Test tube design example

Design a test tube ensemble intended to contain a 4-stranded stick figure at 1 M.

Material: RNA
Temperature: 23 C

In [1]:
# Import Python NUPACK module
from nupack import *
In [2]:
# Define physical model
my_model = Model(material='rna', celsius=23)

# Define sequence domains
da = Domain('N27', name='da')
db = Domain('N29', name='db')
dc = Domain('N25', name='dc')
dd = Domain('N18', name='dd')

# Define strands containing these domains
sa = TargetStrand([da], name='sa')
sb = TargetStrand([db], name='sb')
sc = TargetStrand([dc], name='sc')
sd = TargetStrand([dd], name='sd')

# Define a target complex
cstickfigure = TargetComplex([sa, sb, sc, sd], '..((((((((..((((((((((((...+))))))(((.........)))((((((..+.))))))))))))..((((((((..+.)))))))))))))))).', name='cstickfigure')

#Define a target test tube containing all off-target complexes of up to 4 strands
tstickfigure = TargetTube(on_targets={cstickfigure: 1e-06}, off_targets=SetSpec(max_size=4), name='tfigure')

# Set a stop condition of 1% and a seed for random number generation to get a reproducible result for this demo
my_options = DesignOptions(f_stop=0.01, seed=93)

# Define and run the test tube design job
my_design = tube_design(tubes=[tstickfigure], model=my_model, options=my_options)
my_results = my_design.run(trials=1)[0]

# Display the design results
my_results
Out[2]:
Domain results:
Domain Sequence
da
GGGCCACAGCGAUACAGAGCUCCCGAA
da*
UUCGGGAGCUCUGUAUCGCUGUGGCCC
db
GGGAGCCGCAAAAACGAAGCGCAGACCAC
db*
GUGGUCUGCGCUUCGUUUUUGCGGCUCCC
dc
AGGUCUGUCUGUAAACCAGGAUCGG
dc*
CCGAUCCUGGUUUACAGACAGACCU
dd
GGAUCCUGGGCUGUGGCA
dd*
UGCCACAGCCCAGGAUCC
Strand results:
Strand Sequence
sa
GGGCCACAGCGAUACAGAGCUCCCGAA
sd
GGAUCCUGGGCUGUGGCA
sb
GGGAGCCGCAAAAACGAAGCGCAGACCAC
sc
AGGUCUGUCUGUAAACCAGGAUCGG
Objective function:
Objective type Value
Weighted ensemble defect 0.00973
Ensemble defect: 0.00973

