In [1]:
import os
os.chdir('/fastmode/E_coli_K12_1D_R9.2_SpotON_2/downloads')
In [5]:
from Bio import SeqIO

lengths = open("E_coli_K12_1D_R9.2_SpotON_2.lengths.txt", "w")
for seq in SeqIO.parse(open("E_coli_K12_1D_R9.2_SpotON_2.pass.fasta"), "fasta"):
    print >>lengths, len(seq)
lengths.close()
In [6]:
!head -10 E_coli_K12_1D_R9.2_SpotON_2.lengths.txt
5527
5629
979
1822
4882
4840
6719
19327
2428
55504
In [19]:
%load_ext rpy2.ipython
In [48]:
%%R
library(ggplot2)
lengths = read.table("E_coli_K12_1D_R9.2_SpotON_2.lengths.txt", header=F)
ggplot(lengths, aes(x=V1)) + geom_histogram() + xlim(0,100000) + xlab("Read length") + theme_bw()
In [49]:
%%R
library(ggplot2)
lengths = read.table("E_coli_K12_1D_R9.2_SpotON_2.lengths.txt", header=F)
ggplot(lengths, aes(x=V1)) + geom_histogram() + xlim(50000,200000) + xlab("Read length") + theme_bw()
In [56]:
%%R
library(ggplot2)
lengths = read.table("E_coli_K12_1D_R9.2_SpotON_2.lengths.txt", header=F)
nrow(subset(lengths, V1 >= 50000))
sum(subset(lengths, V1 >= 50000)$V1)
[1] 57497394
In [28]:
!wget ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_refseq/Bacteria/Escherichia_coli_K_12_substr__MG1655_uid57779/NC_000913.fna
--2016-08-02 14:15:54--  ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_refseq/Bacteria/Escherichia_coli_K_12_substr__MG1655_uid57779/NC_000913.fna
           => ‘NC_000913.fna’
Resolving ftp.ncbi.nlm.nih.gov (ftp.ncbi.nlm.nih.gov)... 130.14.250.7, 2607:f220:41e:250::7
Connecting to ftp.ncbi.nlm.nih.gov (ftp.ncbi.nlm.nih.gov)|130.14.250.7|:21... connected.
Logging in as anonymous ... Logged in!
==> SYST ... done.    ==> PWD ... done.
==> TYPE I ... done.  ==> CWD (1) /genomes/archive/old_refseq/Bacteria/Escherichia_coli_K_12_substr__MG1655_uid57779 ... done.
==> SIZE NC_000913.fna ... 4708052
==> PASV ... done.    ==> RETR NC_000913.fna ... done.
Length: 4708052 (4.5M) (unauthoritative)

100%[======================================>] 4,708,052   3.23MB/s   in 1.4s   

2016-08-02 14:16:02 (3.23 MB/s) - ‘NC_000913.fna’ saved [4708052]

In [29]:
!bwa index NC_000913.fna
[bwa_index] Pack FASTA... 0.08 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 1.60 seconds elapse.
[bwa_index] Update BWT... 0.03 sec
[bwa_index] Pack forward-only FASTA... 0.02 sec
[bwa_index] Construct SA from BWT and Occ... 0.57 sec
[main] Version: 0.7.12-r1044
[main] CMD: bwa index NC_000913.fna
[main] Real time: 2.448 sec; CPU: 2.299 sec
In [*]:
!bwa mem -t8 -xont2d NC_000913.fna E_coli_K12_1D_R9.2_SpotON_2.pass.fasta | samtools view -bS - | samtools sort - -o E_coli_K12_1D_R9.2_SpotON_2.sorted.bam  
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[M::process] read 8852 sequences (80014358 bp)...
[M::process] read 8994 sequences (80006436 bp)...
In [33]:
!git clone https://github.com/arq5x/nanopore-scripts.git
fatal: destination path 'nanopore-scripts' already exists and is not an empty directory.
In [37]:
!python nanopore-scripts/expand-cigar.py --bam E_coli_K12_1D_R9.2_SpotON_2.sorted.bam --fasta NC_000913.fna > E_coli_K12_1D_R9.2_SpotON_2.sorted.expanded.bam
In [38]:
!python nanopore-scripts/count-errors.py E_coli_K12_1D_R9.2_SpotON_2.sorted.expanded.bam > E_coli_K12_1D_R9.2_SpotON_2.error_profile.txt
In [41]:
%%R
library(ggplot2)
align=read.table("E_coli_K12_1D_R9.2_SpotON_2.error_profile.txt", header=T)
subset(align, align_len==max(align$align_len))
                                                                 query
49722 6c7359e0-8260-461c-9293-fd9a78e2ee6a_Basecall_Alignment_template
      read_type read_len align_len unalign_len matches mismatches insertions
49722  template   131969    137946          74  120545       8311       3039
      deletions tot_errors
49722      9090      20440
In [43]:
from Bio import SeqIO
import sys

for rec in SeqIO.parse(open("E_coli_K12_1D_R9.2_SpotON_2.pass.fasta"), "fasta"):
    if rec.id == '6c7359e0-8260-461c-9293-fd9a78e2ee6a_Basecall_Alignment_template':
        SeqIO.write([rec], sys.stdout, "fasta")
