Quality trim all fastq.gz files using Trimmomatic (v0.30)

Code explanation of for loop below:

  1. %%bash specifies to use the shell for this Jupyter cell
  2. for file in /Volumes/nightingales/C_virginica/2112_lane1_[^N]* initiates a for loop to handle all files beginning with 2212_lane2_ and only those that do not have the letter "N" at that position in the file name.
  3. do tells the for loop what to do with each of the files.
  4. newname=${file##*/} takes the value of the $file variable (which is /Volumes/nightingales/C_gigas/2212_lane2_[^N]*) and trims the longest match from the beginning of the pattern (the pattern is */; the ## is a bash command to specifiy how to trim). The resulting output (which is just the file name without the full path) is then stored in the newname variable.
  5. This line initiates Trimmomatic and uses the following arguments to specify order of execution:
    1. single end reads (SE)
    2. number of threads (-threads 16),
    3. type of quality score (-phred33),
    4. input file location ("$file"),
    5. output file name/location (/Volumes/Data/Sam/scratch/20150414_trimmed_$newname),
    6. single end Illumina TruSeq adaptor trimming (ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10),
    7. cut number of bases at beginning of read if below quality threshold (LEADING:3)
    8. cut number of bases at end of read if below quality threshold (TRAILING:3)
    9. cut if average quality within 4 base window falls below 15 (SLIDINGWINDOW:4:15)
  6. done closes for loop.
In [2]:
%%bash
for file in /Volumes/nightingales/C_virginica/2112_lane1_[^N]*
do
newname=${file##*/}
java -jar /usr/local/bioinformatics/Trimmomatic-0.30/trimmomatic-0.30.jar SE -threads 16 -phred33 "$file" /Volumes/Data/Sam/scratch/20150414_trimmed_$newname ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15;
done
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_ACAGTG_L001_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 11370712 (71.07%) Dropped: 4629288 (28.93%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_ACAGTG_L001_R1_002.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 1327210 Surviving: 889732 (67.04%) Dropped: 437478 (32.96%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_ATCACG_L001_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 13657433 (85.36%) Dropped: 2342567 (14.64%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_ATCACG_L001_R1_002.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 13551447 (84.70%) Dropped: 2448553 (15.30%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_ATCACG_L001_R1_003.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 1409414 Surviving: 1173081 (83.23%) Dropped: 236333 (16.77%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_CAGATC_L001_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 12742235 (79.64%) Dropped: 3257765 (20.36%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_CAGATC_L001_R1_002.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 12468557 (77.93%) Dropped: 3531443 (22.07%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_CAGATC_L001_R1_003.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 7780221 Surviving: 6056165 (77.84%) Dropped: 1724056 (22.16%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_GCCAAT_L001_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 13494573 (84.34%) Dropped: 2505427 (15.66%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_GCCAAT_L001_R1_002.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 8792684 Surviving: 7316692 (83.21%) Dropped: 1475992 (16.79%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_TGACCA_L001_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 9188940 Surviving: 2827107 (30.77%) Dropped: 6361833 (69.23%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_TTAGGC_L001_R1_001.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 16000000 Surviving: 13428815 (83.93%) Dropped: 2571185 (16.07%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -threads 16 -phred33 /Volumes/nightingales/C_virginica/2112_lane1_TTAGGC_L001_R1_002.fastq.gz /Volumes/Data/Sam/scratch/20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz ILLUMINACLIP:/usr/local/bioinformatics/Trimmomatic-0.30/adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 9752634 Surviving: 8034025 (82.38%) Dropped: 1718609 (17.62%)
TrimmomaticSE: Completed successfully

FASTQC on all trimmed files using FASTQC (v0.11.2)

In [23]:
%%bash
for file in /Volumes/Data/Sam/scratch/20150414_trimmed_2112*; do fastqc "$file" --outdir=/Volumes/Eagle/Arabidopsis/; done
Analysis complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Analysis complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001.fastq.gz
Started analysis of 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 5% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 10% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 15% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 20% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 25% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 30% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 35% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 40% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 45% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 50% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 55% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 60% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 65% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 70% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 75% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 80% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 85% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 90% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 95% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz
Approx 100% complete for 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002.fastq.gz