On-target complex defects:
Complex Complex defect (nt) Normalized complex defect
cstickfigure 0.144 0.00145
Tube defects:
Tube Tube defect (M) Normalized tube defect
tfigure 9.63e-07 0.00973
Complex contributions to tube defects:
Tube On-target complex Structural defect (M) Concentration defect (M) Total defect (M)
tfigure cstickfigure 1.43e-07 8.20e-07 9.63e-07
On-target complex concentrations:
Tube Complex Concentration (M) Target concentration (M)
tfigure cstickfigure 9.92e-07 1.00e-06
Significant off-target complex concentrations (≥ 1% max complex concentration in tube):
Tube Complex Concentration (M)
tfigure
In [3]:
# For more detail, display the analysis results performed on the designed tube ensemble
my_results.analysis_result
Out[3]:
Complex results:
Complex Pfunc ΔG (kcal/mol)
(sa) 7.2963e+6 -9.300
(sb) 1.0985e+5 -6.831
(sc) 5.3855e+4 -6.411
(sd) 1.0682e+2 -2.749
(sa+sa) 1.3227e+17 -23.201
(sa+sb) 3.5730e+18 -25.141
(sb+sb) 6.1891e+12 -17.334
(sc+sa) 1.8364e+15 -20.684
(sc+sb) 6.6467e+17 -24.151
(sc+sc) 6.3860e+12 -17.352
(sd+sa) 1.1953e+22 -29.917
(sd+sb) 2.0554e+19 -26.170
(sd+sc) 4.0646e+20 -27.927
(sd+sd) 1.3046e+14 -19.127
(sa+sa+sa) 8.0996e+27 -37.818
(sa+sa+sb) 3.5667e+31 -42.756
(sa+sb+sb) 9.2621e+27 -37.897
(sb+sb+sb) 2.1204e+21 -28.899
(sc+sa+sa) 3.7186e+27 -37.360
(sc+sa+sb) 1.1711e+33 -44.810
(sc+sb+sa) 3.4134e+25 -34.599
(sc+sb+sb) 6.8483e+26 -36.364
(sc+sc+sa) 1.8138e+25 -34.227
(sc+sc+sb) 1.8165e+27 -36.938
(sc+sc+sc) 1.5174e+21 -28.702
(sd+sa+sa) 8.1024e+31 -43.238
(sd+sa+sb) 9.4843e+35 -48.751
(sd+sa+sc) 1.2360e+36 -48.907
(sd+sb+sa) 8.7833e+29 -40.576
(sd+sb+sb) 7.3575e+27 -37.761
(sd+sb+sc) 3.7580e+34 -46.852
(sd+sc+sa) 2.0259e+28 -38.358
(sd+sc+sb) 1.0165e+27 -36.597
(sd+sc+sc) 9.2618e+29 -40.607
(sd+sd+sa) 5.8774e+31 -43.050
(sd+sd+sb) 5.3791e+28 -38.932
(sd+sd+sc) 6.7221e+28 -39.063
(sd+sd+sd) 2.2617e+24 -33.002
cstickfigure 5.0030e+54 -74.121
(sa+sa+sa+sa) 4.9539e+39 -53.790
(sa+sa+sa+sb) 2.7586e+42 -57.510
(sa+sa+sb+sb) 2.4526e+41 -56.086
(sa+sb+sa+sb) 6.0933e+44 -60.687
(sa+sb+sb+sb) 7.3189e+37 -51.309
(sb+sb+sb+sb) 1.6566e+31 -42.304
(sc+sa+sa+sa) 3.4036e+39 -53.569
(sc+sa+sa+sb) 1.5398e+46 -62.587
(sc+sa+sb+sa) 2.7859e+41 -56.161