>6c7359e0-8260-461c-9293-fd9a78e2ee6a_Basecall_Alignment_template nanopore2_20160729_FNFAB24462_MN17024_sequencing_run_E_coli_K12_1D_R9_SpotOn_2_58342_ch445_read76_strand pass/nanopore2_20160729_FNFAB24462_MN17024_sequencing_run_E_coli_K12_1D_R9_SpotOn_2_58342_ch445_read76_strand.fast5
CGTACTTCGTTCACGGTTACGTGTGCTGTTTCGCATTTATCGTATTGAAACGCTTTCGCG
TTTTCGTGCGCCCTTCAGCAGTTTATCGGCAAAGGAAGATGAAGTGCGGTCCACTTATAA
TACACGGACAGGCGCCACTTCACCGGCAGGCTTCCTTGTGGTAGAAAACCGCACGCTTCC
TGAATGATTTCTGCACTTAAGTACCAATCTTAAACCAGTGGCTCGCCATTTGGTGAATTC
ACAGGTTGAGCGGCGCTCCAGCGCCTTGCGATAAAGCTTTCCCAGGGCAAATCGCCCAGC
AATCCCAGAACCACGACAGTTTGAGGGACTCTTGCCGGTTTCATCACAACCTTCACCGTT
TCACACTGAGAGGTAATCTGTAGATCTTAACAGTATTCCGCTTACGATGACAGTACATCT
GGGTTTTGAATGATGAAGCACGGTCTTTTGGTGTAATCCAGGAGACGCAGAGCCAGTATT
AAACGCCATTGCCATATAACTTGGCAACCGAATACCTCTTCCTACCTCACCCACCATCAC
CACGTCACGTTGGCGGCATAAGAGCTTGTTGGAAAGTTTCTAAGTGTGGTGTATGGTCCT
ACTTGAAGACACAAGATAAGGGAACAACACAGGTAGTCAAAGATGGCGAAACCTGCCTTC
GTTTGGGGCATGGTGAAGTGTAATTGCTACGCCGAGTCACACTGGGACATATCTGTTACT
TCAGTAAACCTTCTTATCTATTTTGCGGCGTACTGTTTTCTGGTGGGTGTGGTCGGTTGT
TTGAAGGACAACATCACAAATGTATCAATCATAAAAGTTAAATTACGTTACCTGACGATA
CATTGGTATGTTGTGCTCATGAATATACCTTATCAAATATGGCATTGCTTTGAGTATTCT
TCCGCACGATTTGTCCGCAAATGATTATTATCGTAAAATTCAAATTTACAGGCGAAATCA
TCACTACCGTAATTCTGAAAAATGAGCGGCAAATTAATGTTTTTAAACAGCAGATAATGG
TTAATTAATGTAATTAATGAAGAAAACATTATTGCAACAACCTGAAGAGCGTTTTGCACG
ATTTAAGATCAAGAAAGATAGGTTCTGATAAAACTTTCTTGTCATCGCTCCTTCGCCGTT
ATGATCGGTCGTCTTTTAAAACACTTCTTGTACACACATGAAGGCAAAAGCGATATTATT
GCCTCGCCTCTGTCCTGCTCATTAGGTTTACCGATACCAACAACGTTCAACAGCACGCAC
AGAGCCTTTCTGACTGGTCAAGGGAAGCAGCAAAGTTTACAAGTCAGGCACGATGATGGT
GGACGATGGGACGTCCTATCGCGCCAGATGGTGACTTGTGGGCTTTCGACGGCATTGAGC
TAGATAAATTCAGAAAATGACAGATTAAAACCATCTTACGCAAGCCAGAAACTATCTCCA
GTCTTAACTGCAGGCAGAGCCGTATATGTACTGGATAGCAGGGCAAGTTAAAACGTAACA
GCCTATGGAACTAACACTACTACCTGTGGAGGCGCTTTTGATCCTCGCAACGCGTCTGGC
GCCAATGCTGTGGGCATCTGGCATCATTCCGAGCACAGGGCGCAATTATGGTTTGAAACA
GACCCCATAATTATGACGCGCGCGTCGCGATGTTGTTGCTTCAACAACTGCCGCGCTGAA
TATGATGCAACGTCTGAACAAAATGTTGACGGCGACTGACTTCAAGCCATATGGCTTATA
ACAGCGAAAGGTCGGTCGCTAATGAAGGCAATTAAAACGAACAAAGCGTGATCCACGGAC
TTCTGTGGTCGTTACCGTTACCACAAGAAACAAAACGATACAGTACCTCCATCTGGCATT
GGTGATATTCTCCAAAACAGCAAGCGTTATGGCGTACGTCTGGCAGCCAGTAAAGCCGTG
CTCTGGCGCGTGTGCACCTGAGCAGCCGGTTGGAAATGGCGAAGGTAGATATGGCGGGGA
TTTCCGTCAGCAAGCTGAAGACATTCAACGCTGTCAAAGCTCCACTAGGCACCGGTAGCC
CTGGTATGGTGGTGCCAAGAAGCATGCAGATCAACTGCGTGAATCGTCTCGGCTTCGAAG
AGCACAGAAAGTACTGTACAGTCAGCGCTAGTTGCCGACAATACATAACTTAACAGCCGT
GTTTACCGTACGCTCTGGCAGCACTTTCAAGTATCGCTTCACGTCTCTCGTAAGCACCAA
AGATTTGCAGCAGTGGAACAAACTGCGCGGATCTAGCTGAAGCCGGGCCAAGGTTGACGA
TTGGTGCAGGCGGTAGCGCACAGCGACTGGCAAACAGCGACAACGTACGTATCGTGTGCG
CAAAGGCGATTCGCTTTCAAGCATTGCTAAACGCCACGTGGTATCAAAGATGTGATGCGC
TGGAACAGCGACACTGCAGATCTGCAACGGGCGATAAGCTGACGTTGTTTGTGAAAACAA
CAACATGCCAGATTCCTGACAAACCGAATAATAAAAGGCACCGATTCCCCGGTGCCTTTT
ATTATGCCGCTTTTGCGTACCTGATGATATCACTGGGTGAAAAGCCATCATTCTGCAAGG
CAAAATGGATTTCTCCTGTCGATGCGCTCTGTTGGTAAATGCGAATAGCGTCTGCTAACG
CTTCTGGCGTACGCATTCTCGCGACCCATGAAAATTCCAGCAGTAACTTATCTGTAATTA
ATTATCGACTTCTCTCAGATTGGCTTCATTGATTAACGTCAACCACTCACCGCTGGCGTG
TAGTTTCGTACGCTGAGAGGTATCGTAATGCTACCGTCTGTAACCAGATGTCGCGCGCTG
GGTGACCGGAACGACCGTCCATCACAATCAGCCTGCCGGTTTAATATCCTATTACTTCTC
GCAGTACTGCACCAACATCTGCCAGTGATGGTAGAGAATAACAGCTGATAACAATATCAA
ATGCGTTATCAGCAAATAGCAGAACTTTCAGCATATCCACAGCGGGTGGTGATATTTTCA
GTTCTGGGGCTTCAGCCTTGTGCAACATCAACATGTGGGCAGCAGATAAGTCATACATAC
CACCGCTCACGTTGCGCAGCATACGTTGATCTGCCATGGCAGACCTGACATGCTGTTATC
GAGCACTACGGGACTGGAATTCAAAGCCATGGGATTGTGATCTGAGCGCGCATAGCAAGT
ACAAACTTCACTGGCTTGTTCAGACCGGTAAAAGCTCAAAATCGAGCAGGCAATAAACGC
CGACGGCGGCGATCATCAGTAAAACACTGTGCTTTTAGCATTTCCCGCACGCAAAAGCGA
TATAACGCGTTCATCCTTCTACGGCTCGGGCATTTGAAATCTCTCCCGCCGCCAATGGGC
CGCGCTGTGGTATGGCTATCGATCGCCAGCAAGGAGTAACTGCCTATAGACATCACGCGC
AGACTGAAGTTGAAGCGGCGTGTATATTCTCCCTATCAACACCGGCAAGTGTCAGGTAAT
GGATAGACCGTCACAATGCCGACTTCGCCAGACGCAAAATGGGTTCTCGTTCACGTAACG
GGCAGCAATACGCACTGGATGTGCCATGAAAGGGTCATTACATAGAAGGATGTTGCTGTA
CTTTAAAAGGTACCTGATCGGCGGCAAGATAGTTAGCGGTCGCAAACTGTACCTGCTCTG
GCGTTGTCTGCGCTTCCTGCAATAACACCAGATGTGCATCTTTGCCGTAGTTCTTTAATA
CCGACAACCATTCAGCGCGTTGCTGTTTATATTCCCGCACCGGGATCCGGGCCAATGCTG
CTCTTCCAGTACTTAACGGTTCCCAGTGGTAATGCACGGCCGATGCTCATAAAGGCCAAC
CCCGGCAGTGAATCTTTCCGCAGGTTGTCCGTAACATAGCACGGCATAGGTGTTTCGCAC
TTTGACTGAAACCTCTATTACGTGTAGCCCTTCCTCGGGAGTTCACTGATTATAGGGATT
TTAGCTCACTCTTTCAACGAGCAATTGTATGTTGTTATGTAAGCAAGTGCTTACCGGTCA
GAATTTTGCTCATTATGGAGAACATTAAATCGCATGACATATCACGCACGTATCCTGATG
GTTTAATGACAAATAATTCAAAATATCTCTCTTCTATTTTGCAGCAGGGCAAAAAGCCTA
AAGCCGTCGGAAGAACTCGCCATTTTGTTTCGGTCATTAAAAGCAGCAGCTTTAGCCGGG
CAGCGGAACAATTAAGGCAAGCTCGAAACTCAGCAGTAAACCAGGCGGTGAAAAAGCTGG
AGATGAAACTTGGCGTTAGCCTGCTTAATCGGACCACGCGACAACTTAGCCCTGACGGAA
GAAGGCGAGCGTTATTTTCGTCGCGTACGAAGTCAATTTTGCAGGAGATGGCAGCAGAAT
CAAGTATGGAACGCGTAGCACCGCGCGTGGACTGTTTACGGATCGTCCCCACATAACTCA
ATGGTGCTGCACTTTCTGATGCCGTTAATTAAGCCTTTCCGTGGAACGCGCTATCCGGAA
GTCGCTGTCCTGATCTCACCTCCGAAACGATTAATTTGATCGAGAAAGAAAAAGTAGATG
TCGCGATACGCGCTGGTACGTTAACGGATTCAGCTTGCATTGCGGGGCCAGTTATTAACA
GTTATCTCGAAGAAGTATCGCCTCCCCGGTGTTCCGCTGCGGGAATCTTAGAAACAATCG
GCAATTCAACAACATATTGCACAGAGATTACAAACCGCCCTGTCCCCACTTCAGCGCCCG
TAGCGATGAACAGTACATAGAGTGAAGTACAGTTTATCATCAATAGTAGAAACACTGAAA
CAACTTTGCCTGGTAGCAACAGGATTGCGTGTTCCGACTACATAATCGACAAAAATCGCT
CGCAGAGAGTGGTAGGTGTGTAGATAAAGTATTACCAGTAAATACCATTCAGTGCCGTCT
ATTACAACGTGCAGCAAAATACACCTATCAAACTTCTCATTTATAAACATATAAACAACT
CCAGAAACTATCAAACTTCTCATCAGCTCAAAACTAGAACTTAACTTCCAGGCTTCTTTC
GAGCAGTCGTTGCAATCAGTGCAACGATCGCTTTATCTTCAACATCAAGCTGTAAATTTA
TGCCGCCAAATTACTCAAATTCCCCATTAATAAAGTGCAAGTAACCCCATGGCCACGCAA
AATCTGTGCCGGGTGCATTGTGTTTGGCTTTGCGATACGAGCAATAACCTCATCTTCAGG
GCCTTACCATGCGCCAGCGTCATATGGGAAGTAATATGGATGCTGGGTAACTGTTTACTT
GAGCAACCACTTCGGTTTTGCAGATGGGAAAGTTCGAAATCTGGTTAGTATGATGTTTCA
GCACCAACAGCAGCAATCACTTTTCATGTCTTGCGGATCTCGTGGTAAATACAAATCTCA
CGCGTCAGCCTTGTTTTAGCTTCCAGCGCGCCATAAAACTCTTCAACAGAGACCATCGTT
TGGTGACGGCCAGTGGATTAGCGTCGAATCAGCATAATCGGTACGCAATTTTGCAGGCTC
TCTCTTTCCAGACTTAGGATCAATTGTCTTTGCTGAGATTTTCAATCCAGATTTTAGTGG
TGATGTAGAGTTCTGACGTGGCACGCCACTTTCTGCAATCGCCTGACCTACTGCGGCTTC
GTTATCATGGTTGTGCGGTATCGTTGCGCGATAACCAAGTTCAAGCGCCGTTATCACAGA
TGAAATAACAACGTCGTCTTTCAGACGGAAAGTGCCTAAATAAATGGGATAATACAATAT
ACGCACTCTTTTAATATATTTTCATTAACCGAGGTGATTATGGAGCTGAACTATTAAGAA
GGAAAAACGTAAATACAGAAGATTTTTGCGAGTTCTGGCAATAATAATAATCTCTAGACG
AAAAACCTCGAAGCGACTAACTCAAGGGCTTCATATCGAGGCATGGAACAGACAGGACTC
GAACCCGCGACCCCTATGCGTGACAGGCAGGTATTCTAATAAACTGAACTACCGCTCCAC
CAGATTCTTTACAACCACCGGTTTTATGACCGGCTTACTGCTTAATTTGATGCACGGCGT
TCCCTATACTCTCGCCGAGGAGACCCACACCATCGGCTACGGCGTTTCGCTTCTGAGTTC
GGCATGGGGTCAGGTGGGACCACCGCGCTACGGCCGCCAAATTCTGTTTTATCAGACCGC
TTCTGCGTTCTGATTTAATCTGTATCAGGCTGAAAATCTTCTCTCAATCCGCAAAACAGC
TTCGGCGTTGTAAGGTTAAGCCTCACGGTTCGTATGCGTACCGGTTAGCTCAACGCATCA
CGCTGCGCTTACACACCCGGCCTATCAACGTCGTCTTCAACATTCCTTCAGGACTCTCAA
GGAGTCAGGAGAACTCTCTCATCTCGGGAACAGATTTCGTAGATGCTTTCAGCACTTATC
TCTTCGCATTGCTTCGGGCGGGTGCCATTGGCATGACGAACACCAGTAGTACGTCCACTC
CCGGTCCTCTCGTGCCAAGACGGCCCCTCAGTTCTCCAGCGCCCGGCAGATAGGGACCGG
GTGTCTCGACGTTCTAAACCCAGCTCGCTGTACCACTTTAAATGGCGAGCAGCCATGCCG
CGGGACCTACTTCAGCCCGGCGGGATGGCGATGAGACCTGCGACGCTCGAGGTGCTGCTG
CTTACCTTCATCAATGTCTGCGCTCTTAGCGGTATCAGCCCTGTTATTATCCCCGCGGTA
CCTTTTATCCGTTGAGCGATATGGCCCTTCCATTCCAAATTCCTGGATCACTATGACCTG
CTTTCGCACCTGCTCGCCGTCCGCTCCACCGGTAGTCAGGCCCAGCTTATGCCATTACTC
GCCTCTGATGTCCGACGGGTGTAACCTTCGTGCTCCTCCATTCTCTTTAAGAGGGGCCGC
TATCGGCTCCACCAGACACTGCTCCACCACTTGAATTACAGGTCAACATTAGGCTCAAAC
CTTCGGGGTAGTGACCTTTCGGGTCCAGCTCCATGCAGACTGGCGTCCACACTTCGCCTC
CTATCCTGCACATCCGGCTCAATGTCGGTGTCGCGAAGCTATAAAAATGGGGGTTCCCGG
GGTCTTTCGTCTGCCGCGGTACACCATCTTCACAGCGGTTCAATTTCCTGAGTCTCGGGT
GAGCAGCACGGCCATCATTACGCCATTCGTGCAGGTCAGCTTACCGACAAAATTCATACA
GGACCGTTATAGTTGCGGCCGCCGTTTACCAGGAGCTTCGATCAAGGCTTCGCTTGCGCC
TAACCCCATCATGCTGCCCGGCACAGAGCAGGCATCCCGCGTACGTCCACCATTGTTTGC
ACGGTGCTGTTTTAATAAACAGTTACGCAGCCAGCTGGTATCTTCGACTGATTTCGCTCC
ACGAGCAAGTCGCTTCACCTACATATCAGCGTGCCTTCTCGTTACACTTTCCTTTTCGTT
CCTTGCAAGTTCTCCTCAGCACCTTAGTATTCTGCCTGACCACTGCAACGTGTCGGTTTG
ATTTGATTGGTACCTGATGCTTAGAGCTTTTCTGAAGCAGGGCATTTGTTGCTTCAGCAC
CGTAGTGCCTCGTCATCACGCCTCGGCCTTGATTTTCCGGATTTGCACGGAAAACCAGCC
TACGCAGCAAGCCAGGCAACCGTCCTTCAGCCGCCTGCGCCTTCTCGTCCCCGCAGTGCC
CCGAAGTACAGAATATGCCTGTTTCCCATCGACTACGCCTTTCGGCGGCCTGTAGGGGTC
GACTCACCCTGCCCGGTGGCGTTGGACGCAGGAACCCTTGGTCTTCTACCGGCGAGCAGA
CTTTTCACCTTTATCATTGCTTGTCTTATTCGCACTGATACTCAGCGCCACCTCCAGTAC
ACACCTTCCAAACACAGAACCTCCCCTACAACAACGCATAAGCGTCGCTGCCACCTTCGG
TGCATGGTTTAGCCCGTACATCTTCCGCGCGAGCCGACTCGACCAGTGAGCTGTACTTTC
TTTAAATGATGGCTGCTTCTAAGCCAGCATCACGGCTGTCTGAGGCCTTATCGTTTACCA
CTTGCAACACCGATTATACTTCGCAAGCGAGGTCTGGGTTGTTTCCCTCTTCCACGACGG
ACGTTAGCACCCGCCGTATGTCTCCTGATAACATTCTCGGTATTCTGCAGTTTGCATCGG
GTTGGTGATCAGGATGACCTGCAGAAACAGTGCTCTACCCCGGAATGAGTTCACGAGCGC
TACCTAAATAGCTTTCGGGGAGAACAGCTATCTCGTTTGATTGGCGCCTTTCACCCCAGC
CACAAGTCATCGCTTCTTAATTTTCAGCATTAGTCGGTTCGGTCCTCCAGTTAGTGTTGC
AACCTTCAACCTGCCATGGCTGGTCACCGGGTTCGAATTCTCTACCCTACAACTTAACGC
CAGATTAAGACTCGGTTTCCTTCGGCTCCCCTATTCAGTTGCTACCGTATAAGTCTGACC
CATTATACAAGGTACAGTCACACGCCTATATAAGCATGCTCCCTGCTTGTACGTACACGG
TTTCATTCTTTTTACTCCCTCACCGAGTTCTTTTCGCCTTTCCTCACGGTACTGGTTCAC
TATCGGTCAGTCAGGAGTATTTAGCCTTGAGTGGTCCCCCATATTCAGACAGGATACCAC
GTGTCCCGCCCTACTCGCTCGAGCTCGGCATGTCGTGTTTTGTGTACGGGGCTGTCACCC
TGTATCGCGCCTTTCCAGACCACTAACACACACACACTGATTCAGGCTCTGGGCTCCTCT
CCCGTTCGCTCACCGCTACTACTGGGGAATCTCGGTTGATTTCTTTTCCTCGGGGTACCA
GATGTTTCAGTTCCCCGGTTCGCCTCTCGATAACCTATATGGTTGATTAATGATAAGTGT
AGCCAAACACTAGAGTTTCAATTCAAATCGCCAGATTCATAACGGTTCATATCACCTTAC
CGACGCTTATCGCAGATTAGCACGTCCTTCATCGCCTCGACTGCCGGGCATCCACCGTGT
ACGCTTAGTCGCCTCACAACCCGAAGATGTTTCTTGCGATCCGCCATCATCGTGTTGCGA
AAATTTGAAGACTCACGAACAACTTTCCTTTCATTGTTCAGTGTTTCAATTTTCAGCAAT
CCAGATTTTAAAACAAACTTCGCGAGTGAACCTTTGCAGGTACTCTGAAGTATTTTATTT
AACCACTACAGAGATGGTAGACTATGCGAGATCGAACCGCAGACCTCCTGCGTGCAAAGC
AGGCTCTCCCAGCTGAGCTATGACGCCCCATAACGTATGTAGTTAAAACTCTTCGGTGCC
GTTACAGGGTGGTAGACCTGAAGTGGACTTGAACCACCGACCTCACCCTTATCGGGGTGC
ACTCTAACCACCTGAGCTACAAGCCTCGCAAAGTTTACTGCTCATTTTCATCAGACAATC
TGTGTGAGCACTGCAAAAGTACCTTCTTTAGGTAAGAAGTGATCCAACCGCAGGTTCCCT
ACAGTTACCTTGTTACGACTTCACCCAGTCATGAATCACAAGTGGTAAGCGCCTCGAGTT
AAGCTACCTACTTCTTTCGCCCTCCATGGTGTACTGACGGGCGGTGTGTACAAGGCCGGG
AACGTATTCACCGTGGCATTCTGATCACGATTACTAGCGATTCTAAACTTCATGGAGTCG
AGTTACGAACTCTCAATCCGGACTACGACGCGCACTTTATGAGGTCGCTTGCTCTCATAG
TCGCTTCTCTTTGTATATGCGCCATTGTAGCACGTGTGTAGCCACAGTCGTAAGGGCCAT
GACTTGACGCGTCATCCCCACCTTCCTCAGTTTATCACTGGCAGTCTCCTTTGAGTTCAG
CCGGTGCTGGCAGCAAAAGATAAGGGTTGCGCTCGTTGCGGGACTTCTTAACATTTCCAC
CTGCTTACGAGCTGGCGACAACCATGCAGCACCTGTCTCGGTTCGAAGGCGCAATCCATC
TCTGGAAAGTTCTACCTGTGGATGTCAAGACCGAGTAAGGTTCTTCGCGTTGCATCGGGT
AAACCATGCCACCGCTTGTACGGGCCCGTCGGTCATTTGATTTTAACCTTGCAGCCGTAC
TCGGTGGTCGACTTAACGCGTTAGCTCCGGGAAGCCACGCCTCAAGGGCGCGCAACACTC
AAGTCATCCGTTTACGGCGTGGACTACCGGGGTATCATCCTGTTTGCTCCCACGCTTTCG
CGCACCTGGGCATCAGTCTTCGCGTCGAGAAGGCCGCCTTCGCCACCGGTATTCCTCCAG
ATCTCTACGCATTTCACCGCTGCACGAATTCTACCCCTCTACGAGACTCAAACGCCGGTA
TCAGATGCAGTTCGAGGACGGGCCGGGATTCATCTGACTTAACAAACCGCCTGCGTGCGC
TTTACCTTGGTAATTCCGGTCCTTGCACCCACTCCGTGTATTACCGCGGCTGCTGGCAGG
TTGTAGTGCTTCTTCTGCGGGTAACGTCGAACTAGTATTATTAACTTCTCCGCCCTCCCG
CTGAAAGTACTGCAGCAAAAGCCTTCTTCACTTACGCAGCATGGCTGCATCAAACACGCC
CATTGTGCAATATTCCCCTGCTGCCTCCGTGAAAGTCTGGATGTCTCCAGTTCAGTGTGT
GGTCATCCTCTCAGACCAGCTAGGGATCGTCGCTAGGTGAGCCGTTACCTACTAGCTAAT
CCATCTGGGCATCCATTAACGAAGGCGAGGTCCTGGTCTTGCGGCGGTATGCGGTATTAG
CTACCGTTTCAATGGTTATCCCATCAGCGATTTCGAACCTTCTCACCCGTCCGCCCTCGT
CAGCAAAGCAAGCTCTTCCTGTTGTGCCGGTCGACTTGCATGTGTGGTAGGCCTGCTACT
GCACCAGCGTTCAACGTCTGGCGGCCGCCAATCAAGCTCTTAATTTAAAGTTTGATGCTC
AAAATTAAACTTTGTATTAATTCCAATGTTCTCCTTGAGACTTGGTATTCCATTTTCTCA
CGACATTAGAATCCATCTTGAGTACCCCAAGATTATCATCGGTATTCAAGAGCAGTTGCG
ACGCGGCTTTCAGCTCACTGCTCGGGGTGGCGCCATGCGCTTTCCTCTAAAGTCAACCCT
GAATTTCAGGATTTTTCTCTTCAACCGAACCAGCTGTTTATTGATGATTCACATCCATAA
ATGTCGAGGCGCATTATGAGAGTCGGCTCAGGAGACAAGCGGAAAAATGCATTATTTCAA
CCGCTCTCATCTTTTAATCATTGTGCCGGTTTTGCTGCTTTTATCGCTTGCGGCAGGTCT
GCCGAATATTTAACACCCAATCCGCCGCGTTTTCTGCTTCAGGCGTAGGCAGTTTACCAT
ACACACCAGCACTTTTGTTCCCACGTTCGCCTGACCGCTGCCTGCATATCTTCTAATTTA
TCGCCCACCATATAAGAGCGGCCATATCCATGCAAATGTCGTGACAAAAGCATCTCCCAG
ATGTGGATTTACGGCAATAATCACCAGACCAGCGAAACTCTTCTTCCCTCCCGGATGATG
CAGGCAATAATAGATACCATCAGATCGTGGCATCTCGGTCCGCCAGCGACCAGTCCATCC
CTCGGGTCTTGTTTCGCTACTTAGTAAATTACCGCGAGCAATGCCAGACTGGTTGGTTAC
TACCACCAGCGCAAAGCCCATTTTTAGCTCGCGCATGGCGTCAATAACACCGTCGATAAA
TTCAAAGTTGTCGATCTCTTGGACATAGCCGTGATCGACATTAATGGTGCTATCACGGTC
AAGAAAAATTGGTACGCTCTTCGCCACCTTTATAGCTCTCCTTAATAAGGCATGTGACGC
TAGTCATGTTTCGACCTGCGAAAGTGCTCTTCCGCTCGCCCTGATTGATTTAGACGTCTG
GATGCCTTAACATCCATTTCGTGACGGCGTTGCCCGTTTCAGGCATTCAGAGATGCCCGA
CTAACAATGACGATAATAGGCGTAATCAATGATAAAGCTTTCGAATATCACCAAAGTGTT
CCAGGGCTTCCCGCACCATCCGGGCGTTGAACAACGTCAGCCTGCATGTGGACAAATTGT
AGCGTTGTATCGGTACCTCAGGCGCGGGTAAAATGCCTTATACGTTGTGTAAACCTGCTG
GAGCGCCCAACCGAGGTGGCGTATATGGTCGATGGCGAGGAACTGACCGCTTGTCAGAAT
CGAGATTGACAAAGCTCATACCGCCAGATTGGTATGATTTTCCAACATTTAACCTGCTCT
TCGCGTACTGTTTTGGCAACGTGGCTCTGCCGCTGGGCTGGACAACACACACCGAAGACG
AGGTCAAACCTCGCGTGACGGAATTGCTGTCCATTGGTTGGTCTTACTTGGCGGCGATAA
GCATGATAGCTACCCGTCGAATCTTTCCGGTGGGCAAAACAACATGCTGGCAATTCTTGC
GATACGTTGTAACCATCAAAATGCTACTGTAGTGACCACCAACGCGCTGGACCCCGGCAA
CGACACGTTCTATTCTCGAACTGCTGAAAGACATCAACCGCCGTCTGGAATTTGACGATT
CTGTTGATCACCCACGAATAGACGTTGTGAAGCGCATTTGTAATGATTGCGTGGCGGTCA
TCAGCAATGTGGAGAGCGATCGGGACACGGTAAGTGAAGTATTCTCGCATCGAAAACGCC
GCTGGCGCAGAAGTTTATTCAGTCGACCCTGCATCTGGATATCCGGAAGATACGGGAACG
TCTGCAAGCGGAGCCATTTACTGACACGTGCCGATGCTGCGTCTGATTCACGGTCAATCA
ATTCGATGCCCTGCTTTCTGAAACCGCGCGTCGTTTCAACATCCTGTAACATTATTAGCG
CGCAGATGGATTACGCCGGTGGCGGTAAGTTCAACATCATGCTGAAGCTGAAAATACGGC
ACACAACAAGATACCGCAAGCCGCCATTGCACGGCTACGAACACCTCTAAAGTAGAGAGG
TACTGGGTTGGTTATGTCTGAGCCGATGTGGCTGGTTCATCAGCGTATAGAAACGCTGGC
CGACCTTCGTAGTTTAGCTGAATTGTGGTCTGCCGGTTGGCGTTCTGCTATGTCACGCGT
CCGGGGCAAATTATTACTAACGCAAGCTACTTATCAATACCGTTTCTGCGATTGTGAACA
TTTTCCATTCCATCCGTTCATTATCTTGCTTGTATGGATGATTCGTTTACCCGCGTTATT
GTCGGTACATCGATTGGTTTGCAGGCAACGTTGTTCCGTTAACCGTTGGTGGCACCGTTT
GTGCCCGTATGGTCGAAGACGCTCTGCTGGAGATCGCCGCCAGGTTAAGTAGAAGCTTCC
CGCGCAATGGGTGCCACGCCGATGAATCGTCCATGTAAGGTGCTGTTGGAAAGCGCTGCC
GGGTCTGAGTAGTGCGGCAACTATCACCCTGATTACGGTGGTTATTCCGCGATGGTGTAG
TGCAGTCAGTGCCGGTGGTTTAGGTCAGATTGGCTATCAGTATGGCTACATCGTATAACG
CGACGGTAGTAGAATACAGTACTAGGTATTGCTGGTCATTCCTGGTTTATTTAACCATTC
AGTTGTTCGCAGGCGACCACATCGTCCGAGCTGTCACTCGCAAGTAACGTTGTACAACAA
ATAATTGAAGAAGGAATGAAGTATGGCGTTCAAATTCAAAACCTTTGCGCGACGGTAGGA
GCCTGATCGGATCACTGCTTTTCGTGAAAGCTGCGGTCAGATTAAAAATCCGCTCCCGAC
TAAAGTCGGCGTATTGTTGGTGCCGAACAGCAGGTTGAAGTCGCGCAGAAGACTGCGAAG
ACAAACAGCACGGACGGTGGCTGGTAACCTTCAACGACTGTTCTGCCGTGACTTGTTAAG
GCAAAGGCGATATCGACCAACGCCTTCCAGCATAAACCGTACCTTGATCAACAGCGAAAG
ATCGTGGCTACAAACTGGTCGCAATGCGGCAACACTTTGTTTATCCGGTGCTGGTGCTCA
AAAATCATCCACCGGATGAACTGCAGGATGGTTCGCAGGTTGCCGTGCCAAACGACCATG
CGCCTTGGTCGTTCACTGCTGCTGCTGCAAAAAGTGGGCTTGATCAAACTGAAAGATGGC
GTTAGCCTGCTGCCATGCGTTCTTGATGTTGTTGAGAACCTTTAAAAATCTGAAAATTGT
TGAACTGGAAGCACCGCAACTGCTGCCGCGCGTTCTCTGGACGACGCACCATCAACTCGG
CGGTTATCAATACCACTATGCACCAGCAGATTGGCCTGACTCTCCGGCGAAAAGACGGTA
TCTGTTGAAGATAAGAAGTCCGTACATATAAACCTGATCGTGACGCGTATGAAGATAACA
AAGACGCCGAGAACATGAAGAAGTGCGTCCCGGCTTATCAGTCTGACGGTTACGAAGCAG
CAAACAAAGTGTTTAGCGGCGGGCTGTTAAGAGCTGGTAATTTTAGGCTGTTTCAATTTG
TAATATCATTCAGGACGGGCACTTGCCCGTCTTGTCGACCTAGCTCCTGATTCCAATATT
GACGCGATCATACATTGAGAAATACTATGCGTGCTTTACCTGTTTAGTAGCACTCATGCT
AAGCGGCTGTTCCATGTTAAGCGAATCCCTGCTCGAACCCCGTTCAAAGCACCACCCCAG
CCGAAAGCGGAGCCTGCAAACCAGCACCGCACCGCCAATGATCAAATTACTCTATGCAGA
AAAATTAATTCTCAGCGACCGTTCCGCGATCTCGGTGAAGTCGTGGCAGCTCTTACGAGC
TATCATCAGGACTCTCCGCCGGCATTCCAACCGCACATGCATGGATGCAAATCGCCTCAC
AAATGACCAATGCTGTATTACTACGCCGCTGCAGAAGTCACCAGCAGTACGCCGGTACTA
TCGTCAGGCTGTATGTATCGATTCTGCGCTTAACATTACGGCGAAATGAGCGGTTTCCAG
TTCGAGCAAATAGGCGTTATTCGCTCACCCTATAAAAAGTTCGCCGTTCATGGCCGGTCT
GGTAAAAGCGCCAACGGCGGGCACCATCATGCTCCCTACAACGGGCCGACGCCGTTCTTG
GCACAGGCGTTCAACCTGCATTTATGGATCCTTTTCGTCTTTCATCGGAAACGATACGGC
GGCTGGCGTCCGACTGTGCGTCCACCGCATAAGCGTGTACTTGCCAGAATAAGTTCCATA
ACGGCCTGCTTTCCGCCCCTAACTTAATTGTAATAAAGCTGGTAGAGCTGAAAGAGTTGT
TGCCATAAAGACGGCGTGATTCTGGCTCGGCAGTCTGGATCTGGTCGAGTGATGGTACCT
GTTAGTGGATATCAAACCGTATCTTCCTTTGCCGAATCGCTGATGCAGTGCCAGCTATGC
GCAAAGTGCGCAGCTGCGAGATATGGCGGTGAGTTTTACCGCAGAGTCGAAAAGCAGCTT
TGACGCGACGTTATCCGCAATTCTTACTGTTTATCCGCGAGGAAGTACTGGCACAGGACC
CGCGCCCGGCCTATCGTAAGGTGAGAAACAGGCAAAACCATGCCGTCTGGCTACATGATT
TTAACGTTCGCTGGCGCGTCACCGACGCAGGTTTTGAAGATCTTTGCGCTGGAACCGCGT
TAAATTCACGCGCCCTTCTCTTTTGACATTTCTTTTGCACTGGTACTTGAAGCTAAATCA
CTTTTTGTCGGGCTCGCGCCAGGCCTGTTCTACCTTCTTCCAACTGGAACCTTCAACCTT
GTGCGTACTAGCCAATACCTGCCTCTCCACTCTCCGGGAGACACCTGCAAAACGCCAAAG
