, 0)
[ 0  0 22  0]
41 C
46 (41, 5, 5, 0)
[22  0  0  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 22  0]
49 C
54 (49, 5, 5, 0)
[22  0  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 22  0  0]
71 Y
76 (71, 5, 5, 0)
[11  0 10  1]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 22]
GGCGAGCGGCCAGGTCTGTTGAAGGACGTAGTTGCAGGGAACACAAGTTCCTTCTATAGCATTACTTCAGCYAAAAGTTGTAAGCT

idx 15 locidx 796
14 A
19 (14, 5, 5, 0)
[ 0 16  0  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 16]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 16]
75 T
80 (75, 5, 5, 0)
[ 0  0 16  0]
TCCGAGCCATCCTCAAACCCCACCCGACCTGTGCGAACGCTCTTAATTCGTGTCAGGGCTCACGCGAACGCAGATTTGAGATTCTG

idx 15 locidx 797
13 C
18 (13, 5, 5, 0)
[23  0  0  0]
24 A
29 (24, 5, 5, 0)
[ 0 23  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 23  0]
75 C
80 (75, 5, 5, 0)
[23  0  0  0]
AACTTGACCAAGCCTGTACTTTATACTCCTGGGGGTAACCTCGTCCTGTAAGCTGAAGCAATGATATCAAACCTGCTAAATTGTAT

idx 15 locidx 798
13 C
18 (13, 5, 5, 0)
[19  0  0  0]
CGCATGTCTTCGTCATTTCCTGCTCATCGATCCTTTACAATGATTCACCGTGTTCTTGTTGTGGCACAATGTGCACTACCCGGCCA

idx 15 locidx 799
25 T
30 (25, 5, 5, 0)
[ 0  0 17  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 17]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 17]
80 T
85 (80, 5, 5, 0)
[ 0  0 17  0]
CTAACTCGACTCGAAGTTCCTGGCATTACGGCCGAAGTACCCCAAGCCCTTCCTTCTTGGATACTATGAGCGGATGTGTGTTGTCG

idx 16 locidx 800
4 C
9 (4, 5, 5, 0)
[23  0  0  0]
6 A
11 (6, 5, 5, 0)
[ 0 23  0  0]
7 A
12 (7, 5, 5, 0)
[ 0 23  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 23  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 23  0]
76 A
81 (76, 5, 5, 0)
[ 0 23  0  0]
CACTCCAATGGTCAGTGTTGTAAGGAGTGAGCAAAATTAGTTCGTGGTTCTTCGGTACGCACTGCGAAATGGACGCATGTGACGGT

idx 16 locidx 801
27 G
32 (27, 5, 5, 0)
[ 0  0  0 21]
34 T
39 (34, 5, 5, 0)
[ 0  0 21  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 21]
79 C
84 (79, 5, 5, 0)
[21  0  0  0]
TAATTCCCGCCCTGCAGTCTACAAGCCGAATCCATGGTAAAGGACGGCTCTCCCGCACTCCGTTATGCGCCTGGTTGATCCAGGGC

idx 16 locidx 802
25 C
30 (25, 5, 5, 0)
[20  0  0  0]
47 C
52 (47, 5, 5, 0)
[20  0  0  0]
54 R
59 (54, 5, 5, 0)
[ 0  8  0 12]
CCCGAATTCTACAGCCGGAAGGACCCTGGGGAGTGCCAGTACATCCCCCAGCTGRTACAATACATTCAATATCATCGGTTATTAAA

NOT HERE
idx 16 locidx 804
51 A
56 (51, 5, 5, 0)
[ 0 18  0  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 18  0]
81 A
86 (81, 5, 5, 0)
[ 0 18  0  0]
GCCGTTGTAGTGGAAATTTAGGGTCTTAGTGTCCAGAAAGCCGTACGGATGACTCCCGGACGCTATCCGGAGTCAGATTCCAACGT

idx 16 locidx 805
9 T
14 (9, 5, 5, 0)
[ 0  0 19  0]
17 G
22 (17, 5, 5, 0)
[ 0  0  0 19]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 19]
42 C
47 (42, 5, 5, 0)
[19  0  0  0]
GACGGCAAATATGACTCGAGAGGCCCATGTTAAGTAAGTACTCGGTCAGATACGCGACAATCCTGCTGGTTCGTGACGCCCGTCCT

idx 16 locidx 806
19 A
24 (19, 5, 5, 0)
[ 0 20  0  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 20  0]
38 C
43 (38, 5, 5, 0)
[20  0  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 20  0]
CTTAGAATCGTTACAGATCAGTTGGCGCGATAGCACGTCACACGTAGTAGGAACCTCGTCAAAATGCACAAATGGGCGGTCGTCTG

idx 16 locidx 807
2 T
7 (2, 5, 5, 0)
[ 0  0 19  0]
23 C
28 (23, 5, 5, 0)
[19  0  0  0]
28 C
33 (28, 5, 5, 0)
[19  0  0  0]
48 C
53 (48, 5, 5, 0)
[19  0  0  0]
52 T
57 (52, 5, 5, 0)
[ 0  0 19  0]
TGTGTGCTGTTGCACTGCGATAACGTAACGCGGCGTGTGGTTTTACGACGCATTGTACCTAGTGGGTGCCCCCGGGCGCGCTTCAG

idx 16 locidx 808
18 G
23 (18, 5, 5, 0)
[ 0  0  0 18]
59 G
64 (59, 5, 5, 0)
[ 0  0  0 18]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 18]
GTGCAGTGCTAGTAGCACGTTCGTCGGGCCCCCGCCGTGACCTGTTGATCAAAGAAGCCGAACGGACGGGAGGGATAGCAGCACCG

NOT HERE
idx 16 locidx 810
24 A
29 (24, 5, 5, 0)
[ 0 20  0  0]
76 A
81 (76, 5, 5, 0)
[ 0 20  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 20  0]
GCCTGTCAGCCTTCTAAACAGGCAACGCGAAAGGGTGAATTACGTGGAGTAGAGGGCCATACTCAGTTGTCGAAGAATACTCTTTG

idx 16 locidx 811
37 Y
42 (37, 5, 5, 0)
[11  0 13  0]
51 A
56 (51, 5, 5, 0)
[ 0 24  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 24  0  0]
TGGAGTACATAAGAGATTTAGGGTTTTGTAGATCTTTYTTCCGAGGAGGGCAGATCCGACGAACGCCTACACCCGCGCTCTATAGG

idx 16 locidx 812
31 C
36 (31, 5, 5, 0)
[19  0  0  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 19  0]
76 A
81 (76, 5, 5, 0)
[ 0 19  0  0]
TACCCGGGGGCTCTTTGTCCCTCACCGAGAGCTATGTCAACAGAATTACTTGGGGCTTCTCCGACGGAGATTGGATATCCATATCA

idx 16 locidx 813
54 T
59 (54, 5, 5, 0)
[ 0  0 21  0]
75 G
80 (75, 5, 5, 0)
[ 0  0  0 21]
CATGGGGACTTGCTTCGGAGGGTGGGTACATTCCGGCTGCTCCGGAGGCCCCTATTCCGCGTCGTGCGGGTGTACGTAGCGACC-TA

idx 16 locidx 814
43 T
48 (43, 5, 5, 0)
[ 0  0 20  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 20  0]
49 A
54 (49, 5, 5, 0)
[ 0 20  0  0]
68 S
73 (68, 5, 5, 0)
[11  0  0  9]
AAAGCAGCACTATTCTATTAGGTCGATGGATGGTTTGCGGACATTGTTTACTTCCTGATATCTTGATGSTTGACTCGGTATATCTT

idx 16 locidx 815
26 A
31 (26, 5, 5, 0)
[ 0 17  0  0]
30 A
35 (30, 5, 5, 0)
[ 0 17  0  0]
CAGCATCATGGCGCGAACAACGTGGGAGTGACGTGGGCAGACGACCTCACTAGCGGAGACTATGGTAGCTCCAGTGAGGATGGCAA

idx 16 locidx 816
11 T
16 (11, 5, 5, 0)
[ 0  0 24  0]
28 C
33 (28, 5, 5, 0)
[24  0  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 24  0]
59 M
64 (59, 5, 5, 0)
[12 12  0  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 24]
81 A
86 (81, 5, 5, 0)
[ 0 24  0  0]
CAGTTAGGCAGTCGTAAGTTCAAGTAGCCGGGCAGGTCAATGCCAGGCATCAATATGTTMAATAGGTTACGCCATCATTAAAAGTC

idx 16 locidx 817
0 A
5 (0, 5, 5, 0)
[ 0 23  0  0]
3 A
8 (3, 5, 5, 0)
[ 0 23  0  0]
26 C
31 (26, 5, 5, 0)
[23  0  0  0]
69 S
74 (69, 5, 5, 0)
[12  0  0 11]
ACCATGAATACCGGTTCGTGCTGTAACGTGCCTGCATGGGATTGCTCACATTTGCTTGCTTGCTCGAAASTGGGTAAAGTTAGCGA

idx 16 locidx 818
82 G
87 (82, 5, 5, 0)
[ 0  0  0 23]
CAGTAAGCGGAACACCCACAATCGAAACAATGAGCCAAGCAATCACGATCACGCGTTGCGACAGCTTGTCTTAATAAATATAGCCC

idx 16 locidx 819
26 A
31 (26, 5, 5, 0)
[ 0 23  0  0]
AACGCCGGCGGTGAAGCCACTCAGGTAACCATCTGCGAGTTATTAACTTTATTCGCCCACGCCGCCTTGCTGGTCCACGTCCGCCC

idx 16 locidx 820
23 G
28 (23, 5, 5, 0)
[ 0  0  0 14]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 14]
51 M
56 (51, 5, 5, 0)
[6 8 0 0]
67 A
72 (67, 5, 5, 0)
[ 0 14  0  0]
73 A
78 (73, 5, 5, 0)
[ 0 14  0  0]
76 C
81 (76, 5, 5, 0)
[14  0  0  0]
79 T
84 (79, 5, 5, 0)
[ 0  0 14  0]
82 C
87 (82, 5, 5, 0)
[14  0  0  0]
AAGCATAGACCTCAGTAGTAAGCGGCTGCTTGGGTACGTTCCTCGTGTCTCMTTCAACTTTCCACTCAAGCACATTCTATAGCTCT

idx 16 locidx 821
20 A
25 (20, 5, 5, 0)
[ 0 21  0  0]
51 C
56 (51, 5, 5, 0)
[21  0  0  0]
GGGTGACGTTCAAAGGCGCGACCACTGATAGTTCCCCCGTCCTCTCTAGCCCGCAGGTGCCAATCTTGGACATACGATTTGAGGGA

idx 16 locidx 822
8 T
13 (8, 5, 5, 0)
[ 0  0 22  0]
25 C
30 (25, 5, 5, 0)
[22  0  0  0]
40 A
45 (40, 5, 5, 0)
[ 0 22  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 22  0]
45 A
50 (45, 5, 5, 0)
[ 0 22  0  0]
58 T
63 (58, 5, 5, 0)
[ 0  0 22  0]
70 C
75 (70, 5, 5, 0)
[22  0  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 22  0]
81 C
86 (81, 5, 5, 0)
[22  0  0  0]
TTGTCAACTGAGGCGCCACTGTTAACTACCTAGCCGCCAAAAATGAGAGGCTTATTAGTCGCCGGGAAGCCTTAGGAGGCTCCCTT

idx 16 locidx 823
13 G
18 (13, 5, 5, 0)
[ 0  0  0 19]
18 C
23 (18, 5, 5, 0)
[19  0  0  0]
61 C
66 (61, 5, 5, 0)
[19  0  0  0]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 19]
80 A
85 (80, 5, 5, 0)
[ 0 19  0  0]
GACTGCGAATGACGGTGGCTAGTACTCGAGGAAGGGTCGCACCGCAGTAAGCTAATCTGACCCTCTGGAGCGCGTACCGTACGAAG

idx 16 locidx 824
30 T
35 (30, 5, 5, 0)
[ 0  0 18  0]
31 C
36 (31, 5, 5, 0)
[18  0  0  0]
32 T
37 (32, 5, 5, 0)
[ 0  0 18  0]
33 A
38 (33, 5, 5, 0)
[ 0 18  0  0]
50 A
55 (50, 5, 5, 0)
[ 0 18  0  0]
80 C
85 (80, 5, 5, 0)
[18  0  0  0]
81 A
86 (81, 5, 5, 0)
[ 0 18  0  0]
82 C
87 (82, 5, 5, 0)
[18  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 18]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 18]
CAAGAGCTCACAACCAGGGGAGTAAAAATTTCTAAGATATTGAGCTAACAATTGTACCAAAGGGGCGTCGATCTTCTCGCCACGGC