Unzip all FASTQC .zip files

In [24]:
cd /Volumes/Eagle/Arabidopsis/
/Volumes/Eagle/Arabidopsis
In [25]:
%%bash
for file in 20150414_trimmed_2112_lane1_*.zip; do unzip "$file"; done
Archive:  20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/
   creating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_001_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/
   creating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_ACAGTG_L001_R1_002_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_001_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_002_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_ATCACG_L001_R1_003_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_001_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_002_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_CAGATC_L001_R1_003_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/
   creating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_001_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/
   creating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_GCCAAT_L001_R1_002_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/
   creating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_TGACCA_L001_R1_001_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/
   creating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_001_fastqc/fastqc.fo  
Archive:  20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc.zip
   creating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/
   creating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Icons/
   creating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Icons/fastqc_icon.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Icons/warning.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Icons/error.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Icons/tick.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/summary.txt  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/per_base_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/per_tile_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/per_sequence_quality.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/per_base_sequence_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/per_sequence_gc_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/per_base_n_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/sequence_length_distribution.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/duplication_levels.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/adapter_content.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/Images/kmer_profiles.png  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/fastqc_report.html  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/fastqc_data.txt  
  inflating: 20150414_trimmed_2112_lane1_TTAGGC_L001_R1_002_fastqc/fastqc.fo  

Concatenate groups of sequences into single files

In [3]:
cd /Volumes/Data/Sam/scratch/
/Volumes/Data/Sam/scratch

HB2 25,000ppm oil Index - ATCACG

In [4]:
%%bash
#gunzips all matching files in folder and appends the data to a single file:
#20150414_trimmed_2112_lane1_HB2_Oil_25000ppm_ATCACG.fastq
for file in 20150414_trimmed_2112_lane1_ATCACG*
do
gunzip -c "$file"  >> 20150414_trimmed_2112_lane1_HB2_Oil_25000ppm_ATCACG.fastq
done
In [5]:
%%bash
#Gzip file
gzip 20150414_trimmed_2112_lane1_HB2_Oil_25000ppm_ATCACG.fastq

HB16 25,000ppm oil Index - TTAGGC

In [20]:
%%bash
#gunzips all matching files in folder and appends the data to a single file:
#20150414_trimmed_2112_lane1_HB16_Oil_25000ppm_TTAGGC.fastq
for file in 20150414_trimmed_2112_lane1_TTAGGC*
do
gunzip -c "$file"  >> 20150414_trimmed_2112_lane1_HB16_Oil_25000ppm_TTAGGC.fastq
done
In [21]:
%%bash
#Gzip file
gzip 20150414_trimmed_2112_lane1_HB16_Oil_25000ppm_TTAGGC.fastq

HB30 25,000ppm oil Index - TGACCA

In [8]:
%%bash
#gunzips all matching files in folder and appends the data to a single file:
#20150414_trimmed_2112_lane1_HB30_Oil_25000ppm_TGACCA.fastq
for file in 20150414_trimmed_2112_lane1_TGACCA*
do
gunzip -c "$file"  >> 20150414_trimmed_2112_lane1_HB30_Oil_25000ppm_TGACCA.fastq
done
In [9]:
%%bash
#Gzip file
gzip 20150414_trimmed_2112_lane1_HB30_Oil_25000ppm_TGACCA.fastq

NB3 No oil Index - ACAGTG

In [10]:
%%bash
#gunzips all matching files in folder and appends the data to a single file:
#20150414_trimmed_2112_lane1_NB3_NoOil_ACAGTG.fastq
for file in 20150414_trimmed_2112_lane1_ACAGTG*
do
gunzip -c "$file"  >> 20150414_trimmed_2112_lane1_NB3_NoOil_ACAGTG.fastq
done
In [11]:
%%bash
#Gzip file
gzip 20150414_trimmed_2112_lane1_NB3_NoOil_ACAGTG.fastq

NB6 No oil Index - GCCAAT

In [12]:
%%bash
#gunzips all matching files in folder and appends the data to a single file:
#20150414_trimmed_2112_lane1_NB6_NoOil_GCCAAT.fastq
for file in 20150414_trimmed_2112_lane1_GCCAAT*
do
gunzip -c "$file"  >> 20150414_trimmed_2112_lane1_NB6_NoOil_GCCAAT.fastq
done
In [13]:
%%bash
#Gzip file
gzip 20150414_trimmed_2112_lane1_NB6_NoOil_GCCAAT.fastq

NB11 No oil Index - CAGATC

In [14]:
%%bash
#gunzips all matching files in folder and appends the data to a single file:
#20150414_trimmed_2112_lane1_NB11_NoOil_CAGATC.fastq
for file in 20150414_trimmed_2112_lane1_CAGATC*
do
gunzip -c "$file"  >> 20150414_trimmed_2112_lane1_NB11_NoOil_CAGATC.fastq
done
In [15]:
%%bash
#Gzip file
gzip 20150414_trimmed_2112_lane1_NB11_NoOil_CAGATC.fastq

Copy files to Eagle for web-based access

In [19]:
%%bash
for file in 2015*e1_[NH]B*; do cp "$file" /Volumes/Eagle/Arabidopsis/; done
In [ ]: