Table of Contents 0. Pairwise alignment (noun) 0. kmer (noun)
A hypothesis about which bases or amino acids in two biological sequences are derived from a common ancestral base or amino acid. By definition, the aligned sequences will be of equal length with gaps (usually denoted with -
, or .
for terminal gaps) indicating hypothesized insertion deletion events. A pairwise alignment may be represented as follows:
ACC---GTAC
CCCATCGTAG
A kmer is simply a word (or list of adjacent characters) in a sequence of length k. For example, the overlapping kmers in the sequence ACCGTGACCAGTTACCAGTTTGACCAA
are as follows:
import skbio
skbio.DNA('ACCGTGACCAGTTACCAGTTTGACCAA').kmer_frequencies(k=5, overlap=True)
It is common for bioinformaticians to substitute the value of k
for the letter k in the word kmer. For example, you might here someone say "we identified all seven-mers in our sequence", to mean they identified all kmers of length seven.