idx 16 locidx 825
20 C
25 (20, 5, 5, 0)
[21  0  0  0]
49 C
54 (49, 5, 5, 0)
[21  0  0  0]
53 C
58 (53, 5, 5, 0)
[21  0  0  0]
54 T
59 (54, 5, 5, 0)
[ 0  0 21  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 21  0]
AGGATTGCTACAGAACCAGACTTGGGCATGTAGAAATTTTAATCCCGCACTATCTCCCGACCATAGGCGAAGGATCATTATCTCAA

idx 16 locidx 826
13 C
18 (13, 5, 5, 0)
[23  0  0  0]
18 C
23 (18, 5, 5, 0)
[23  0  0  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 23]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 23]
32 T
37 (32, 5, 5, 0)
[ 0  0 23  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 23]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 23]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 23]
65 T
70 (65, 5, 5, 0)
[ 0  0 23  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 23]
TGCCTCGACTGTGCGCGTCCGCTGAATAAGGGTTGCAGCTCTCGACTAGAAGATAGGTGCTCTCTTCGCGCCAGGATGGAACCAGC

idx 16 locidx 827
3 A
8 (3, 5, 5, 0)
[ 0 17  0  0]
35 G
40 (35, 5, 5, 0)
[ 0  0  0 17]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 17]
63 A
68 (63, 5, 5, 0)
[ 0 17  0  0]
TCCAGATTGAACACTTTACTCAATTCTGGCTAGGGGAGCGGGGTTCCACTCCATGACCCCCTCAATTAGAGTCATTTTGTTTACTC

idx 16 locidx 828
44 T
49 (44, 5, 5, 0)
[ 0  0 22  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 22  0]
69 A
74 (69, 5, 5, 0)
[ 0 22  0  0]
74 T
79 (74, 5, 5, 0)
[ 0  0 22  0]
80 C
85 (80, 5, 5, 0)
[22  0  0  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 22]
CGGCAACGAGCAACTGATTGCAGTACATATGTGGCGTAACAACTTCGCTAGCCGCTGCGTCGAATACGAACGATTTACCTCGCCGG

idx 16 locidx 829
21 A
26 (21, 5, 5, 0)
[ 0 18  0  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 18]
33 T
38 (33, 5, 5, 0)
[ 0  0 18  0]
70 K
75 (70, 5, 5, 0)
[ 0  0  8 10]
74 C
79 (74, 5, 5, 0)
[18  0  0  0]
CCGGCGTTTGATACACACGTCAGAGATTCGAATTTCGGGCGGTGCGAATTTTTCGGTTGCTTGAATCCCCKGTTCAAACTAGTGCC

idx 16 locidx 830
7 C
12 (7, 5, 5, 0)
[22  0  0  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 22]
GCGGCCTCTTAATTGTTTACCAGCTGCTTAGTAGAAATACTATTCACTTAAAACCCTGAACCCCCCCGCGAGAAGGAGGCGTAAGA

idx 16 locidx 831
7 T
12 (7, 5, 5, 0)
[ 0  0 20  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 20]
38 T
43 (38, 5, 5, 0)
[ 0  0 20  0]
43 C
48 (43, 5, 5, 0)
[20  0  0  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 20  0]
75 A
80 (75, 5, 5, 0)
[ 0 20  0  0]
TGACGGATAGGGGCACGCTGCCTTTAACAGGCCCGTCCTGTGACGATACGAACAAGATCAAGACGCGAGATGTTTATATCTTGTAC

idx 16 locidx 832
45 C
50 (45, 5, 5, 0)
[18  0  0  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 18]
60 A
65 (60, 5, 5, 0)
[ 0 18  0  0]
CGCTGCTAGTACCTGATCAACGAACGGGCCTGGGTTTGGTTATGTCAGTCGCAGTGGTTTAGACGTAGGGTTTTTCGAAAAGATCT

idx 16 locidx 833
5 C
10 (5, 5, 5, 0)
[19  0  0  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 19  0]
17 G
22 (17, 5, 5, 0)
[ 0  0  0 19]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 19]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 19]
GGCACCTTTTCTACCATGGGTTCGGGTTCCTGCTCCGCCGTGTGCCATTTGTGAGCCCTGGGCGTGTAGGCGTCTCCGTGCGTACA

idx 16 locidx 834
26 G
31 (26, 5, 5, 0)
[ 0  0  0 22]
38 C
43 (38, 5, 5, 0)
[22  0  0  0]
51 A
56 (51, 5, 5, 0)
[ 0 22  0  0]
79 G
84 (79, 5, 5, 0)
[ 0  0  0 22]
85 A
90 (85, 5, 5, 0)
[ 0 22  0  0]
TATGTACGTGTCGGAGGCACGTGTGTGGGATGGGTCGTCAGGACTAGATGGACCGCAAGCGGGGGAGGGGATTCCCCCCGGTCAGA

idx 16 locidx 835
0 C
5 (0, 5, 5, 0)
[20  0  1  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 21  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 21  0]
77 A
82 (77, 5, 5, 0)
[ 0 21  0  0]
CAAAGCCAGGTTTGCCCGGCTACGTGTGAGTAGAGTGCACCGTGGGTGCACGCTCTGCCCACTAAGCATCCCCCTTAATAGCTACA

idx 16 locidx 836
23 G
28 (23, 5, 5, 0)
[ 0  0  0 22]
31 C
36 (31, 5, 5, 0)
[22  0  0  0]
37 A
42 (37, 5, 5, 0)
[ 0 22  0  0]
45 C
50 (45, 5, 5, 0)
[22  0  0  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 22  0]
CGACGAAGAACCGAACCCAAGCAGCTACGCACTCGGTATGTTTTACACTCGACCTTCATAGTACTGTGCTTCGTAAGGGAAACCCA

NOT HERE
idx 16 locidx 838
4 C
9 (4, 5, 5, 0)
[18  0  0  0]
48 A
53 (48, 5, 5, 0)
[ 0 18  0  0]
52 A
57 (52, 5, 5, 0)
[ 0 18  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 18  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 18]
76 C
81 (76, 5, 5, 0)
[18  0  0  0]
83 C
88 (83, 5, 5, 0)
[18  0  0  0]
GTCACTTTTCACGATACACTATTGTTATTACTGTGAGACACAAAGCTAATTCATCACTTCACGGATACCGCGTCCTCCTATAACGC

idx 16 locidx 839
2 C
7 (2, 5, 5, 0)
[19  0  0  0]
4 T
9 (4, 5, 5, 0)
[ 0  0 19  0]
17 C
22 (17, 5, 5, 0)
[19  0  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 19  0  0]
66 C
71 (66, 5, 5, 0)
[19  0  0  0]
70 A
75 (70, 5, 5, 0)
[ 0 19  0  0]
82 T
87 (82, 5, 5, 0)
[ 0  0 19  0]
GACATCTTCTCTGCGTGCTCGATTAATATTCTCGCCCGCTCGGGCTGCCGCGCACAGCATATGATACTATACAACTCGGGGTTGTT

idx 16 locidx 840
6 G
11 (6, 5, 5, 0)
[ 0  0  0 21]
30 T
35 (30, 5, 5, 0)
[ 0  0 21  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 21]
TCTAACGTAGAAACTTCCGTGCTTTAGCCGTTAGCGCCACTTTGGTCCATGATTCTGATCCCTTACTATAGTGAACGCCTGTGGAT

idx 16 locidx 841
23 G
28 (23, 5, 5, 0)
[ 0  0  0 16]
TCACCTAAACCTGTGCCTTCGTAGGTTCATCTGTTCCACGATGGAGGTTGCGTGCCATCCTCGAGTCCTTAATCGGCTCTTGCCGC

idx 16 locidx 842
2 C
7 (2, 5, 5, 0)
[17  0  0  0]
4 G
9 (4, 5, 5, 0)
[ 0  0  0 17]
10 A
15 (10, 5, 5, 0)
[ 0 17  0  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 17]
39 A
44 (39, 5, 5, 0)
[ 0 17  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 17]
48 A
53 (48, 5, 5, 0)
[ 0 17  0  0]
ATCCGTGACTAACGGTTTAGGTCTGGCATCGCATTTGACACTATCTAGAAAATAGAACCAGTCAGGAGAATCTAGCAAAAAGATCC

idx 16 locidx 843
2 Y
7 (2, 5, 5, 0)
[ 8  0 10  0]
80 A
85 (80, 5, 5, 0)
[ 0 18  0  0]
ATYTCCGCCGAATTGACCCCGATTGGCGTCAAGGGAATAGATATGAGGAACTGAGCCAATCCACACCGTGTGTAAGCTAAACTTTT

idx 16 locidx 844
11 C
16 (11, 5, 5, 0)
[22  0  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 22]
53 G
58 (53, 5, 5, 0)
[ 0  0  0 22]
CATCTCATTACCTCAGGTGTTGACGGCGCCAGGTCACAATCTTGAGGCAAGGGGAGTGGGCATCCCACAACCGAGTGTACTTGGAT

idx 16 locidx 845
3 C
8 (3, 5, 5, 0)
[22  0  0  0]
72 M
77 (72, 5, 5, 0)
[11 11  0  0]
79 C
84 (79, 5, 5, 0)
[22  0  0  0]
GTGCCGTCAGGCTCCGGTGCAGCAGGTGCGTGATTACACTGGAAGCTACACTGAAGTGAAGTGCGGGACGAGMATCGCGCAGCAAA

idx 16 locidx 846
0 T
5 (0, 5, 5, 0)
[ 1  0 20  0]
33 M
38 (33, 5, 5, 0)
[10 11  0  0]
43 T
48 (43, 5, 5, 0)
[ 0  0 21  0]
TTGCCAGAAAGAAGGGCTGACGACTCCATTATAMTCACCCTCTTACCATTACCTGTCGATAGGTGTAAGCTAGAGGGCCTCGGGAG

idx 16 locidx 847
20 C
25 (20, 5, 5, 0)
[18  0  0  0]
23 T
28 (23, 5, 5, 0)
[ 0  0 18  0]
32 C
37 (32, 5, 5, 0)
[18  0  0  0]
61 A
66 (61, 5, 5, 0)
[ 0 18  0  0]
63 C
68 (63, 5, 5, 0)
[18  0  0  0]
68 A
73 (68, 5, 5, 0)
[ 0 18  0  0]
81 A
86 (81, 5, 5, 0)
[ 0 18  0  0]
AGAAATCTACAGAAGCTGTGCCGTGGACCTGCCGAGGTTTCCCAATCTCACTAAAGGGGGGAGCCTTTAGGCCTATAAATTAGGTT

idx 16 locidx 848
14 G
19 (14, 5, 5, 0)
[ 0  0  0 15]
26 T
31 (26, 5, 5, 0)
[ 0  0 15  0]
50 A
55 (50, 5, 5, 0)
[ 0 15  0  0]
67 T
72 (67, 5, 5, 0)
[ 0  0 15  0]
GATACTGCCTAATTGCCCTACTCAGATACCGCATATGTTTTCTCGGTACAACATGTTCGTTTGCTTATGACGCTATGTACTAACAG

idx 16 locidx 849
12 A
17 (12, 5, 5, 0)
[ 0 18  0  0]
13 A
18 (13, 5, 5, 0)
[ 0 18  0  0]
15 A
20 (15, 5, 5, 0)
[ 0 18  0  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 18  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 18]
20 A
25 (20, 5, 5, 0)
[ 0 18  0  0]
29 C
34 (29, 5, 5, 0)
[18  0  0  0]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 18]
62 A
67 (62, 5, 5, 0)
[ 0 18  0  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 18]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 18]
85 A
90 (85, 5, 5, 0)
[ 0 18  0  0]
TTCCATGATAGTAAAAGTTGACATGGAGCCTTGGAGATGTTACTCACACGGGTTACTATCGGATTGGCGTATTAAGGACTGAGCAA

idx 17 locidx 850
6 T
11 (6, 5, 5, 0)
[ 0  0 17  0]
8 T
13 (8, 5, 5, 0)
[ 0  0 17  0]
11 A
16 (11, 5, 5, 0)
[ 0 17  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 17  0]
55 A
60 (55, 5, 5, 0)
[ 0 17  0  0]
65 A
70 (65, 5, 5, 0)
[ 0 17  0  0]
77 C
82 (77, 5, 5, 0)
[17  0  0  0]
TAAAGCTCTCTACATAGTAATTCGAACGCGACGGTCTTCGGCAGCTCGCGGTCCGATCCCCACTTAGGCCGAATCGCCATCCGTTT

idx 17 locidx 851
44 C
49 (44, 5, 5, 0)
[18  0  0  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 18  0]
50 T
55 (50, 5, 5, 0)
[ 0  0 18  0]
CCAGAGACTACCACTCTGATTCAGTTTATGATGTACTCGACCCTCTCTCTTTTTTTAGATGTGGTAAGATTTTATAAAAGTTAACT

idx 17 locidx 852
18 G
23 (18, 5, 5, 0)
[ 0  0  0 25]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 25]
65 T
70 (65, 5, 5, 0)
[ 0  0 25  0]
GGGAGCCGGGGGCACGACGCGGATCTCCGTACAGTAGATCACGATCTCTACGAAATATGAAGAACTTGAGACCTAACCAACCCATT

idx 17 locidx 853
11 C
16 (11, 5, 5, 0)
[22  0  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 22  0  0]
74 G
79 (74, 5, 5, 0)
[ 1  0  0 21]
GTGCTCTAGCACGAGGACATCCGAAGTTTCGATTAGCGTTGATGTCTAAACCTGGAACAACGCAAGTTGGTGTGGCTTCGAACCAG

idx 17 locidx 854
21 C
26 (21, 5, 5, 0)
[17  0  0  0]
ATAGGAGACGAATTAAATCTACATCAATCATTAGGCGTGGGATTGCTTCAAAGTCTGTTCCGGGAGCTGCCAGGCCCCAGTGCTAG

idx 17 locidx 855
18 G
23 (18, 5, 5, 0)
[ 0  1  0 19]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 20]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 20]
64 A
69 (64, 5, 5, 0)
[ 0 20  0  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 20]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 20]
GGGAGACGCTGGCCATCGGCCGCGCTGCCGAGGAACTTCTACATTGTCCGCTTCCCAAAAATATAGGCGATTACCCAGTTAGTGGG

idx 17 locidx 856
25 T
30 (25, 5, 5, 0)
[ 0  0 13  0]
27 G
32 (27, 5, 5, 0)
[ 0  0  0 13]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 13]
72 C
77 (72, 5, 5, 0)
[13  0  0  0]
TGGTTCATCACAAATCGATGCCCGGTCGTCGCCCTTGTCGCTAATGGAGCGCGACAATTCTAGCAGGGTTCGCCTTATTCACGCCA

idx 17 locidx 857
72 T
77 (72, 5, 5, 0)
[ 0  0 19  0]
80 A
85 (80, 5, 5, 0)
[ 0 19  0  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 19]
ACCCTAGACGGAAATTGTAGTTTCATGACGCAACGCCGTCTCTCACCTCCAAGGCTATGAAGTCGCTTCAAGTGGCAGTGACACGA

idx 17 locidx 858
14 T
19 (14, 5, 5, 0)
[ 0  0 23  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 23]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 23]
40 M
45 (40, 5, 5, 0)
[10 13  0  0]
CTGCTACAGATAGGTTTCAGCATTTAAGGAAGTGGTGTGGMGCTCCCACATTTTCTGTGCAACACGAATTGTAAGTCGGCTAGCTC

NOT HERE
idx 17 locidx 860
0 A
5 (0, 5, 5, 0)
[ 0 17  0  0]
1 C
6 (1, 5, 5, 0)
[17  0  0  0]
24 R
29 (24, 5, 5, 0)
[0 9 0 8]
34 A
39 (34, 5, 5, 0)
[ 0 17  0  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 17]
85 C
90 (85, 5, 5, 0)
[17  0  0  0]
ACCGCCGGGACAAGCTTTCGTTAARGGTGGCCACATGACCAGGTTAAGGTTGGCTTGTTTAGTTAACCTTTGCAACCGGCGTAAAC

idx 17 locidx 861
16 G
21 (16, 5, 5, 0)
[ 0  0  0 17]
33 G
38 (33, 5, 5, 0)
[ 0  0  0 17]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 17]
39 A
44 (39, 5, 5, 0)
[ 0 17  0  0]
42 C
47 (42, 5, 5, 0)
[17  0  0  0]
49 T
54 (49, 5, 5, 0)
[ 0  0 17  0]
AAGGTGACGTGCCATAGAGAGACGTGCACAGTGGGGAGAAGTCTCACTATGGCAGAGGGATGGAGAAAGCCCGAGGGGTAGGTCTA

idx 17 locidx 862
30 T
35 (30, 5, 5, 0)
[ 0  0 20  0]
40 A
45 (40, 5, 5, 0)
[ 1 19  0  0]
55 A
60 (55, 5, 5, 0)
[ 0 20  0  0]
GCGCAGCCGCGTAGAAACCGACACAACGGATCCTTCAAGCAACGAAGCGACGGCCAGATTCTTAGTTCGCGATAATCTCAGTCAAT

idx 17 locidx 863
20 G
25 (20, 5, 5, 0)
[ 0  0  0 23]
24 T
29 (24, 5, 5, 0)
[ 0  0 23  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 23]
76 C
81 (76, 5, 5, 0)
[23  0  0  0]
GATAGGCTTACGCTTGACACGAAATGATGTGGTTATCTCGGAGTCCAGACCGCCTGATAACCTAGGCAATGCATCTCGCATGTAGA

idx 17 locidx 864
1 A
6 (1, 5, 5, 0)
[ 0 25  0  0]
7 T
12 (7, 5, 5, 0)
[ 0  0 25  0]
40 G
45 (40, 5, 5, 0)
[ 0  0  0 25]
82 T
87 (82, 5, 5, 0)
[ 0  0 25  0]
TATCCAATCCCGTTTTTACGCAGCGCGCCAGACCTTTGGTGGTCCTCCGTAGATAGCGGACCGGAAGGAATAAAGGCTACGTTGCA

idx 17 locidx 865
27 G
32 (27, 5, 5, 0)
[ 0  0  0 18]
29 C
34 (29, 5, 5, 0)
[18  0  0  0]
45 W
50 (45, 5, 5, 0)
[0 9 9 0]
53 T
58 (53, 5, 5, 0)
[ 0  0 17  1]
60 Y
65 (60, 5, 5, 0)
[9 0 9 0]
61 T
66 (61, 5, 5, 0)
[ 0  0 18  0]
77 A
82 (77, 5, 5, 0)
[ 0 18  0  0]
85 T
90 (85, 5, 5, 0)
[ 0  0 18  0]
CCGGACACACGGTACGTCGAGGCGCCAGCCAAGTGCTGAGTATCGWTGCGCCGTTATCTAYTATGGGCACCCGTCAAATCGTTGTT

idx 17 locidx 866
18 A
23 (18, 5, 5, 0)
[ 0 21  0  0]
21 G
26 (21, 5, 5, 0)
[ 0  0  0 21]
28 T
33 (28, 5, 5, 0)
[ 0  0 21  0]
29 T
34 (29, 5, 5, 0)
[ 0  0 21  0]
38 G
43 (38, 5, 5, 0)
[ 0  0  0 21]
52 T
57 (52, 5, 5, 0)
[ 0  0 21  0]
59 A
64 (59, 5, 5, 0)
[ 0 21  0  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 21]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 21]
TTTGGATAATCGCATGAAAATGTCGGCCTTCCATTTTGGGGCTCATCGATCTTCAAATGACGGAGGCTTCGACCAGACAAGCTGAG

idx 17 locidx 867
35 A
40 (35, 5, 5, 0)
[ 0 18  0  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 18]
TGTGTATTAGCATTGGCCACCGCATGTCCTCGCACAGGGTCCCGGAGAAGCGGTCGTGATGTATGCGTACAGACGTACTCCAATTC

idx 17 locidx 868
25 T
30 (25, 5, 5, 0)
[ 0  0 21  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 21  0]
57 C
62 (57, 5, 5, 0)
[21  0  0  0]
71 C
76 (71, 5, 5, 0)
[21  0  0  0]
ATTTGAGAGATCTCTTTACGCGCTCTGCAAATGTTTCTCTGCTAGTTAAAGGAACGCCGTAGTCGATATTCCCGTGCCCACGTTCG

idx 17 locidx 869
58 A
63 (58, 5, 5, 0)
[ 0 22  0  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 22]
GATAGGTAATCATTTGCAAGGGGCCGTCGCTGACCCTTATATGAACAATCCAGTCTATAGCGGCCACTGACCGCCGTAACAAGCAT

idx 17 locidx 870
6 G
11 (6, 5, 5, 0)
[ 0  0  0 24]
19 A
24 (19, 5, 5, 0)
[ 0 24  0  0]
24 C
29 (24, 5, 5, 0)
[24  0  0  0]
46 A
51 (46, 5, 5, 0)
[ 0 24  0  0]
70 C
75 (70, 5, 5, 0)
[24  0  0  0]
CGTGGCGTCATTCTAGGTAAAACTCCTGCTGGATACCCGTTAGCCGAGCGCACCTTTTAGGTTACGCACGCTGTCTAACGGACATA

idx 17 locidx 871
27 C
32 (27, 5, 5, 0)
[22  0  0  0]
ATTATGGCCACAGATTCATCAAAGACGCCTTGGCACTTGGATGACCGGGCCCGGCTCGCCGTGTGATGCGGTGCATTGCCCTGCCT

idx 17 locidx 872
11 A
16 (11, 5, 5, 0)
[ 0 20  0  0]
30 T
35 (30, 5, 5, 0)
[ 0  0 20  0]
38 G
43 (38, 5, 5, 0)
[ 0  0  0 20]
54 T
59 (54, 5, 5, 0)
[ 0  0 20  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 20]
CTCACCCATTGAAGAGGTTTAGCAACGGCATTGTACGCGCATACGGTGACGTAATTCAGAGTTAATTCCGCGTGCGACTCCTAGCT

idx 17 locidx 873
4 C
9 (4, 5, 5, 0)
[19  0  0  0]
TAGTCATAACGATAACCGGACATAACCTCTAGCGACAATTGAGTTGACACATGTGTCCCCTTAGAGAGTTAACGCATAGCGGCCGC

idx 17 locidx 874
2 G
7 (2, 5, 5, 0)
[ 0  0  0 22]
12 A
17 (12, 5, 5, 0)
[ 0 22  0  0]
16 G
21 (16, 5, 5, 0)
[ 0  0  0 22]
40 A
45 (40, 5, 5, 0)
[ 0 22  0  0]
80 C
85 (80, 5, 5, 0)
[22  0  0  0]
CCGAACCAGACCATAAGTTGATCCTAAGGGTAACACCTTGATTGGAATGTGAGTACCACTTTAGGTTCTAGGACGTGGTGCTGGCG

idx 17 locidx 875
36 C
41 (36, 5, 5, 0)
[20  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 20  0]
84 A
89 (84, 5, 5, 0)
[ 0 20  0  0]
85 C
90 (85, 5, 5, 0)
[20  0  0  0]
ACTCACGGCTAGGGTTCCCACGTGATAATAGCTCCGCCCCCTAGCCTCAGCAGTTTGACGGACCTTTAACCAGCTGTCCAAAGTAC

idx 17 locidx 876
14 G
19 (14, 5, 5, 0)
[ 0  0  0 20]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
53 T
58 (53, 5, 5, 0)
[ 0  0 20  0]
65 A
70 (65, 5, 5, 0)
[ 0 20  0  0]
CTCTAGCAATCTAAGGAGGCTCGTGTTCTGCCCCGGCGATTGTCTTTTGTCCGTTGTACCCCCCTAAATCGACGTTGAAATAGAAA