GTAATCGTATACATCAACTAATGCTGCGCATGAGATGATCCGCAAGCTGTCTCCGGGTTA
TATACTGGCTGCACCGACCGGCGTGCGCGCGTTCTGAAAAAGTCGAAAACATCGTGCGTG
AAGAGATGAACAACCTGCCAGGCGTTACGTCAGTGTGTCGATGCCGGTGGTTCCTTGTGA
TTTGTGGCAGAAGGTGGTCGTTGTTGGGAACAAGCAATTCTCCAGAACTACTGCGTTTCT
TGGCCCATGTGAAGCGACTCCGTTCGTACTCGGCCAACTCCATGAAAGTTATCACTGACC
TGATTCATGTGACTTAGCTCTTACAAGCAGCTGCCATGTGAACTTCTATCAGATCAGCCA
AGTTCATTAGAAATTACACCGTACTGTTCACGGCGTCTGCGCGTTCCGCAATTCCTGATA
AAGATGCTACTTCTCTTTCCATGTACTTCTCAGGAGATCCCCGGAAACCTACGATGCCGT
AATGTATGCGGCCTACAGCAAAATCTTCAGCCGCATGGGGCTGGATTTCCGCGCCGTACA
AGCCGACGCACCGGTTCTACTACCCATCGGCAGCGCCTCACGAATTCCGGTGCTGGCGCA
GAGCGGTGAAGACGATGTGGTCTTCTCCGGCACCTCTAGCCTTCTGCGGCGAACATTGTG
AACTGGCGAAGCTATCACGCCGGGGCCGCGCGCTGCTGCTGCAATAGCCTTTGGTTGATA
CGCTCGAACGCGGCGACCATCTGGAACTGGTTGAACAGTTCAATCTGCCGATTGAAGAAG
GCAGTTTAAAACTCCTACCGTTCCCAAAAGCAGCAGTTTGAAAGCAACACTTCCTAAGAG
TTGCACTGCTGGTGCGCGGTGATCACGAGCTGAACGAAGTAAAGCAACTGCCGCAGGTTG
CAAGCCCATGACTTTCCGCGACCGAAGAAGAAATTCGTGCCGTGGTTAAAGCCGGTCCGG
GTTCACTGGGTCCGGTAAACGCCTACCGATTCGGTGACGAATTAGCCCGTACCATTGCGG
CGATGAAGTGATTTCGCGCTGCTGAACGCTTCTTATCAATGCATTAACCTGCTTGCCAGC
ATCTTCAGTCGCGATGTCGCTACGGAAGTTGCAGATATCCGTAACGTGTGGTGACTGGCG
ATCCAGCCCGGATGGCGAGGTAGGCTGCTGATCAAACGTGGTATCGAGTTGGTCCCTCTT
CCAGCTGGGTACAAGTACTCCGAAGCACTGAAAGCCTCGTACAGGGTGAAGATGACGTAA
CCAAATCCTGACGATAAGTTTTGCTACGGTATCGCGGGGTAACGCGTGTGGTGGCACAAG
CAGCGATTGAGCAGAACTACGACGAACGAGGCATCGTATGGCTGGCCGCTATCACGCGCT
GCGTTCAATTGGCGATTCTAGCAAATGAACATGCACCGATCAGCTAACGTGCAAGGCTTG
CTGAGAAACTGTACGGCGAACTGCGTGCGCAAGGCATCGAGAGATGGATGACCGCAAAAG
AGCGTCCAGGCGTGATGTTTGCTTTGATATTGATTTAATCGGTATTCCGCACACTGTGCT
GGGCGTATAACCTCGACAACGACGATATCGAATAAATATCGTCGCAGCGGCGAAAACAGT
TAATTAAGACTGGTGACATCGTCGAATATCTGGTGTAGAAACAAATTAAAGCTGATGCCA
GAAAGGGTCCTGTAATTCAGGGCCCTTTTATGGATTGTATAAATGGATAAACCAAAGGCG
TACCTGCCGCCTGTTTCTCCCAACTTTCTTTACTTTCGGCTTGTACCGTTGTCCTCAATA
GCAATAGGCCATCAACCCAGCAATGCGAAAGCCACTTATGGGCTCTCCTGCGAATTCAAC
ATCACTTTCACCGAACAATCAATAAAAATAACGGCACCTGATCTCAGCCCGGCGATTTGC
TGTTCTCCTCAAGCCTTGGGGTGCTCGGAATCCGCGTCTTCAGCACTTCCTCTGAGTCAC
GTTACGGAAAATCTTTCTGGGTGATAATAACGTTGCAGAAGCGACAGGCGCTGGCGTCCA
GATCGTTCCTTAAAAGCGATGAAACATAGTGATAAGCTTTTGTCTTACGGAGTCCCGGAT
ACCCGCAACAAGCCACCGTCTCACCCGCGTTGTTTTACCCAAAATAAAATCAAAGATAGC
GGTTATAACTATCGCAGCATTGTCGAATTTATTCCTTATATGGTGACTCATAGATATGTA
CTCACTGGTGTTCTCCGAGATTTTCCGCCGCCGTTACGTCAGCTTTGGCAACCTGGTCAT
GATGTGGGCAAAGAGACAAAAGTCCGTGGTTTTGTTTCCGAATTTGTCACGGATGCCTTT
GCCAAAGCGGGCATCCACTTACACTGGCGCAATCGGGCTGGATTAGCCCTGCCGATCTGA
TGCATATGCGTATTGGTGATGTCTGCGTTTAATGAAACGCAGATTACAGTATGTTGGGCA
CCTGAAGCGGGATTTATATCAAGGCAGGTCGCTTTGTTGTTGACCCGGTGATAAAGTAAA
TGCCTTATCCATATAGGTATGAGGGGGTTGTAGGCGTGATAAGACGCGCCAACGTCGCAT
CAAAACGTTGAGCACCATTGCCGGATGCAGCATCGCTTATATCCAGCCTACAAACTTGAT
GCAAATTCAAAATGTTGAAATATATCCTTCTGGCCTGTTTGCTTGGGTGTTTCTGTCTCA
AGACGGGTTACTGCCCAAACCTGCAATCTGGTTGGGGTAAAATTTCCTACCGTATCGGGT
GCCAATACTTTAGTCGGCGCGCACCGGTCAGATTACCACCCTCAAAATAAGTAATATGCA
AGCAAATATACGGTTTTCCTGTGACCGCGCGCAGCCAGTGCTTTATCCAGCTCTGCGATT
TATTCGCTACCATGGCTTGTTCCGGTCGCACTGATGGTAGTCCTTACATCAGCCATATAA
AAATACATACCCGCAGGCTCGCCAGCGTCATAGGTAAACGGATTGTGCCGCCAGCGTATA
GTTGAACTGCGATTCAATCGGATTGCAGCTTCCGATCGAGCATCTCGCACATCGCCTTTC
GCCCGATAATAAGCTTTTCACCTTTGCTGTCAGATTCATACCGAAAAGCATCGGCGGTTC
GCGCCCATGTACCGTAGGAAGCGAAGGAGAGTTCTTCGAGCACCGAGATAACGCTCATTC
ATCACCCATGTTCCGTCTTTCGAGGAACAGAGAGGTTTCATTCATGCAATCGGCACACGG
CAACACGCCGCCAACTGCGGCATCGGTTTTGATTCGGCAGCCTGCGCCGGAAAGCAATAT
CGACTTCGGCCCGGTGTACATCCATCAGAGTAAAAGCTGATTACAGCCATCGCTGTCACT
ATCGCTTTTCACCATCCATTCCTTCTTTTTATTCCCGACCACTGCACGCACCGCGCATCA
CCTTCACGCTTGATTTTGTGCTTTCGATGCCAGCCTGCTGCCTCTTTCGATGCAGGTGGG
CCGCGTGGGTCGTCGGGCTTTTTCTGTTGTTAATTCTTTAATGTAGCCACCAGCCGGGCA
GAGCTGCTTCGCTGGTTCAGTTCCTGACTGCGGTATTCCTGTATGTGTAACCAATCACGC
CATCACTGCTGATCAAATGATGGCTGGCGGCGGCTGAACGCTCTTTGTAATACTCTGGCA
GGCTGGACGCGAATGTCAAAACGCAGATGAATAGCCGTTGAGGTCTTATTAACATGCTGC
CGCCCGCGCCCTGCGCACGAATGGCAGTGATCTCAAGCTCACCACCATCATGAAGATATG
TCATGTCGGAAATCACAATCATGAAGGTTGTTGCCGGGCGGTTAAATTCACTTCAGATTA
TTCTTATCATCGATAACTGAATCACGCCATCCTGAATCGTTGCCTGCAGCGTCAACATTT
TGATCAGCGAAGCACCACCATGGTGTTCATCGTCAGAATACAGAGCAGAAAATTGGCAAA