(sc+sa+sb+sb) 2.5443e+43 -58.818
(sc+sa+sc+sa) 8.1008e+36 -50.014
(sc+sb+sa+sa) 1.5895e+37 -50.410
(sc+sb+sa+sb) 1.1887e+42 -57.015
(sc+sb+sb+sa) 5.6597e+36 -49.803
(sc+sb+sb+sb) 3.9540e+36 -49.592
(sc+sb+sc+sa) 2.2230e+39 -53.318
(sc+sb+sc+sb) 8.6883e+40 -55.475
(sc+sc+sa+sa) 2.7228e+37 -50.727
(sc+sc+sa+sb) 5.1991e+43 -59.238
(sc+sc+sb+sa) 3.2206e+35 -48.116
(sc+sc+sb+sb) 2.0476e+37 -50.559
(sc+sc+sc+sa) 7.4614e+34 -47.255
(sc+sc+sc+sb) 2.8406e+36 -49.397
(sc+sc+sc+sc) 1.3147e+30 -40.813
(sd+sa+sa+sa) 7.0757e+44 -60.775
(sd+sa+sa+sb) 6.7866e+45 -62.105
(sd+sa+sa+sc) 1.6608e+48 -65.342
(sd+sa+sb+sa) 1.9106e+46 -62.714
(sd+sa+sb+sb) 7.7559e+45 -62.184
(sd+sa+sc+sa) 5.9960e+43 -59.322
(sd+sa+sc+sb) 3.3892e+42 -57.631
(sd+sa+sc+sc) 8.3391e+46 -63.582
(sd+sa+sd+sa) 4.4940e+48 -65.928
(sd+sb+sa+sa) 2.7919e+40 -54.807
(sd+sb+sa+sb) 7.9413e+43 -59.488
(sd+sb+sa+sc) 9.4562e+43 -59.590
(sd+sb+sb+sa) 1.1982e+39 -52.954
(sd+sb+sb+sb) 8.6729e+36 -50.054
(sd+sb+sb+sc) 8.3313e+44 -60.871
(sd+sb+sc+sa) 4.8736e+42 -57.845
(sd+sb+sc+sb) 1.4393e+41 -55.772
(sd+sb+sc+sc) 7.8085e+44 -60.833
(sd+sb+sd+sa) 4.5687e+45 -61.872
(sd+sb+sd+sb) 1.3624e+42 -57.095
(sd+sb+sd+sc) 1.8854e+43 -58.641
(sd+sc+sa+sa) 7.2662e+41 -56.725
(sd+sc+sa+sb) 1.9599e+42 -57.309
(sd+sc+sa+sc) 4.6842e+41 -56.467
(sd+sc+sb+sa) 1.9310e+40 -54.590
(sd+sc+sb+sb) 5.8112e+37 -51.173
(sd+sc+sb+sc) 7.2097e+42 -58.076
(sd+sc+sc+sa) 1.2886e+39 -52.997
(sd+sc+sc+sb) 6.3004e+38 -52.576
(sd+sc+sc+sc) 6.6791e+38 -52.610
(sd+sc+sd+sa) 3.7955e+47 -64.473
(sd+sc+sd+sc) 1.5972e+45 -61.254
(sd+sd+sa+sa) 7.8733e+46 -63.548
(sd+sd+sa+sb) 3.3319e+48 -65.752
(sd+sd+sa+sc) 6.1991e+47 -64.762
(sd+sd+sb+sa) 1.1258e+44 -59.693
(sd+sd+sb+sb) 4.3339e+41 -56.421
(sd+sd+sb+sc) 1.5714e+45 -61.244
(sd+sd+sc+sa) 4.7031e+41 -56.469
(sd+sd+sc+sb) 1.1504e+39 -52.930
(sd+sd+sc+sc) 5.0363e+42 -57.864
(sd+sd+sd+sa) 2.4808e+44 -60.158
(sd+sd+sd+sb) 2.9435e+39 -53.483
(sd+sd+sd+sc) 2.7524e+41 -56.154
(sd+sd+sd+sd) 1.5291e+37 -50.388
Concentration results:
Complex tfigure (M)
cstickfigure 9.917e-07
(sb) 7.188e-09
(sa) 5.666e-09
(sd+sc) 4.821e-09
(sc) 2.691e-09
(sd+sa) 2.203e-09
(sd+sb+sc) 5.289e-10
(sd+sb) 3.192e-10
(sd+sa+sb) 2.074e-10
(sd+sa+sc) 2.065e-10
(sc+sb) 3.941e-11
(sa+sb) 3.293e-12
(sd) 1.398e-12
(sc+sa+sb) 9.780e-13
(sd+sd+sa+sb) 1.730e-13
(sd+sd+sa+sc) 2.458e-14
(sd+sc+sd+sa) 1.505e-14
(sd+sb+sb+sc) 1.391e-14
(sd+sa+sc+sc) 1.262e-14
(sd+sb+sc+sc) 9.960e-15
(sd+sc+sc) 9.955e-15
(sd+sc+sd+sc) 8.149e-15
(sd+sa+sd+sa) 5.538e-15
(sd+sd+sb+sc) 5.249e-15
(sd+sa+sa+sc) 3.907e-15
(sa+sa) 2.893e-15
(sd+sd+sa) 2.571e-15
(sd+sa+sb+sb) 2.013e-15
(sc+sa) 1.292e-15
(sb+sb) 9.612e-16
(sd+sd) 8.104e-16
(sc+sc) 5.784e-16
(sa+sa+sb) 4.629e-16
(sd+sb+sd+sa) 2.372e-16
(sd+sa+sa) 2.103e-16
(sd+sd+sb) 1.983e-16
(sd+sb+sa) 1.921e-16
(sd+sd+sc) 1.892e-16
(sc+sa+sa+sb) 1.811e-16
(sd+sb+sb) 1.356e-16
(sc+sc+sb) 9.762e-17
(sd+sc+sb+sc) 9.196e-17
(sd+sb+sd+sc) 6.298e-17
(sd+sa+sb+sa) 5.886e-17
(sd+sd+sa+sa) 4.851e-17
(sc+sb+sb) 4.819e-17
(sc+sc+sa+sb) 3.935e-17
(sc+sa+sb+sb) 2.522e-17
(sd+sa+sa+sb) 2.091e-17
(sd+sb+sa+sb) 2.061e-17
(sa+sb+sa+sb) 1.877e-17
(sd+sb+sa+sc) 1.874e-17
(sd+sc+sb) 1.431e-17
(sd+sd+sc+sc) 1.285e-17
(sd+sb+sd+sb) 1.192e-17
(sc+sb+sc+sb) 1.108e-17
(sa+sb+sb) 1.013e-17
(sd+sd+sb+sa) 5.844e-18
(sd+sc+sa) 3.384e-18
(sd+sd+sd+sa) 2.576e-18
(sd+sb+sc+sb) 2.404e-18
(sd+sd+sb+sb) 1.896e-18
(sc+sb+sa+sb) 1.178e-18
(sd+sb+sc+sa) 9.661e-19
(sd+sa+sc+sb) 6.718e-19
(sd+sc+sa+sb) 3.885e-19
(sd+sd+sd+sc) 1.839e-19
(sd+sa+sc+sa) 1.411e-19
(sd+sc+sa+sc) 7.091e-20
(sc+sa+sa) 3.686e-20
(sc+sb+sa) 2.851e-20
(sd+sa+sa+sa) 2.587e-20
(sd+sd+sc+sa) 1.865e-20
(sc+sc+sa) 1.157e-20
(sd+sc+sc+sb) 8.036e-21
(sd+sc+sc+sc) 6.506e-21
(sd+sd+sd) 5.002e-21
(sd+sd+sc+sb) 3.843e-21
(sd+sc+sb+sa) 3.828e-21
(sa+sa+sb+sb) 3.778e-21
(sa+sa+sa) 3.743e-21
(sc+sa+sb+sa) 3.277e-21
(sd+sd+sd+sb) 2.575e-21
(sd+sc+sa+sa) 1.709e-21
(sc+sb+sc+sa) 1.683e-21
(sc+sc+sb+sb) 1.306e-21
(sd+sc+sb+sb) 9.706e-22
(sb+sb+sb) 5.862e-22
(sa+sa+sa+sb) 5.043e-22
(sc+sb+sb+sb) 3.302e-22
(sd+sb+sb+sa) 3.110e-22
(sd+sc+sc+sa) 1.951e-22
(sd+sb+sb+sb) 1.897e-22
(sc+sc+sc) 1.868e-22
(sc+sc+sc+sb) 1.383e-22
(sa+sb+sb+sb) 9.498e-23
(sd+sb+sa+sa) 8.601e-23
(sd+sd+sd+sd) 1.070e-23
(sc+sb+sb+sa) 5.609e-24
(sc+sa+sa+sa) 4.751e-25
(sc+sc+sa+sa) 2.446e-25
(sc+sc+sb+sa) 2.438e-25
(sc+sb+sa+sa) 1.870e-25
(sc+sa+sc+sa) 1.455e-25
(sc+sc+sc+sa) 4.313e-26
(sa+sa+sa+sa) 4.299e-26
(sb+sb+sb+sb) 7.246e-27
(sc+sc+sc+sc) 1.956e-28