NOT HERE
idx 17 locidx 878
73 C
78 (73, 5, 5, 0)
[20  0  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 20  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 20]
TCATGAGCCCTCGAGTTACTCTGTAGAAAAAAAGCCTAACCGACTTTAGTACCCGATCTCTCGCCATACCTGACATGTCCCTTCTG

idx 17 locidx 879
2 A
7 (2, 5, 5, 0)
[ 0 19  0  0]
30 C
35 (30, 5, 5, 0)
[19  0  0  0]
65 T
70 (65, 5, 5, 0)
[ 0  0 19  0]
GAAGGGGGGACGCCGTAGGGCTAACCAACGCTTTTTAAGCGCCTCAAGATTAATAAACCACATCTTCTGAGTGTTTAAGCCGACGA

idx 17 locidx 880
30 A
35 (30, 5, 5, 0)
[ 0 19  0  0]
CTGCCAGTCAGTCCCGAATAGAGCGAAAGTAAAGAGCGTGATGCTCCCGCATCCGTGCCGGATCCTCTCACGACAATGTGGTCGCC

idx 17 locidx 881
9 C
14 (9, 5, 5, 0)
[19  0  0  0]
36 A
41 (36, 5, 5, 0)
[ 0 19  0  0]
53 C
58 (53, 5, 5, 0)
[19  0  0  0]
76 C
81 (76, 5, 5, 0)
[19  0  0  0]
ATCCGACGCCAGGGACCCCAATTGTCGCAGGAGATGACTCGGTAAATTTCTCTCTTCTACAAGGTGGTGCCTTCAGCATCTAGCCC

idx 17 locidx 882
25 A
30 (25, 5, 5, 0)
[ 0 17  0  0]
26 T
31 (26, 5, 5, 0)
[ 0  0 17  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 17]
71 T
76 (71, 5, 5, 0)
[ 0  0 17  0]
ACATGACAAGCGACGTTACTGCCCCATGTTGGTAGGCCAATACGGGCCATTGAACCACGTTGTTTCCGCAATCTCGGCGGCCACAT

idx 17 locidx 883
1 C
6 (1, 5, 5, 0)
[21  0  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 21  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 21]
46 C
51 (46, 5, 5, 0)
[21  0  0  0]
CCCTGTTGTAAATTGCCCGAATACAACCAACAGGATAGGGACTGAGCTCAACAGCGGCATGAGGTCTGCTACCAAATTCCTTACGA

idx 17 locidx 884
33 C
38 (33, 5, 5, 0)
[20  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 20]
AAACAGTAGCGGCCCATCTTTTTAAACTTTTACCAAGTCTGTGCAGCCGACCGATCTGAAGAGGTTTACACCGATATGAGGATGGG

idx 17 locidx 885
28 Y
33 (28, 5, 5, 0)
[11  0 10  0]
36 C
41 (36, 5, 5, 0)
[21  0  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 21  0]
63 A
68 (63, 5, 5, 0)
[ 0 21  0  0]
75 A
80 (75, 5, 5, 0)
[ 0 21  0  0]
TCGCATTCCGTCAAGGCATATGTGCGCAYGCTGGCGCGGTAATTATTCTTACCGTTCCTACCTACTATTACTCAAACTGCCCCTAC

idx 17 locidx 886
39 G
44 (39, 5, 5, 0)
[ 0  0  0 23]
40 A
45 (40, 5, 5, 0)
[ 0 23  0  0]
ACGCTTGATTAGTCTTCTACGCTTGTTAGGTTACTCGCAGAATTCTTTAGTCTTGGATGGTGAATGTATATCGGAAATGGTCGAGG

idx 17 locidx 887
33 C
38 (33, 5, 5, 0)
[23  0  0  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 23]
57 A
62 (57, 5, 5, 0)
[ 0 23  0  0]
58 A
63 (58, 5, 5, 0)
[ 0 23  0  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 23  0]
67 A
72 (67, 5, 5, 0)
[ 0 23  0  0]
CCTGCTCTTAGGATAGGTCCACACATGGCCCATCGAATACGCCCGGCTCCATGATGGAAAATTAAGGATATGTTAAATGGAAATTG

idx 17 locidx 888
24 T
29 (24, 5, 5, 0)
[ 0  0 23  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 23]
34 T
39 (34, 5, 5, 0)
[ 0  0 23  0]
41 A
46 (41, 5, 5, 0)
[ 0 23  0  0]
47 A
52 (47, 5, 5, 0)
[ 0 23  0  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 23  0]
76 A
81 (76, 5, 5, 0)
[ 0 23  0  0]
82 C
87 (82, 5, 5, 0)
[23  0  0  0]
CGGGGTCCTTAGAGTCGTTCCTAGTTGGCCTCACTCCGGACAAACGGAGGCTCGTTTACTTTTAGTGCAATCTGTCATAACGCTGC

idx 17 locidx 889
4 T
9 (4, 5, 5, 0)
[ 0  0 23  0]
7 G
12 (7, 5, 5, 0)
[ 0  0  0 23]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 23]
32 C
37 (32, 5, 5, 0)
[23  0  0  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 23  0]
50 A
55 (50, 5, 5, 0)
[ 0 23  0  0]
AGCATGCGACGAGAGCCCCGGGAGATATCTGCCCTAAGTCTTCACACCCTAGGGGTACCGCGTCGCATTTGGTGCTATGCGCACAT

idx 17 locidx 890
26 A
31 (26, 5, 5, 0)
[ 0 21  0  0]
28 A
33 (28, 5, 5, 0)
[ 0 21  0  0]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 21]
44 A
49 (44, 5, 5, 0)
[ 0 21  0  0]
53 A
58 (53, 5, 5, 0)
[ 0 21  0  0]
57 T
62 (57, 5, 5, 0)
[ 0  0 21  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 21]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 21]
84 C
89 (84, 5, 5, 0)
[21  0  0  0]
85 G
90 (85, 5, 5, 0)
[ 0  0  0 21]
ACCGTTTCTCCGTGAATAGCAGTGTGATAACGGCTACGGATAGAATGTCGTGAACCATCACACTGCGGCCCGTCGAGGTCGGCTCG

idx 17 locidx 891
18 T
23 (18, 5, 5, 0)
[ 0  0 23  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 23]
40 A
45 (40, 5, 5, 0)
[ 0 23  0  0]
51 C
56 (51, 5, 5, 0)
[23  0  0  0]
66 T
71 (66, 5, 5, 0)
[ 0  0 23  0]
TACGTTGCTTAATGAGCTTCGGTGGGGCTTACATCAGTTCATGACTAACCCCTTATGATGTGGAACTACGAACCACGATCGACCTT

idx 17 locidx 892
19 G
24 (19, 5, 5, 0)
[ 0  0  0 19]
22 T
27 (22, 5, 5, 0)
[ 0  0 19  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 19  0]
85 C
90 (85, 5, 5, 0)
[19  0  0  0]
ACGCGATAGCCGGTAATAAGGGTCAACGCACTAGACTCATGATCTACGACGATGACATTCTTCTTAGTATCCCTTGGGACGACGCC

idx 17 locidx 893
36 T
41 (36, 5, 5, 0)
[ 0  0 19  0]
TTGGAGCAGCTACGGATAGACAAAGTTATCCCAACGTTACCTGGGATGTGGTACCTGGATTATGAACTCTGAATATGCGCCCGCTG

idx 17 locidx 894
25 Y
30 (25, 5, 5, 0)
[6 0 9 0]
63 T
68 (63, 5, 5, 0)
[ 0  0 15  0]
CGTTACTACTTTAGGCAACTACCATYCGGTATTAACACAGCCGTGCCGTCATCTTAACATAAGTATCATCGTAGTAGCAAGGTCAA

idx 17 locidx 895
10 G
15 (10, 5, 5, 0)
[ 0  0  0 18]
26 C
31 (26, 5, 5, 0)
[17  0  0  1]
41 A
46 (41, 5, 5, 0)
[ 0 17  0  1]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 18]
CTTTTGCGAGGGCCCGGGGCCTCCCGCGATTAATTATGCGAACATTACAAACGGTAGCCTGAAACAGCTTGCATCTCATGGTCGTG

idx 17 locidx 896
11 C
16 (11, 5, 5, 0)
[19  0  0  0]
35 C
40 (35, 5, 5, 0)
[19  0  0  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 19  0]
ATCGATGGCATCCTCTTTAACTAGGTAGTGCGAATCCCTCAAATTGGCAATCCGGTTCAGTTTTATGTCGTGAACTCTTAATAAGG

idx 17 locidx 897
0 T
5 (0, 5, 5, 0)
[ 0  0 20  0]
47 A
52 (47, 5, 5, 0)
[ 0 20  0  0]
TCTCAGTCGGTCCAGGATCTCATTTAGTTCACTCTTCTTTGGTCGTAAACTGATCATCAGGGCTTTGCCATAGATTTCCACATCGC

idx 17 locidx 898
30 T
35 (30, 5, 5, 0)
[ 0  0 12  0]
34 T
39 (34, 5, 5, 0)
[ 0  0 12  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 12  0]
TTTTAGCGGGAGGAACTTGTATCTTTTTGGTCGCTTTACTTCGCACCGAGCGGTATATGAGTTATACCAGTCCTGCTATGAGCTGT

idx 17 locidx 899
6 T
11 (6, 5, 5, 0)
[ 0  0 23  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 23  0]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 23]
TTTGTCTACACGCACACGCACGATCGGCTCACGTGGCACCGCATGCTAGTTACTTGGACCGAGTGATACTGGGCCATCCTCCCGTT

idx 18 locidx 900
25 T
30 (25, 5, 5, 0)
[ 0  0 16  0]
28 T
33 (28, 5, 5, 0)
[ 0  0 16  0]
44 A
49 (44, 5, 5, 0)
[ 0 16  0  0]
54 C
59 (54, 5, 5, 0)
[16  0  0  0]
69 C
74 (69, 5, 5, 0)
[16  0  0  0]
AGGAGGATTTACACCCGTTTACGCCTAGTGTGTCTATTTGCTATATGGACAGGCCGCTCTGAGCTAAGCCTCGTTAAGGTCCGGTA

idx 18 locidx 901
9 G
14 (9, 5, 5, 0)
[ 0  0  0 20]
17 A
22 (17, 5, 5, 0)
[ 0 20  0  0]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 20]
41 T
46 (41, 5, 5, 0)
[ 0  0 20  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 20]
86 A
90 (86, 5, 5, 1)
[ 0 20  0  0]
AAGAGAAAGGCTTCCCTACACGTACAAGATCGGAAGCCTCTTGAGAGTTAGCTGCCCCAAGTTAGTGGCCGGCTCAGTTAGGGC-CA

idx 18 locidx 902
26 T
31 (26, 5, 5, 0)
[ 0  0 20  0]
46 A
51 (46, 5, 5, 0)
[ 0 20  0  0]
51 C
56 (51, 5, 5, 0)
[20  0  0  0]
62 G
67 (62, 5, 5, 0)
[ 0  0  0 20]
GCCATACTGCCTCTTAATGTTATCCGTTCGCTGTATTGTGGGAGTTACATCCCGGTCGTGTAGACCCTGCGGCTAAAAACAACCAG

idx 18 locidx 903
3 T
8 (3, 5, 5, 0)
[ 0  0 23  0]
45 T
50 (45, 5, 5, 0)
[ 0  0 23  0]
63 T
68 (63, 5, 5, 0)
[ 0  0 23  0]
69 G
74 (69, 5, 5, 0)
[ 0  0  0 23]
71 A
76 (71, 5, 5, 0)
[ 0 23  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 23  0  0]
83 C
88 (83, 5, 5, 0)
[23  0  0  0]
ATTTAGGGAAGTATGAATAAATAAGTACAAGGACGATGCTCCCACTCTGTCATACTTGTGTTCTCGTCTGGAGACGTCCAACCCAC

idx 18 locidx 904
3 A
8 (3, 5, 5, 0)
[ 0 23  0  0]
9 C
14 (9, 5, 5, 0)
[23  0  0  0]
10 T
15 (10, 5, 5, 0)
[ 0  0 23  0]
20 A
25 (20, 5, 5, 0)
[ 0 23  0  0]
50 C
55 (50, 5, 5, 0)
[23  0  0  0]
54 A
59 (54, 5, 5, 0)
[ 0 23  0  0]
85 A
90 (85, 5, 5, 0)
[ 0 23  0  0]
GGCAACAACCTACGTGGGCTATATCCAGCATCTAAAACGTCCGGCGGAGTCTCAATTGTGGCGGAGCTACCTTCTGGCGTGGCCGA

idx 18 locidx 905
13 A
18 (13, 5, 5, 0)
[ 0 23  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 23  0  0]
49 C
54 (49, 5, 5, 0)
[23  0  0  0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 23]
73 C
78 (73, 5, 5, 0)
[23  0  0  0]
83 C
88 (83, 5, 5, 0)
[23  0  0  0]
84 T
89 (84, 5, 5, 0)
[ 0  0 22  1]
85 T
90 (85, 5, 5, 0)
[ 0  0 23  0]
ACCTCAAGTTCTTACCTGATAACTAGGCTGTACCCTACCGGACCGAATCCAGTATTTTAGAGTGACATGTCCTCCTCTCACTCCTT

idx 18 locidx 906
14 C
19 (14, 5, 5, 0)
[16  0  0  0]
20 C
25 (20, 5, 5, 0)
[16  0  0  0]
29 T
34 (29, 5, 5, 0)
[ 0  0 16  0]
71 G
76 (71, 5, 5, 0)
[ 0  0  0 16]
78 G
83 (78, 5, 5, 0)
[ 0  0  0 16]
GAAAATCGGTTGAACGACCTCTGCTCAAATGCGCTATGCAGGTTTCCGTACCACGTTTTGTACCGAGACCAGGAACTGGATTTATC

idx 18 locidx 907
26 C
31 (26, 5, 5, 0)
[17  1  0  0]
GTCTACTAGTCGATGACTAATATACTCACGACCTACTACTCCTAGGCGGGAAAAGGCTCCTCGGGGTCCTCAAAGCAGGATAATGC

idx 18 locidx 908
33 T
38 (33, 5, 5, 0)
[ 0  0 17  0]
34 C
39 (34, 5, 5, 0)
[17  0  0  0]
48 A
53 (48, 5, 5, 0)
[ 0 17  0  0]
58 G
63 (58, 5, 5, 0)
[ 0  0  0 17]
64 T
69 (64, 5, 5, 0)
[ 0  0 17  0]
78 A
83 (78, 5, 5, 0)
[ 0 17  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 17]
84 A
89 (84, 5, 5, 0)
[ 0 17  0  0]
ATCTTTGTCGTATCAGATCCTTCATTTTTCTACTCAACCGGTCGGGAAATCGAGAGACGTTGCATAGTAGTAGCGTACAAAGAGAC