CTGCACATTGCTCTGATTTTGCTGCCACCAGATTTGCGCCGCCGACGCTATTATAGGTAA
ACAGCGCGCGCCACTTCTACGGCACAGGTACGACTTTCTGCATCCGCCGCTCATCCGGCA
GCTAGCTCAATCCACAAATCAATGCCGAGGTGATCATTACGCAGCCACGCTTCCGGCTCA
TCATCGGCACACAAACCTACGGAAGTAAGTACAGACGTTCATCGGCATATTTCAGCCACG
CCAGCAAGCGCCTTTGTCCACTACGCTCTGGGTTTGAAGGATGGCGCGCCAGCGTCGAGA
GAGGCATCGAGAAGCTGGTTACGCGGTCGAGATCGGCCACATTAACCGTCGCTATAAGTG
GTGTCCCTTTAAGCATACATAAGAAAACTCCTTTCGAATCCAGGAGGCCGTTGTAACGGA
GATACGTGCGGTTGCGGCGCGCTGATATTGCGCAGAAATGAGTGTGGTATAGTCACCTTG
CCAGGAAACGAGTTTATCTTCTGCGTGAGCTTGAACTTGCATCCACGGTTGAAGTCAGAG
TGCTGACAGGGCATGTGAAAATATTGTGGGGTTATTCTTCACGCACCAACGAGAAGGCAC
GCAGCGAAATCGCCACTTGGAGACTTGGGATACGTTCCGGACATAGCATGAACGCGCGTT
TTGAAAGTGCTGAATGAAATGGCTGCCGGCAGTGACGCGCCCTTTCCTGCAAAAAGGGCT
GTCGGGAAAAGCAGCGCGCTGCGGCAAACTTACTGGTGAGCGATTATGTCAATGAATGAT
ACGTATCGCTAAATCAGTGCGGTGAATTACGATAATCTTGAGCTCGCCTACAGCATCATT
GTGCTGACACTTACGAAAGATGGCGAAAATTGCGAGAAGGCAAAAGCCGGTGATTTAGTC
TCCCGCAAAAATGTAGATGCACGGTCGTCGAAGGGCCGCTGTACAGAAACCCGCGAAGCT
GCGTGGATAAGTACCAGCTTTAGCCACCCGGAAATCGGTACGGTGGTGGTAAGCGAATCC
TGATTGACTTTCTACCTGGATGCGACGTTTGATGCGTCTTATCCGGCTTTCATATTCGGC
GTTTTCTGAACCAAGCTTCGCCATTCTCACCTTCACACCTTCTTGCGTCACAAATACCCC
TGCCGCCGCATCGCAACGTTTCGCCATAAACAACAGTGGTAGTGTCCATAAGCCGGCGGC
GCCTTCTTGCCAGATTTTTCTTTGGCTTACGTCCGCCGTTACGCCGACAATATGCAGCAA
TCACGGCGCTTCGACACTTACGCTGACGCTTCATCTCTGCACGGAGGCAGATATCTTACT
CCGCATTAAGCTGTACACTTCCCAGCCCGCCGGTAATTCCAGCGGTTGAGCCCGTCTGCC
ACGGCTGATGTTTCGCTTGCCCGGTGACGGATTTGTCCACCACAGTTGCGACTGATAGCG
TCGTTCGCCTGCATGTCCGCTCAAAATTAGAGCATCTTGCCTGCTTTCCTACTTCTGAAT
CCTCACCAACGCGTCGCGGGAAGGCATCGGTGCATTCTACCTGCCAGCCAGCGGCGGATA
ATCGCCGCGGCGGGCATCCTCCATCCTGCTTGTGCGCAATCCGCAGCGTCCTGCGGCGTT
GACGGTGTGCTAAATCATCTGCCAGCAGTTCATCCAGCAGGCTCTCTTGTTCGCGCTGAA
AGTGCAGCGCTACGAGCCGGTACCGGCAAAATACGGCCAGCGCTGCTGCAATAACGGCAC
TACGCGCAGGCGCGAAAGTTACGATCGTGAGTCTGATTGCTTTCGTCGCCAATCCAGCAA
ATCATGCTGACGCGCCCACTGCTGGTTCCCCGCGGTAGACGAGCAACGGGCGAATAAGCC
GCGTTCCGGCAAACTCCGAGACTTCCGCCATGGCCGGCAGCCCGGCAGGGCCTGCCGCGT
TTAGCGCCAGCAAGGTTTCATTGATCGTCGATGTTGCGGTGACCAACTACAGGCAACAAG
GTGCTGGTAATGCTGATAACTGCCTGCGCGCGCCTGTAGGCCTCAATGCCCAGTCACTTC
TTGCGCAAGTTGTACGCGTTCGACCACCAGCGGCACCTGCCACTGTTGGCGAACGTTTTC
GCAATGTCGCCAGAGGCATCGGCATTGGCGCCGGCCGTATTTTATGAATAGCGCGCAGAG
CGGCACGGATTTCCGTGCTTCCTGCTGTGATGCAGCAGAACGGTGGAGTCAAGCCGCTAA
AGGCCACAGAATCTGGCGTGAGGTGAAAGTTGTCTATTGAGCGTGAGTGTCATGATGGTG
CCGCGTTTTACAGCAATGCCCGGCACGTTACCGAACCGTGCGGCGATGACAAACCTTGCT
CGCATACAGTTCAACGGCAGCCCGTCCGGATCGTTAAAGAAGGTGAAGCGTTTTGCGTGC
TGTATGGATCGACACGGATGGTTTCACACTTCGGTATGGCACAAAGGTGCACCACTGCCA
CCTCGATGTCATCAACGCTAAAAACTGACGCAGGCCGCAAGCTTCCGGTCGGCTGGGTCG
TTCAGCGGGAACGGAAATGAAAGCTCAATCACATGTGTGCCCATTAAGCGCCGTCCTTTC
CGCGGTCGCGCGCTTCGCGATATATGGAGCTTCTACTTCACAATGAGGCAAGAATATCGC
GGTAGAAGCTTTACCACCGCATAATCCGTCTAATAATCGCAATATGGTGAACCTGTTTAA
ACCCAGCATAACGTCTCCTTTGTTGTTAACAGCGTTGCCAGCCGGAAGCCGCTCTGGCAA
GTTATCCCGCCATTTAGGACTCGTACGGTAAACGCCGTCTTCCCGTCCTCTGTTCGCGCC
GTAGAATATCCGTTCGCCAGGGTAATGTTGCCCCGACGAACAAAGCATCAGTAGAAAATC
AGTACTGTGCGGCTCTCTTTGATCCTTTCTCGAGGCATCCCAACAGCAACGAGCGCCGGT
GGATAAGGCAGGATCATGCCGATACTCTGGAAGGCCAGTTGTTCCAGCGCAACTTTCTAC
TTCGCCTTTAATTTGTCGTTGCCATACCTGATGTGGCGTCGCAATCATCCTCAACCGAAG
TATCAAGAATGCCCTGCACTTATCAAAACCAGGAATCGGTATTTACCGCAAGATCAAGCT
TATGGATCCCTTGTGCAGATCCTGAATACATATTGCGGTGAAATCGGGATCTTCTGCAAG
ATCGGGTAGCATATTTTGATCCGCAGGTTGAGATCGTAGAGCGTTTGAATTCCGTCAACC
CGCAATAATCCCATTGCTTTGGTTTATCGATGCAATACTAAGAAACAGCAGGTTATAAGG
GCCGGTTTCTCTACTACGTCCACGTTCGTCAGCGAGGAATTTTGCTACCAGCGCCGCCGG
GATCCTCTCGCTCATATTGCCTGCTCGTCCATCCCCGGTATTCGAAATGGTGACTTTAAT
CGCGGATCAGCTGCTCTGATCAGCATCCGCATCATTCAAAGCCGTGCCACTGTTCGCCGA
GGCGCAACGGGCAACATTCGGCTTCATCTGATCTACGGCGGTTGCCAGATATCGAAAACC
AACCGTCAGACTCTTCCGCAGCCGCTGGACCTCTTTACGAGCCAGGCTCGTTCTACTGAA
CGGTTAATCAGCCGTTTGCCCGGATTACCACGCAGCATCGCCGCCGCCGTCTCAACCAGA
AGCAACAATGGGATAACTGGGCGAGGTGGTGGTATCATCTTAAAGGCTTCGTTAAAAGGC
CTCTTCGTCCTTACTCGCCTTTAATGTGGATCAGCGAAACGCCACGTCACCACCATAGCA
TTTTGTGGGTCGATTGCTGAATCTTTTCCGCAACACGCTCGCCGCTCATACCACTTTACT
ACTGGTAGATCAGCGGATGAAAATGGGTGTGTACGGCACCGAGGAGCAGAATCGAAGTGA
ATCGGCTTGGACATCCAGCGTCTGTTTGACGATCCAGTCGGTGTTGTGAAACAACCATCA
TAGGTGGAGTTAGTCACCCTTAGACAACCATTGTGCTTGCGTGGTAGCAGCGACTTTCTC
