In [7]:
cd /Volumes/Data/Sam/scratch/
/Volumes/Data/Sam/scratch

Quality trim & remove first 39bp from single FASTQ file

Code explanation:

java -jar /usr/local/bioinformatics/Trimmomatic-0.30/trimmomatic-0.30.jar

This line above initiates Trimmomatic and uses the following arguments to specify order of execution:

-single end reads (SE)

-number of threads (-threads 16),

-type of quality score (-phred33),

-input file location (/Volumes/nightingales/C_gigas/2212_lane2_CTTGTA_L002_R1_001.fastq.gz),

-output file name/location (20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz),

-single end Illumina TruSeq adaptor trimming (ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10),

-cut number of bases at beginning of each read (HEADCROP:39)

-cut number of bases at beginning of read if below quality threshold (LEADING:3)

-cut number of bases at end of read if below quality threshold (TRAILING:3)

-cut if average quality within 4 base window falls below 15 (SLIDINGWINDOW:4:15)

In [4]:
%%bash
java -jar /usr/local/bioinformatics/Trimmomatic-0.30/trimmomatic-0.30.jar \
SE \
-threads 16 \
-phred33 \
/Volumes/nightingales/C_gigas/2212_lane2_CTTGTA_L002_R1_001.fastq.gz \
/Volumes/Data/Sam/scratch/20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz \
ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 \
HEADCROP:39 \
LEADING:3 \
TRAILING:3 \
SLIDINGWINDOW:4:15
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_gigas/2212_lane2_CTTGTA_L002_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 HEADCROP:39 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 15796545 (98.73%) Dropped: 203455 (1.27%)
TrimmomaticSE: Completed successfully

FASTQC on trimmed file

In [5]:
%%bash
fastqc /Volumes/Data/Sam/scratch/20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz \
--outdir=/Volumes/Eagle/Arabidopsis/
Analysis complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Started analysis of 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 5% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 10% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 15% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 20% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 25% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 30% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 35% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 40% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 45% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 50% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 55% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 60% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 65% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 70% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 75% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 80% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 85% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 90% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz
Approx 95% complete for 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001.fastq.gz

Copy files to Eagle for web-based access

In [6]:
cp 20150506_* /Volumes/Eagle/Arabidopsis/

Unzip FASTQC output

In [12]:
%%bash
unzip /Volumes/Eagle/Arabidopsis/20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc.zip
Archive:  /Volumes/Eagle/Arabidopsis/20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc.zip
   creating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/
   creating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Icons/
   creating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Icons/warning.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Icons/error.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Icons/tick.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/summary.txt  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/fastqc_report.html  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/fastqc.fo  

Move unzipped folder to Eagle

In [13]:
%%bash
mv 20150506_trimmed_2212_lane2_CTTGTA_L002_R1_001_fastqc/ /Volumes/Eagle/Arabidopsis/