NOT HERE
idx 18 locidx 910
3 G
8 (3, 5, 5, 0)
[ 0  0  0 16]
30 T
35 (30, 5, 5, 0)
[ 0  0 16  0]
47 C
52 (47, 5, 5, 0)
[16  0  0  0]
52 G
57 (52, 5, 5, 0)
[ 0  0  0 16]
TCTGCAGCCTGAACTATTGTTTTCTGTTTGTAGACGCACCGTCCTACCGAATGAAGGCTGTACAATCCCGTTGAGCGACTGGATAA

idx 18 locidx 911
20 C
25 (20, 5, 5, 0)
[19  0  0  0]
25 G
30 (25, 5, 5, 0)
[ 0  0  0 19]
59 T
64 (59, 5, 5, 0)
[ 0  0 19  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 19]
GTCACATAAGGCCGACTTGTCATGAGTTAAGGCTCAGGACAATAGGACGAAAGTCAGTCTACATGCGGGATAGAAACTGTCGCCTA

idx 18 locidx 912
24 C
29 (24, 5, 5, 0)
[20  0  0  0]
51 S
56 (51, 5, 5, 0)
[ 7  0  0 13]
66 A
71 (66, 5, 5, 0)
[ 0 19  1  0]
77 C
82 (77, 5, 5, 0)
[20  0  0  0]
TGGTTGTGAATTTTGTGGCGTATTCAAACACACGTACTGGATTTTCGGTTASAGGCGTGAGTGCCGATCCCCCGGGGCTAGATGAG

idx 18 locidx 913
48 C
53 (48, 5, 5, 0)
[21  0  0  0]
66 G
71 (66, 5, 5, 0)
[ 0  0  0 21]
69 C
74 (69, 5, 5, 0)
[21  0  0  0]
78 C
83 (78, 5, 5, 0)
[21  0  0  0]
82 A
87 (82, 5, 5, 0)
[ 0 21  0  0]
CTCCTCTATGCGCGCTCATGACGGACTCGTCCGCCATATGTAAGGGCACCATTCAAACCCACTGTAGGTCTAGCATGTCGTGATAC

idx 18 locidx 914
22 A
27 (22, 5, 5, 0)
[ 0 14  0  0]
37 C
42 (37, 5, 5, 0)
[14  0  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 14  0  0]
CAGCCACACTATCGATCGTTACATATACGTTGCAACACGATAGCAACCTTTGTGTAGGATTTGCCGCCTTAGATCTACTGCCAGTG

idx 18 locidx 915
7 T
12 (7, 5, 5, 0)
[ 0  0 19  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 19  0]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 19]
65 T
70 (65, 5, 5, 0)
[ 0  0 19  0]
GTAGGGCTGGTCTGTATTTCGACGTGGGAATCGTTAGCGCAACCTTGAAGGCCTTTCGCATTTCCTACGCTAAGGCATCACTTGGG

idx 18 locidx 916
6 T
11 (6, 5, 5, 0)
[ 0  0 19  0]
8 G
13 (8, 5, 5, 0)
[ 0  0  0 19]
16 C
21 (16, 5, 5, 0)
[19  0  0  0]
CCGCAATCGGTAGTGCCCGTAAATGCTGCAGGCTCTGAAACGACCGCAGCCAATATCGGCCGCGCAGCTTTAGCAACCGCATGGGA

idx 18 locidx 917
30 A
35 (30, 5, 5, 0)
[ 0 18  0  0]
43 C
48 (43, 5, 5, 0)
[18  0  0  0]
54 T
59 (54, 5, 5, 0)
[ 0  0 18  0]
61 T
66 (61, 5, 5, 0)
[ 0  0 18  0]
CTATGCAGGCTATGTATTCGGTTTCATTATATTTCCAGAAAATCTGTTTTAGCATACGCCGTCACTCCTATATTAACGGCTTAAAC

idx 18 locidx 918
0 T
5 (0, 5, 5, 0)
[ 0  0 12  0]
50 C
55 (50, 5, 5, 0)
[12  0  0  0]
80 W
85 (80, 5, 5, 0)
[0 6 6 0]
TACCCACTAGACGTCTTAGCTGGTTCAGTGGCCAGCCCTCCTCCGTGGTGCTGGATATATGTAAAATTTTTGAATGCCTTWGACGT

idx 18 locidx 919
2 G
7 (2, 5, 5, 0)
[ 0  0  0 26]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 26]
61 C
66 (61, 5, 5, 0)
[26  0  0  0]
77 G
82 (77, 5, 5, 0)
[ 0  0  0 26]
CAGACACGAAATAATGGCAGAATCCTTACTTGCAAACAAATGGGATTCTCGTCGTCGGTGTCGATCGGCATTCTTCTGAGTGAGAT

idx 18 locidx 920
15 C
20 (15, 5, 5, 0)
[18  0  0  0]
40 C
45 (40, 5, 5, 0)
[18  0  0  0]
67 C
72 (67, 5, 5, 0)
[18  0  0  0]
CTCATCTCCTGATATCGTCACGTTTTCCTAAGGGAGTGGCCCATAGGACCCCCATGCGCAACGTCTTCGACTTAAGGTTACGGGCA

idx 18 locidx 921
19 C
24 (19, 5, 5, 0)
[24  0  0  0]
42 T
47 (42, 5, 5, 0)
[ 0  0 24  0]
62 A
67 (62, 5, 5, 0)
[ 0 24  0  0]
74 A
79 (74, 5, 5, 0)
[ 0 24  0  0]
81 W
86 (81, 5, 5, 0)
[ 0 15  9  0]
TCCCAAGCCACTTTTTTGGCCGACGGGCGTCCTAGGGCGTCATCGTCACTCTGACGGAAGCAAGTACATAACCAAGCTAGTWTATT

idx 18 locidx 922
10 R
15 (10, 5, 5, 0)
[ 0  8  0 14]
13 C
18 (13, 5, 5, 0)
[22  0  0  0]
33 C
38 (33, 5, 5, 0)
[22  0  0  0]
67 A
72 (67, 5, 5, 0)
[ 0 22  0  0]
78 A
83 (78, 5, 5, 0)
[ 0 22  0  0]
GATGCCGAGARGTCATAACGGCACGAATGTCACCAGTTATTTTCCTAATCTAAGACAACAAATAACAAGGAAGTCATTATAGATGT

idx 18 locidx 923
7 T
12 (7, 5, 5, 0)
[ 0  0 24  0]
GCCTCGATAGCCTTCGTCCCTGCTGATTGTTAACTATGGCACGACAGGCCCTCACTGAAAAAGCATTCAAATTAAGAAACGGATTA

idx 18 locidx 924
16 T
21 (16, 5, 5, 0)
[ 0  0 21  0]
33 A
38 (33, 5, 5, 0)
[ 0 21  0  0]
46 G
51 (46, 5, 5, 0)
[ 0  0  0 21]
56 A
61 (56, 5, 5, 0)
[ 0 21  0  0]
CTCTTGCTAAGACCTCTCGGCACGCGTGACTATATCAAACTGACGTGGGGGTATTTACCGAGGTTCGAAAAGTTCATATCACTAAT

idx 18 locidx 925
16 A
21 (16, 5, 5, 0)
[ 0 18  0  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 18  0]
48 A
53 (48, 5, 5, 0)
[ 0 18  0  0]
85 Y
90 (85, 5, 5, 0)
[ 8  0 10  0]
TATCTCGACTTTACCGATCGCCGCATATGACAGCCGACATGTCTGCCTAGCCGCTTGACGGCCAATATAGAGTCGTTGGTTACATY

idx 18 locidx 926
10 A
15 (10, 5, 5, 0)
[ 0 21  0  0]
20 T
25 (20, 5, 5, 0)
[ 0  0 21  0]
23 T
28 (23, 5, 5, 0)
[ 0  0 21  0]
24 T
29 (24, 5, 5, 0)
[ 0  0 21  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 21]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 21]
66 Y
71 (66, 5, 5, 0)
[11  0 10  0]
67 K
72 (67, 5, 5, 0)
[ 0  0 11 10]
84 T
89 (84, 5, 5, 0)
[ 0  0 21  0]
CCACTGTATGAAGCACCTCCTGGTTCGGCCGCGAGGCCATTTCCTTCTGAGCCTGTACTGCCGTGGYKAGATTTACGACTAGTATC

idx 18 locidx 927
34 T
39 (34, 5, 5, 0)
[ 0  0 23  0]
55 T
60 (55, 5, 5, 0)
[ 0  0 23  0]
56 A
61 (56, 5, 5, 0)
[ 0 23  0  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 23]
AGCGCATCAAATATTCTAGGATCTTTCAACGGAGTAACCCAAATGTGTCCGGCATTAGATCTGTCCGAGGAGAGCTGACGACAAGC

idx 18 locidx 928
57 G
62 (57, 5, 5, 0)
[ 0  0  0 27]
70 T
75 (70, 5, 5, 0)
[ 0  0 27  0]
84 K
89 (84, 5, 5, 0)
[ 0  0 15 12]
TGCGGTGGGCAGTGGAGCTCGACTAGGAATGCGAATTACTGCAAGGATGTAGAAATCGAGAGGGAGCCTCTCCAGGCAGGCGGGKG

idx 18 locidx 929
3 T
8 (3, 5, 5, 0)
[ 0  0 16  0]
18 K
23 (18, 5, 5, 0)
[0 0 8 8]
40 A
45 (40, 5, 5, 0)
[ 0 16  0  0]
42 G
47 (42, 5, 5, 0)
[ 0  0  0 16]
45 m
50 (45, 5, 5, 0)
[8 8 0 0]
61 G
66 (61, 5, 5, 0)
[ 0  0  0 16]
GTATCTATCATCTAAGGAKTTAGATGGTATTGACGGAGAAAAGGTmTAAGACATCATCTGAGCCTCTCAAACATTGAGTCCTCTTT

idx 18 locidx 930
51 C
56 (51, 5, 5, 0)
[18  0  0  0]
53 T
58 (53, 5, 5, 0)
[ 0  0 18  0]
TTCGCTCGTTCTAGTTACGCCAACGATACTGCTACTTGCCTTAGTGTGGAGCATAGTCTCTGATGAGAGGACTGTTCGTCTATTAC

idx 18 locidx 931
0 C
5 (0, 5, 5, 0)
[20  0  0  0]
2 G
7 (2, 5, 5, 0)
[ 0  0  0 20]
21 C
26 (21, 5, 5, 0)
[20  0  0  0]
23 T
28 (23, 5, 5, 0)
[ 0  0 20  0]
29 A
34 (29, 5, 5, 0)
[ 0 20  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 20]
44 T
48 (44, 5, 5, 1)
[ 0  0 20  0]
47 T
51 (47, 5, 5, 1)
[ 0  0 20  0]
84 A
87 (84, 5, 5, 2)
[ 0 20  0  0]
85 T
88 (85, 5, 5, 2)
[ 0  0 20  0]
CAGTGAGTTATGATGGAACCGCGTGAAGTACCATTCGGAAGCC-TGATCCAAGAATTTGCCTCGGTT-CTTGGTAGAAGGTGGGAT

