#!/usr/bin/env python
# coding: utf-8

# # Pretty-printing DNA and protein sequences with `monoseq`

# [`monoseq`](https://github.com/martijnvermaat/monoseq/) is a Python library for pretty-printing DNA and protein sequences using a monospace font. It also provides a simple command line interface.
# 
# Sequences are pretty-printed in the traditional way using blocks of letters where each line is prefixed with the sequence position. User-specified regions are highlighted and the output format can be HTML or plaintext with optional styling using ANSI escape codes for use in a terminal.
# 
# Here we show how `monoseq` can be used in the IPython Notebook environment. See the `monoseq` [documentation](https://monoseq.readthedocs.org/) for more.
# 
# **Note:** Some applications (e.g., GitHub) will not show the annotation styling in this notebook. [View this notebook on nbviewer](http://nbviewer.ipython.org/github/martijnvermaat/monoseq/blob/master/doc/monoseq.ipynb) to see all styling.

# ## Use in the IPython Notebook

# If you haven't already done so, install `monoseq` using `pip`.
# 
#     pip install monoseq
# 
# The `monoseq.ipynb` module provides `Seq`, a convenience wrapper around `monoseq.pprint_sequence` providing easy printing of sequence strings in an IPython Notebook.

# In[1]:


from monoseq.ipynb import Seq

s = ('cgcactcaaaacaaaggaagaccgtcctcgactgcagaggaagcaggaagctgtc'
     'ggcccagctctgagcccagctgctggagccccgagcagcggcatggagtccgtgg'
     'ccctgtacagctttcaggctacagagagcgacgagctggccttcaacaagggaga'
     'cacactcaagatcctgaacatggaggatgaccagaactggtacaaggccgagctc'
     'cggggtgtcgagggatttattcccaagaactacatccgcgtcaag')

Seq(s)


# ### Block and line lengths

# We can change the number of characters per block and the number of blocks per line.

# In[2]:


Seq(s, block_length=8, blocks_per_line=8)


# ### Annotations

# Let's say we want to highlight two subsequences because they are conserved between species. We define each region as a tuple *start,stop* (zero-based, stop not included) and include this in the *annotation* argument.

# In[3]:


conserved = [(11, 37), (222, 247)]

Seq(s, annotations=[conserved])


# As a contrived example to show several levels of annotation, let's also annotate every 12th character and the middle third of the sequence.

# In[4]:


twelves = [(p, p + 1) for p in range(11, len(s), 12)]
middle = [(len(s) / 3, len(s) / 3 * 2)]

Seq(s, annotations=[conserved, twelves, middle])


# ### Custom styling

# The default CSS that is applied can be overridden with the *style* argument.

# In[5]:


style = """
{selector} {{ background: beige; color: gray }}
{selector} .monoseq-margin {{ font-style: italic; color: green }}
{selector} .monoseq-annotation-0 {{ color: blue; font-weight: bold }}
"""

Seq(s, style=style, annotations=[conserved])


# See the string in `monoseq.ipynb.DEFAULT_STYLE` for a longer example.