idx 18 locidx 932
2 T
7 (2, 5, 5, 0)
[ 0  0 23  0]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 23]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 23]
62 A
67 (62, 5, 5, 0)
[ 0 23  0  0]
82 C
87 (82, 5, 5, 0)
[23  0  0  0]
GGTACGTCTCAAGGTGGCTGCGGGTTAAGGAAATGTCGTGCGGAGCAAGCCATCACGGTTCGACGTTACACGCCCAAAACTACGTT

idx 18 locidx 933
23 A
28 (23, 5, 5, 0)
[ 0 20  0  0]
34 C
39 (34, 5, 5, 0)
[20  0  0  0]
43 A
48 (43, 5, 5, 0)
[ 0 20  0  0]
CAGTGTAACGATACTTCTTGGGGAGTTGGGCTGTCCTAAAGAGACCGCCCACGTCTTCTTTAATAAGATTGGTGCACCGTACCACT

idx 18 locidx 934
33 C
38 (33, 5, 5, 0)
[20  0  0  0]
47 C
52 (47, 5, 5, 0)
[20  0  0  0]
65 C
70 (65, 5, 5, 0)
[20  0  0  0]
GAGGTTTAAGTGACTTTGTAGTAGAAAATCAAACGTCGGGGGCTCCTCAGTTACTCGCCCCACAACAGAGCATGCGGTATCCCTTC

idx 18 locidx 935
17 T
22 (17, 5, 5, 0)
[ 0  0 20  0]
33 C
38 (33, 5, 5, 0)
[20  0  0  0]
39 A
44 (39, 5, 5, 0)
[ 0 20  0  0]
46 A
51 (46, 5, 5, 0)
[ 0 20  0  0]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 20]
79 A
84 (79, 5, 5, 0)
[ 0 20  0  0]
TGGGGTGAGACCCAGATTAAAAACCCCTCAATACATGCCAACGTCAAGGGACTCCTTCGTCCACATTCGAGGGTCTGACAGGGTCC

idx 18 locidx 936
1 G
6 (1, 5, 5, 0)
[ 0  0  0 18]
9 A
14 (9, 5, 5, 0)
[ 1 17  0  0]
15 T
20 (15, 5, 5, 0)
[ 0  0 18  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 18]
62 T
67 (62, 5, 5, 0)
[ 0  0 18  0]
81 A
86 (81, 5, 5, 0)
[ 0 18  0  0]
85 C
90 (85, 5, 5, 0)
[18  0  0  0]
TGCCGACAAATGGTATAGAGGACGCCTTCGTCACTACTTTCACTAAGGTGCCTAGAGAGGTATTCCTGTCTGTGATTAGCCAGGAC

idx 18 locidx 937
33 T
38 (33, 5, 5, 0)
[ 0  0 25  0]
46 W
51 (46, 5, 5, 0)
[ 0 12 13  0]
AACATTTTCTTTAAGTTCGGCAGCGTTTATTCCTCCGTATGTTTATWGCGTGGCGATCACTCGTATCGATCAGGCGGCCAAATACG

idx 18 locidx 938
0 A
5 (0, 5, 5, 0)
[ 0 24  0  0]
15 A
20 (15, 5, 5, 0)
[ 0 24  0  0]
40 C
45 (40, 5, 5, 0)
[24  0  0  0]
62 C
67 (62, 5, 5, 0)
[24  0  0  0]
ATATCGCTACATGCCACTCACAGACTGCTCCTCGGTGACGCGCAAATAGCGACACGACACCGCTTACCGTTCCCCATAAATCTATC

idx 18 locidx 939
7 C
12 (7, 5, 5, 0)
[21  0  0  0]
9 A
14 (9, 5, 5, 0)
[ 0 21  0  0]
10 A
15 (10, 5, 5, 0)
[ 0 21  0  0]
35 T
40 (35, 5, 5, 0)
[ 0  0 21  0]
46 T
51 (46, 5, 5, 0)
[ 0  0 21  0]
55 C
60 (55, 5, 5, 0)
[21  0  0  0]
62 T
67 (62, 5, 5, 0)
[ 0  0 21  0]
70 C
75 (70, 5, 5, 0)
[21  0  0  0]
GCGCAGTCCAACGTTTTTTTGTTCGCTCAGCGATGTCCCTACATTCTGTTCTCTGCAAATTATCACTTTGCAAGCCTTGAGCGGCA

idx 18 locidx 940
5 C
10 (5, 5, 5, 0)
[19  0  0  0]
10 T
15 (10, 5, 5, 0)
[ 0  0 19  0]
36 G
41 (36, 5, 5, 0)
[ 0  0  0 19]
55 G
60 (55, 5, 5, 0)
[ 0  0  0 19]
GGACACGACATATTGCAACGAAACCGCCCTCGCGTAGCTGACAACAGTCGAAGCGGTTAAAACTTGTATTACTCACAGCTTGATAT

idx 18 locidx 941
43 C
48 (43, 5, 5, 0)
[16  0  0  0]
83 G
88 (83, 5, 5, 0)
[ 0  0  0 16]
TGAGATATGCTAGGAAATTAAACGCTTGTGCACGTCAAAAGCACTTGGTTGAGCGTAGACGTTTAATGTTGGAGGGGCGGTGCGGG

idx 18 locidx 942
29 T
34 (29, 5, 5, 0)
[ 0  0 21  0]
49 G
54 (49, 5, 5, 0)
[ 0  0  0 21]
57 K
62 (57, 5, 5, 0)
[ 0  0 13  8]
69 T
74 (69, 5, 5, 0)
[ 0  0 21  0]
CCAACACGTTAAACGCGTGACTGTAAACTTGTTGCTGGCTAACGAACAAGGACGGAGKGTTCACCATCCTCGTTCAGAATTCGTCG

idx 18 locidx 943
6 T
11 (6, 5, 5, 0)
[ 0  0 19  0]
18 A
23 (18, 5, 5, 0)
[ 0 19  0  0]
AGACGATCCTTGAAGTCTAGGTGCTCGCTAGACAGTTCGGCGACTCAGGCTTGATGGCTCTTCATAGGAGGCCCAATCATAGTTGG

idx 18 locidx 944
26 A
31 (26, 5, 5, 0)
[ 0 23  0  0]
43 G
48 (43, 5, 5, 0)
[ 0  0  0 23]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 23]
65 T
70 (65, 5, 5, 0)
[ 0  0 23  0]
67 A
72 (67, 5, 5, 0)
[ 0 23  0  0]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 23]
73 C
78 (73, 5, 5, 0)
[23  0  0  0]
ATAAGAGTATCAAATGACTATTCACCATCTTGGGTATGTACTTGCGATTTTAGACGTCGCTGATGTTAACCCGCCATGCCAAATAA

idx 18 locidx 945
12 T
17 (12, 5, 5, 0)
[ 0  0 27  0]
66 C
71 (66, 5, 5, 0)
[27  0  0  0]
ACCTTATGTGACTTCACACCATTGATGTACAACTAGGGGCACCCCCTTGGGTTCAATGGTGGATCTCTAAGCGCACCAGTCCGTCC

idx 18 locidx 946
1 A
6 (1, 5, 5, 0)
[ 0 20  0  0]
2 S
7 (2, 5, 5, 0)
[10  0  0 10]
61 C
66 (61, 5, 5, 0)
[19  0  0  1]
GASTTAAACCATTCCGCGACACTGTTGTCGCCTTCAAGCACCGTGCAGCAACCGCGCCGGCCGGCGCACATACGAGTGCTGTCCCA

idx 18 locidx 947
25 T
30 (25, 5, 5, 0)
[ 0  0 23  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 23]
43 C
48 (43, 5, 5, 0)
[23  0  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 23]
71 A
76 (71, 5, 5, 0)
[ 0 23  0  0]
78 C
83 (78, 5, 5, 0)
[23  0  0  0]
83 T
88 (83, 5, 5, 0)
[ 0  0 23  0]
TCCGACTGGCGGCTAGGTACTGTCATGACACTGAACGAACATGCGCCGTTATGTGCTAATTGCATAGCCCCAGGCGGGCCATCTGC

idx 18 locidx 948
12 G
17 (12, 5, 5, 0)
[ 0  0  0 14]
23 C
28 (23, 5, 5, 0)
[14  0  0  0]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 14]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 14]
TACCATAAGCTAGCGACGGGTCACGTTTGGAAATGGACCATTTTGATAAACATCGCACGTTTCCGTGCCGAGAGGCGTTCCCAGAT

idx 18 locidx 949
36 A
41 (36, 5, 5, 0)
[ 0 23  0  0]
49 C
54 (49, 5, 5, 0)
[23  0  0  0]
GTGGGGCGATAGATGACGGCAAGTTGCTGGAGGTGCATACCCCGATTCTCATCCTCCATCGTGAATTCCCATCGATCATGCCACGT

idx 19 locidx 950
20 T
25 (20, 5, 5, 0)
[ 0  0 20  0]
30 G
35 (30, 5, 5, 0)
[ 0  0  0 20]
68 G
73 (68, 5, 5, 0)
[ 0  0  0 20]
71 A
76 (71, 5, 5, 0)
[ 0 20  0  0]
TGGGGTATGTGGTCAATCCATAGACATTATGCGTTCTTCGCACCAGTATTCCACACATTTTATCTAACGAGATGTGTGCCCAAACG

idx 19 locidx 951
7 T
12 (7, 5, 5, 0)
[ 0  0 23  0]
15 C
20 (15, 5, 5, 0)
[22  1  0  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 23]
TTGGGATTACGGATCCACTCACGCATGGTCAGTAGTGTTAGTCCGGGCCCCTTTTGCAGTGCATCCGTTCACCGGAGGAAGGACGT

idx 19 locidx 952
29 A
34 (29, 5, 5, 0)
[ 0 18  0  0]
45 G
50 (45, 5, 5, 0)
[ 0  0  0 18]
48 G
53 (48, 5, 5, 0)
[ 0  0  0 18]
63 A
68 (63, 5, 5, 0)
[ 0 18  0  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 18]
77 M
82 (77, 5, 5, 0)
[10  8  0  0]
GTCGGGGATCGTCTCTGTATTGGACGATCAATCAGCATGCGTTTGGAGGACTAAGCGAGTAATAGGTACAATCCTACMTTCGGTCA

idx 19 locidx 953
2 A
7 (2, 5, 5, 0)
[ 0 20  0  0]
8 A
13 (8, 5, 5, 0)
[ 0 20  0  0]
22 A
27 (22, 5, 5, 0)
[ 0 20  0  0]
70 C
75 (70, 5, 5, 0)
[20  0  0  0]
GGAGGGACAGTTTGCAGTAGCGATCAATAGTTATTTACAATGTAAGGTCGGGTGACGCCGATTTGAAATACATCATCTACGGCCTC

idx 19 locidx 954
3 A
8 (3, 5, 5, 0)
[ 0 23  0  0]
10 G
15 (10, 5, 5, 0)
[ 0  0  0 23]
32 A
37 (32, 5, 5, 0)
[ 0 23  0  0]
66 R
71 (66, 5, 5, 0)
[ 0 11  0 12]
69 Y
74 (69, 5, 5, 0)
[11  0 12  0]
70 y
75 (70, 5, 5, 0)
[12  0 11  0]
81 C
86 (81, 5, 5, 0)
[23  0  0  0]
CCCACCAAGAGCTTAATGTGGAGAAAAATGCTAACGTGTGCAATTCCTAGATTAACTACAGTCCGARACYyCTCCTTTCGGCTCTT

idx 19 locidx 955
1 A
6 (1, 5, 5, 0)
[ 0 16  0  0]
50 T
55 (50, 5, 5, 0)
[ 0  0 16  0]
TAAGAGCGAGCTCAAAGGGACGCAATCGGTTAGTGCCGGGCGCTTATCGGTTACAATTCGAGACTATCCCATCTTCGAGATGCCCC

idx 19 locidx 956
35 G
40 (35, 5, 5, 0)
[ 0  0  0 21]
51 C
56 (51, 5, 5, 0)
[21  0  0  0]
56 C
61 (56, 5, 5, 0)
[21  0  0  0]
57 C
62 (57, 5, 5, 0)
[21  0  0  0]
80 A
85 (80, 5, 5, 0)
[ 0 21  0  0]
TCCGACCATGACGTCCATGCGCTTACTTCTAAGGGGGTGCTATCCGCTTATCGCAACCAGTGCATTTGGGATGGTCTTTGACAAGG

idx 19 locidx 957
23 A
28 (23, 5, 5, 0)
[ 0 16  0  0]
31 S
36 (31, 5, 5, 0)
[9 0 0 7]
38 A
43 (38, 5, 5, 0)
[ 0 16  0  0]
45 C
50 (45, 5, 5, 0)
[16  0  0  0]
51 T
56 (51, 5, 5, 0)
[ 0  0 16  0]
52 k
57 (52, 5, 5, 0)
[0 0 7 9]
54 T
59 (54, 5, 5, 0)
[ 0  0 16  0]
69 T
74 (69, 5, 5, 0)
[ 0  0 16  0]
CCTGGTTTGTTATTGAATCGACCATGTTTTTSGCCCCTACTCGGCCATCGGTkTTCAGTAAGGCCAGGCTAGCGTCAAACATTATG

idx 19 locidx 958
12 A
17 (12, 5, 5, 0)
[ 0 16  0  0]
37 G
42 (37, 5, 5, 0)
[ 0  0  0 16]
TCCGCGCGGTGGACGGAGCTATAACACACCGCCCTTAGGTGACTCCCTACACTACTTGATAATTATAAGCCGAACCCATCCGCATA

idx 19 locidx 959
7 G
12 (7, 5, 5, 0)
[ 0  0  0 20]
60 T
65 (60, 5, 5, 0)
[ 0  0 20  0]
64 R
69 (64, 5, 5, 0)
[ 0  9  0 11]
76 A
81 (76, 5, 5, 0)
[ 0 20  0  0]
CATCGTTGTCAAATAGTATGGTGATGCTAGAATACCGCTGGCAGAAAATAGCCCGGAATATCCCRAGTCCCCATTCAGACTATCAA

idx 19 locidx 960
10 T
15 (10, 5, 5, 0)
[ 0  0 21  0]
31 G
36 (31, 5, 5, 0)
[ 0  0  0 21]
39 T
44 (39, 5, 5, 0)
[ 0  0 21  0]
69 A
74 (69, 5, 5, 0)
[ 0 21  0  0]
TGTTCCAGGATTAGGCGGCATGGATGTCATTGTTAAAACTTTCTCAGTCTTCATCACGAGTGCCAAGAGATCTTCATGGGACAAAT

idx 19 locidx 961
2 C
7 (2, 5, 5, 0)
[19  0  0  0]
35 A
40 (35, 5, 5, 0)
[ 0 19  0  0]
36 T
41 (36, 5, 5, 0)
[ 0  0 19  0]
39 T
44 (39, 5, 5, 0)
[ 0  0 19  0]
66 C
71 (66, 5, 5, 0)
[19  0  0  0]
78 C
83 (78, 5, 5, 0)
[19  0  0  0]
GGCAGCGGCTTATAACCCCAAGGGAATACGGAAGCATTTTATTGTTGAACATGCTGAGGACTAACGCGCCAAATCTCGCTCCATAG

idx 19 locidx 962
13 C
18 (13, 5, 5, 0)
[23  0  0  0]
17 T
22 (17, 5, 5, 0)
[ 0  0 23  0]
26 G
31 (26, 5, 5, 0)
[ 0  0  0 23]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 23]
85 T
90 (85, 5, 5, 0)
[ 0  0 23  0]
CAACCGAATGGCCCCCTTTTCGCATAGTGACAGAGTAGACGCGTGCATGCCTGATCAGGGCTAAGGTTTTTAGTACATGGTGCAGT

idx 19 locidx 963
8 T
13 (8, 5, 5, 0)
[ 0  0 14  0]
10 T
15 (10, 5, 5, 0)
[ 0  0 14  0]
70 T
75 (70, 5, 5, 0)
[ 0  0 14  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 14]
TCCCTAGATTTTGGGTGCATCAATGTGCTCCCAGTGGAGAGATAGTTCGACTCGCTCACGAAGCAATTATTGGCGAATGGTCAGCA

idx 19 locidx 964
0 A
5 (0, 5, 5, 0)
[ 0 21  0  0]
32 T
37 (32, 5, 5, 0)
[ 0  0 21  0]
66 C
71 (66, 5, 5, 0)
[21  0  0  0]
AGGTATGCTCGTAATTTAATAAAGTTCTGTCATCACAGAACCTGGTGGCTACGACTGAGAGGTTTGCGATCAGTGGCGTCCTGGCA

idx 19 locidx 965
6 A
11 (6, 5, 5, 0)
[ 0 20  0  0]
29 C
34 (29, 5, 5, 0)
[20  0  0  0]
CGTTAAAGCGATCAGGGGTGTCGTATTCGCGAATGCACTCGCAAGGCTCACTGCGCTAGTGAGCCCCTGGATCGTATGCGCTTTCC

idx 19 locidx 966
0 C
5 (0, 5, 5, 0)
[23  0  0  0]
7 C
12 (7, 5, 5, 0)
[23  0  0  0]
14 C
19 (14, 5, 5, 0)
[23  0  0  0]
17 A
22 (17, 5, 5, 0)
[ 0 23  0  0]
20 G
25 (20, 5, 5, 0)
[ 0  0  0 23]
29 T
34 (29, 5, 5, 0)
[ 0  0 23  0]
71 C
76 (71, 5, 5, 0)
[22  0  1  0]
CGTTCAGCTGGAAACAAAACGATTGCCGGTCACCAAGCGATAAACAGTCGGAGGTGGTGGTTGGGCCCATACGCAGACAACCCCTG

idx 19 locidx 967
29 T
34 (29, 5, 5, 0)
[ 0  0 18  0]
54 C
59 (54, 5, 5, 0)
[18  0  0  0]
56 C
61 (56, 5, 5, 0)
[18  0  0  0]
80 C
85 (80, 5, 5, 0)
[18  0  0  0]
ATATAGAAACAAAGCCCCTCACTCCTAGATCATGGGGCGGCCTATTGATGTTAGCGCAACTAGTGTTCAGTAGAGTGCGACCTCGC

idx 19 locidx 968
13 G
18 (13, 5, 5, 0)
[ 0  0  0 20]
44 G
49 (44, 5, 5, 0)
[ 0  0  0 20]
AACGAAATCTGCTGTCGTCGAGCATTTATACGCTGGATGTATATGAAAGGTACAAAAGTACTGCGGACCGAACCTATGACGATATG

idx 19 locidx 969
14 T
19 (14, 5, 5, 0)
[ 0  0 14  0]
49 C
54 (49, 5, 5, 0)
[14  0  0  0]
50 T
55 (50, 5, 5, 0)
[ 0  0 14  0]
CGAAACCGGCGCACTTCTCCTGGAATTCCAGCGCCACTTCGCCTAGCATCTGCGGTGTCTCAGACATGAAGAACGCGTAGAACTTG

idx 19 locidx 970
2 W
7 (2, 5, 5, 0)
[ 0 12 18  0]
11 T
16 (11, 5, 5, 0)
[ 0  0 30  0]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 30]
CGWTGCTGCTCTCCATCGTGGTCAGAAATGAACTTTTTTTTAGGTCCCCTTTGAGGCTACTTACCGAGTGTACGATATGCGAACAG

idx 19 locidx 971
15 A
20 (15, 5, 5, 0)
[ 0 21  0  0]
47 G
52 (47, 5, 5, 0)
[ 0  0  0 21]
56 G
61 (56, 5, 5, 0)
[ 0  0  0 21]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 21]
75 T
80 (75, 5, 5, 0)
[ 0  0 21  0]
81 A
86 (81, 5, 5, 0)
[ 0 21  0  0]
ACGGGCAGCCATCTGAAAGCGCGGAATTTGATAAGAGTTAGTACCTAGATTGCATTGCTGTGTGCGCGTGTTCGATTGAAAATGCC

idx 19 locidx 972
6 T
11 (6, 5, 5, 0)
[ 0  0 18  0]
10 G
15 (10, 5, 5, 0)
[ 0  0  0 18]
32 T
37 (32, 5, 5, 0)
[ 0  0 18  0]
CATCCCTAAGGTAGAGATTAGACTGAGCCCTATCCTAGCTATGCTTATTTCGACGTCAAGATGCGGGATTGGCAAGCACCGCCGCT

idx 19 locidx 973
23 A
28 (23, 5, 5, 0)
[ 0 24  0  0]
39 C
44 (39, 5, 5, 0)
[24  0  0  0]
46 C
51 (46, 5, 5, 0)
[24  0  0  0]
52 A
57 (52, 5, 5, 0)
[ 0 24  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 24  0]
CGCCTCTACATGAAAGGCTCTACAGGTGCTCACTTCAGGCCTACCTCCCTGGATATGCCGGTAATACTTTACCGATTGGTGAGAGT

idx 19 locidx 974
8 A
13 (8, 5, 5, 0)
[ 0 19  0  0]
38 T
43 (38, 5, 5, 0)
[ 0  0 19  0]
67 A
72 (67, 5, 5, 0)
[ 0 19  0  0]
72 K
77 (72, 5, 5, 0)
[ 0  0 11  8]
74 A
79 (74, 5, 5, 0)
[ 0 19  0  0]
TTGGTATTAAGGCGGAGCCCGAGGCTAGTGTGCGCTCGTACCTTATACGTTCCTGTCCTTAAGTAGTAGAAGKAAACGTAGTTTTG

idx 19 locidx 975
37 A
42 (37, 5, 5, 0)
[ 0 24  0  0]
CGGATACATATGTGCAGTGCGGCGATGTTCACCTCGCAACCTTACGAATTCGAAGACCGTGTTAGATATGGGGCCATGCCTTTATC

idx 19 locidx 976
0 A
5 (0, 5, 5, 0)
[ 0 24  0  0]
2 G
7 (2, 5, 5, 0)
[ 0  0  0 24]
25 C
30 (25, 5, 5, 0)
[24  0  0  0]
31 A
36 (31, 5, 5, 0)
[ 0 24  0  0]
34 C
39 (34, 5, 5, 0)
[24  0  0  0]
66 A
71 (66, 5, 5, 0)
[ 0 24  0  0]
84 G
89 (84, 5, 5, 0)
[ 0  0  0 24]
AGGCCTGTGGATCCGGCATGATCCCCCGCTTAAACTTTCATGGAAAATTGCGCGGTCCCCCGGAAGAAGCGAAGGAACCGGGCAGG

idx 19 locidx 977
1 T
6 (1, 5, 5, 0)
[ 0  0 23  0]
65 A
70 (65, 5, 5, 0)
[ 0 23  0  0]
CTGCACAAGCTTTGAGCACGGGAGAGCCCGAGACAAGCTAAGGCAATATACGTCCAGTACTTAAGACTCATACAACCGTACATCCG

idx 19 locidx 978
6 G
11 (6, 5, 5, 0)
[ 0  0  0 22]
30 T
35 (30, 5, 5, 0)
[ 0  0 22  0]
37 C
42 (37, 5, 5, 0)
[22  0  0  0]
63 A
68 (63, 5, 5, 0)
[ 0 22  0  0]
65 C
70 (65, 5, 5, 0)
[22  0  0  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 22  0]
ATGAGCGCGGCATTAGTGAGATGGGAAGTATCGCGTACACCCGGAGACTACGCCCGTGCCGACAGCGGGCCTATGATGTCGGAGCT

idx 19 locidx 979
13 C
18 (13, 5, 5, 0)
[22  0  0  0]
42 A
47 (42, 5, 5, 0)
[ 0 22  0  0]
47 T
52 (47, 5, 5, 0)
[ 0  0 22  0]
81 C
86 (81, 5, 5, 0)
[22  0  0  0]
CGGTATCGATAGTCGGGTAATATACAGCGGGTCTCTTCAATCAGGGTTCGCATAACGCAGGTCAGATGACACGTTTTTGCACTTTG

idx 19 locidx 980
9 G
14 (9, 5, 5, 0)
[ 0  0  0 18]
10 G
15 (10, 5, 5, 0)
[ 0  0  0 18]
12 T
17 (12, 5, 5, 0)
[ 0  0 18  0]
14 C
19 (14, 5, 5, 0)
[18  0  0  0]
22 G
27 (22, 5, 5, 0)
[ 0  0  0 18]
29 A
34 (29, 5, 5, 0)
[ 0 18  0  0]
37 C
42 (37, 5, 5, 0)
[18  0  0  0]
52 C
57 (52, 5, 5, 0)
[18  0  0  0]
CTTAAGCTTGGGTTCCCAGCGGGTAGCTGACCTTCTACAGCTGCCCAGTGAGCTCCGCTCTGCCCAGGCTGCCGGCCCAAACGTAT--

idx 19 locidx 981
7 C
12 (7, 5, 5, 0)
[22  0  0  0]
52 C
57 (52, 5, 5, 0)
[22  0  0  0]
61 A
66 (61, 5, 5, 0)
[ 0 22  0  0]
CAGGTGTCCCTTAGAGGGGGGTATCAAGAGTAACGGACACTAAGTGGTAACGCCAGAAGGCACGACTGCCGCTGGGTCGAGCACAC

idx 19 locidx 982
9 C
14 (9, 5, 5, 0)
[22  0  0  0]
32 T
37 (32, 5, 5, 0)
[ 0  0 22  0]
34 G
39 (34, 5, 5, 0)
[ 0  0  0 22]
56 C
61 (56, 5, 5, 0)
[22  0  0  0]
64 G
69 (64, 5, 5, 0)
[ 0  0  0 22]
65 G
70 (65, 5, 5, 0)
[ 0  0  0 22]
72 G
77 (72, 5, 5, 0)
[ 0  0  0 22]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 22]
GGTCTGTGTCCCGTCTTGTATTTTAAGGGTGATGGTTTCTCGAACTCCGGGAGCACCAGCAAGTGGTGATCCGGGGATTTAACCGA

idx 19 locidx 983
34 G
39 (34, 5, 5, 0)
[ 0  0  0 22]
47 A
52 (47, 5, 5, 0)
[ 0 22  0  0]
48 T
53 (48, 5, 5, 0)
[ 0  0 22  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 22  0]
82 G
87 (82, 5, 5, 0)
[ 0  0  0 22]
GCTGCAAGTTCTGCTCGAATACAACCGGGAAATTGCTCGAGACATTCATCGCGGCAAGTGGAGCCCCTGCTGGCAGCCCCTTGGCT

idx 19 locidx 984
23 C
28 (23, 5, 5, 0)
[21  0  0  0]
29 G
34 (29, 5, 5, 0)
[ 0  0  0 21]
GAAAATTATGCGTTGTAAAGCAGCCAACAGTGCAAACAATACAAAGGCCCAATCGGTTACTGACTCTGCGCATGCGTAAATGCAGA

idx 19 locidx 985
25 T
30 (25, 5, 5, 0)
[ 0  0 21  0]
51 T
56 (51, 5, 5, 0)
[ 0  0 21  0]
81 C
86 (81, 5, 5, 0)
[21  0  0  0]
AGTCTATCTGACGAGGGAAGCTAACTCGGCGAATAGATTGTTGCAGAACACTACTGAGGGTCTAGATTAGCAAGGATCTTCCATTT

idx 19 locidx 986
8 T
13 (8, 5, 5, 0)
[ 0  0 21  0]
18 G
23 (18, 5, 5, 0)
[ 0  0  0 21]
41 T
46 (41, 5, 5, 0)
[ 0  0 21  0]
68 T
73 (68, 5, 5, 0)
[ 0  0 21  0]
72 A
77 (72, 5, 5, 0)
[ 0 21  0  0]
75 T
80 (75, 5, 5, 0)
[ 0  0 21  0]
80 T
85 (80, 5, 5, 0)
[ 0  0 21  0]
GTTCAGTGTGCACTACGAGTCCAAATAAGATCCTCTGCATGTCCAGTGAAGTCAGCCGTGTCCTAACATTGTACATGGAATATTCT

idx 19 locidx 987
8 C
13 (8, 5, 5, 0)
[21  0  0  0]
67 G
72 (67, 5, 5, 0)
[ 0  0  0 21]
70 G
75 (70, 5, 5, 0)
[ 0  0  0 21]
80 G
85 (80, 5, 5, 0)
[ 0  0  0 21]
AAGCGCGCCTGAAGAATCTGGAAGTCACAATGTTACGCTCTCGTCCTCAAGTAAATTTATCATGTAAGGGGTATCGACGTGCAAGG

idx 19 locidx 988
21 T
26 (21, 5, 5, 0)
[ 0  0 20  0]
41 T
46 (41, 5, 5, 0)
[ 0  0 20  0]
48 C
53 (48, 5, 5, 0)
[20  0  0  0]
TACTTCGGCGACTGAATGATATTAAATTGGTTACTTAGGCTTATCGAGCGGGGACTTGGGCGGTTTAACTCTGTCGACAAGAACTG

idx 19 locidx 989
9 G
14 (9, 5, 5, 0)
[ 0  0  0 20]
26 A
31 (26, 5, 5, 0)
[ 0 20  0  0]
41 A
46 (41, 5, 5, 0)
[ 0 20  0  0]
73 G
78 (73, 5, 5, 0)
[ 0  0  0 20]
TTACCAGCTGGCGTTCCTTCAGAGGAACCTTAGGTGGTAATACCAAAATCCCTGCGCAATGCGCATGTCTTGCGCCTCTTGATATT

idx 19 locidx 990
11 T
16 (11, 5, 5, 0)
[ 0  0 20  0]
56 T
61 (56, 5, 5, 0)
[ 0  0 20  0]
65 C
70 (65, 5, 5, 0)
[20  0  0  0]
TCGTAGCAATCTGTGGCAGGTCTGGGTACTCTTCTTTGAACATTTGGCTTTTCCATTGCCAAGATCAAGATCGCGACTTAAAAATA

idx 19 locidx 991
7 G
12 (7, 5, 5, 0)
[ 0  0  0 19]
49 T
54 (49, 5, 5, 0)
[ 0  0 19  0]
51 C
56 (51, 5, 5, 0)
[19  0  0  0]
68 A
73 (68, 5, 5, 0)
[ 0 19  0  0]
78 T
83 (78, 5, 5, 0)
[ 0  0 19  0]
CCAATAAGGTCCCGCTTTCTTCATATGCTAAGACGGGTTTATTGCCCCCTGCCCAGGTCCTCCTTCTTACCGCCAGTCTATATTGA

idx 19 locidx 992
46 G
51 (46, 5, 5, 0)
[ 0  0  0 19]
54 C
59 (54, 5, 5, 0)
[19  0  0  0]
72 T
77 (72, 5, 5, 0)
[ 0  0 19  0]
74 A
79 (74, 5, 5, 0)
[ 0 19  0  0]
81 G
86 (81, 5, 5, 0)
[ 0  0  0 19]
84 T
89 (84, 5, 5, 0)
[ 0  0 19  0]
TATAGGCGAGGGAATCCTAAGGTGAATAGGTTCGACCGAGTACACAGGGACTATCACGGTCGGGTCCAGCTGTCAAGAACGGCCTG

idx 19 locidx 993
0 A
5 (0, 5, 5, 0)
[ 0 20  0  0]
8 C
13 (8, 5, 5, 0)
[20  0  0  0]
12 T
17 (12, 5, 5, 0)
[ 0  0 20  0]
14 C
19 (14, 5, 5, 0)
[20  0  0  0]
16 A
21 (16, 5, 5, 0)
[ 0 20  0  0]
27 A
32 (27, 5, 5, 0)
[ 0 20  0  0]
53 C
58 (53, 5, 5, 0)
[20  0  0  0]
59 T
64 (59, 5, 5, 0)
[ 0  0 20  0]
AGATAACTCATCTTCGAGATCCCTGACACTAGGCACCACTGTACGACCTTCAACATTGCTAACGTTGTAGTTGTTGGGGACTAGGT

idx 19 locidx 994
4 T
9 (4, 5, 5, 0)
[ 0  0 19  0]
67 T
72 (67, 5, 5, 0)
[ 0  0 19  0]
74 G
79 (74, 5, 5, 0)
[ 0  0  0 19]
TTTCTAGCTCGAAGGGCGGCGAGAGCCGAACCCGTTTGCGCGAAAGCCAGAAGTTACAACGAAGAACTACGAAAGTGGTGCGTAAA

idx 19 locidx 995
15 G
20 (15, 5, 5, 0)
[ 0  0  0 20]
19 G
24 (19, 5, 5, 0)
[ 0  0  0 20]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 20]
36 A
41 (36, 5, 5, 0)
[ 0 20  0  0]
AGCTTTACTAGACGGGGTTGCTCCAAAAAGGTGTCAAATGACGTCACCTAACACATTTAATACCCCTTGACGCAGTGTGGCTAGAC

idx 19 locidx 996
13 T
17 (13, 5, 5, 1)
[ 0  0 17  0]
15 A
19 (15, 5, 5, 1)
[ 0 17  0  0]
35 T
39 (35, 5, 5, 1)
[ 0  0 17  0]
50 A
54 (50, 5, 5, 1)
[ 0 17  0  0]
54 C
58 (54, 5, 5, 1)
[17  0  0  0]
ATGTTCCC-TAGATTAACACAACAGGTTTCTTCCCTCGGTGACTAACCATAGGACCCTTGCAAATGGAGCCGCTAGCACCGACTAC

idx 19 locidx 997
23 A
28 (23, 5, 5, 0)
[ 0 17  0  0]
32 G
37 (32, 5, 5, 0)
[ 0  0  0 17]
34 A
39 (34, 5, 5, 0)
[ 0 17  0  0]
37 T
42 (37, 5, 5, 0)
[ 0  0 17  0]
64 A
69 (64, 5, 5, 0)
[ 0 17  0  0]
76 T
81 (76, 5, 5, 0)
[ 0  0 17  0]
CTTTGGTCGTAGGTGAATCAGGTACTGTACCGGAAGGTTTACCACGTTGTTATGAAGGCTAAAGACAGTTATGTTGTGCCCCCCGC

idx 19 locidx 998
20 G
25 (20, 5, 5, 0)
[ 0  0  0 16]
43 A
48 (43, 5, 5, 0)
[ 0 16  0  0]
CACGGGCGTTCCACATCGATGAGGGGTTCCCAAGTTCATGGTGACGACTTCGAATCTACCTAAGGCAACATAAAGTCTGCGCAGAC

idx 19 locidx 999
39 C
44 (39, 5, 5, 0)
[14  0  0  0]
64 T
69 (64, 5, 5, 0)
[ 0  0 14  0]
84 C
89 (84, 5, 5, 0)
[14  0  0  0]
TAGGTCATCGCCGTGCCCTCTGTTACATGGTTGTTTCCTCGGTTAGCTATAAATATAGGTGCACTTTATACGTTTTCGCGTAGGCG

In [77]:
seq
Out[77]:
'TGGGGTATGTGGTCAATCCATAGACATTATGCGTTCTTCGCACCAGTATTCCACACATTTTATCTAACGAGATGTGTGCCCAAACG'
In [42]:
def merge(name, assemblies, rename_dict=None):
    """
    Creates and returns a new Assembly object in which samples from two or more
    Assembly objects with matching names are 'merged'. Merging does not affect 
    the actual files written on disk, but rather creates new Samples that are 
    linked to multiple data files, and with stats summed.

    # merge two assemblies
    new = ip.merge('newname', (assembly1, assembly2))

    # merge two assemblies and rename samples
    rename = {"1A_0", "A", "1B_0", "A"}
    new = ip.merge('newname', (assembly1, assembly2), rename_dict=rename)
    """
    # create new Assembly
    merged = Assembly(name)

    # one or multiple assemblies?
    try:
        _ = len(assemblies)
    except TypeError:
        assemblies = [assemblies]

    # iterate over all sample names from all Assemblies
    for data in assemblies:

        # make a deepcopy
        ndata = copy.deepcopy(data)
        for sname, sample in ndata.samples.items():
            
            # rename sample if in rename dict
            if sname in rename_dict:
                sname = rename_dict[sname]
                sample.name = sname
                
            # is it in the merged assembly already
            if sname in merged.samples:
                msample = merged.samples[sname]
                
                # update stats
                msample.stats.reads_raw += sample.stats.reads_raw
                if sample.stats.reads_passed_filter:
                    msample.stats.reads_passed_filter += sample.stats.reads_passed_filter
                
                # append files
                msample.files.fastqs.append(sample.files.fastqs)
                msample.files.edits.append(sample.files.edits)

                # do not allow state >2 at merging (requires reclustering)
                # if merging WITHIN samples.
                msample.stats.state = min(sample.stats.state, 2)

            # merge its stats and files
            else:
                merged.samples[sname] = sample

    # Merged assembly inherits max of hackers values (max frag length)
    merged.hackersonly.max_fragment_length = max(
        [i.hackersonly.max_fragment_length for i in assemblies])

    # Set the values for some params that don't make sense inside mergers
    merged_names = ", ".join([i.name for i in assemblies])
    merged.params.raw_fastq_path = "Merged: " + merged_names
    merged.params.barcodes_path = "Merged: " + merged_names
    merged.params.sorted_fastq_path = "Merged: " + merged_names

    # return the new Assembly object
    merged.save()
    return merged