TTCGATGCTGTCGCGAGTAAATTCACGGCGCGGATCCCACAAGAATCTGCACCCGTACGC
GTCGGTTTCAGCCAGACTGGCACCCCATCGTTCATCTGTCGCCGATGATGCGCCGCGATT
TATGACAATTGCGGTTGATCAACAGCGTACTGCCGGATGGCGCGGCATTACATACCCATA
TAGGTACAATGCGACGTCGATGTTCGTTGGTGACGATATAACTCTGTTCCGCGCAAAGTC
CGCGCGATGTACTCTTCCTTCCAGGTGTAGCCCAGTGTGGTCGAGCAACAGACAACTCAG
TAGCCAAGAAATAGAGGCATCAGCCGCAAGTATTCCACCGAAAAATCATAAAACAGACCT
TAACCGGGCTTTTGATATGCAGTGCCGCCCATATGCCGGCGTACAAAAGGTGTACTTCCG
CTCCTTTGTTGGCAGCAGTAGCAAGGCTTTCGTGAACGGCGTGTAATGTTATCAAGATAT
TCTCGGTGTACTGACGCATACGAGAATGGCGATATCTTCCGCTGCCCAGCACCTGCCAAA
AACCAGGCGCCATCCGCATATCCTGCGCATGACATCCATCGTCGAGTGGGTGTTGATGAA
GGCATAAAGCAGGAGATATTCATTAAGCGTTGATATCGCTACATAAATCGAGACTGTACT
CATCAGTCAAAAATCACGCCGCAAATTCGAGGGTTATACTCGTCCAATTCAACAAATCAA
CACTATTTGTGGCCCGAATATCTGAAAGCCTTGCACTTCACCAGCGCCGACTCCAGTTCT
TTGATGGGCTCATCACAAAAGACTACATACGGTCCCATAGCAATGATATTCCTGTGTTCT
CTGAAAATCCTTATATCCACCGCCTACTCAAACCGTGGCGATAAAGGGCCACCGAAGTGA
CCCTTTCAGAACTTTGCGAATTACGCGGCCGTATCATCAAGCACTGATAACGACAATTTT
TAAATCTTCAGTGCTGCTACATCAAGATCAGCGGCCAGATCCTCCGCCAGCAGTTGCGCG
CTTTCAACGATGCCGCCATCGCTTCGGGTTACGGTGAGCACCACCAGTGGTTCGGGATGA
TGGAGTCGTCAGTTTCAGTTCTTTCAGACGCTGGGCAATGATACCATCGCTTCAGCCGCC
AGCGGCGCGCGTCGGCGCTCTTCCACAAGTGGACGCACAACCTTCCGGCGAGATAACGGA
ATAGGTGCTGTGCAGCATATTCACTTTATCGCCCGCCAATCGCCAGCGCACCGCCGAACC
ACCTTCACCGATAACCCGTACCGACTACCGGTACGCCAGAACATTTCACGCAGGTTGCGT
GCAGCCGCTAGACTAACCACTCTGCGCCCGCCGGAATAAGCCCCGAGGTGTCGTCGCGGT
GATGATAGGCATCTTAAAGCGTTCAGCCTTGTTTGCATCAGACGCAGTGCTTTGCGGTAA
CCTTCTGCTTTTAGCACTGCAAAGTTACGGCGAATTTTTCTTTGGTTTCGACCTTTTTGA
TGACCAATGATCATCACCGGACGACCATCGAGACAGGCGATACCACCGGTGATAACTTTA
TCGTCTGCATACGCGCGCAGTCGCCAGCCAGTTCGTCAAATTCTCATCAAATGCCGAGCG
AACATAATCCGGGAAATTCTCAAGACGCTGTGGATGTGGCGTGCCAGTTGCGCAATCTGC
CATGCACCGAGATCGGCGAAGGTACGTGTCAGTTCTACGCTTTTTCACGCAGACGACGCT
TCTTCATCGATGTTAATATCCAGTTTCTGTCCTGACGGCTAACCGCAGTCAGAGAATCGA
TTTTCGCTTCCATGCAGTGTTTCAAAATCAAGAAATTCAGACTCATAGTATTCCTGTAGT
CAAACTCAGTTCCACCTGCTCCGAACAATGAGGCCACGAGATCGTTGTCGTCGCTCGGAA
GACACATACGTCGCGCCAAACGCAACCGCGCGTGCATCCGCCCTCTGATAGTAAAGATGT
ACAAGGTATCCAGAGCAGGTAGGGTTAGGGCAAACAGAGTCAGTTCAGCTGGTCATCAGC
GCACTATGTCCGTCAGCGAGATAGCAAGCCGCGAGCATATTTCCCGGGCTTCGTCGTATC
CTCACTTCATGACGGTCATTTCATGCTGTAAGTCATCAAAGCCTGTCCGCTGACGATAAA
GTATGCAGTCTTTTCCAGCAAATTGCTGGTATTTATCGAGGGCGTCAGTAGTAACATCAC
TTCTTCGCAGGAACGGTCATCCAGCGTGCAGATACCGACCGATTGCCGCGGCGGTGACCG
CAACCGCGGCAGCAACGAACCCGCAGCCGTGATGACTTTACCGTTCTGTCGGGTGCTGTC
TTTCAGCCGCCGCCTCCGACCTGCTCAATCTCTTTTAAATGCTGGTGCGTAGGGTGTGTC
CGGTCAGGTACAGGCTAACACCGTTCCCATCTGACCACCTGCTCCAGCCACGGTTGTAGC
AGCTTCTTGTTAAGATTATTTCAATTTGTTCCGGCTCTTGTGCCACTGTGAACTATCGGC
CTGACCGATAGCTTCCACTTTCGCGTGATCTGCCGCGCAACATCGCCCAGCGAGTTCATC
AGCGCTGCGCAGTGTGGCCCAAAGACAGATCCGCTTCTTGGACGCGATCAATTTCTTGCT
GACGGTTCCTTTTTGGTGTCGGTACGGGCGCGAAGATCAAGCAGTTCGCGGAAGTAGCCG
CCTTTGTACGGCTTCGATGATGACGCAATGGACCTTCGCGACCCCGCCCAATCGCGCCAA
TACCATACGTTCGCCGTCGTCGTTGACGATAGTAAAGACCGGAGTTTATATCTGGTGGCA
GGATTTTCAGCCCATCCGCCAGCACTCATCCACCAGACCCACCACCTTCTCGGGTGTTGT
CCATATCGGTCGACCCTGCCGCCATAAACTCCGCAGGATAGTGCGCTTTCAGCCATAACG
TTGATATGACACCAAAGCGGCCGCAGAGTGCGATTTGTTAAATCCGTAACCAGCGAATTT
CTCCACCGGGTCGAAGATTTTCATCGCCAGTTCAGCGTTGATTCCGTTCTTTTCTACACC
TTCAGCGGCTCCGAAACGTTGCCGCCATCTGCGGCTTTTCTTACCCATCGCACGACGCAG
CATCCGCGCGCCACCGAGGTATAACCGCATACCTGCAATCTACTTGACCTGTTCCTGATA
CAGGATAATGCATACAAGTTAGCTCCAGAAAATACCAGTTTCGGGCTTTGCTGCCACTGC
CGTCCAGATAGAAGTCTCTTCACGACCATATTTTACGAATTCAGTAAAGTTATCCACCAT
CCCTGATTGCAACGGACCGGGGCGGAACAGTACCACTAAGGCGATCATATCTTCAAGCAA
TCAGGACATGGTGGCAATCAGGTCCTTCATGCCGCGCGTTCAAGCTGGAATACCGCCGTG
GTTTCGAGCGTTGGCATGTCGAAGCTTTTCTTATCATCCAGCGGGATCGCGGCGATATCC
AGCGGCTCGCCATTCTTCGCCCGCCACTTGTTGATCATCTCCAACGGGTGTGGTGATGGT
GAGCGTACGCAAACAAGGAAGTCGACACCAGTCCGGCATTCAACGTCGCTTTATCAAACT
GGGTGACCGGATGTTTGCCCTCTTCATCGCAAGTAAAGCGGCGCAAAATCAGTAGTGGTC
GGCGCGATAACCACCCACCGGCGTGCTTACCGGCGGTACGGTGACCCCTTCCAGTTGCGC
GCCGGCATGTCGTCAGCCTTAACTTCTTCTTTCATCCGCTTCGTAGATTTCCGGCAGCTG
CGGCTCGGCTAAACGCTGCATGGCGTGTCCCGGATCGGGCGGGATCAGTTTCGAGGAATA
CGATCGACAAGCCCTTTGGATACTACTTGCGGCTACGTCGCGGATCTTCCTTTCGCCGCC
ATTGTACCGAAGGTGATGATGCGATACCGCATCACGACCGTACATGTCACACTTTACGTG
CTCGATAACACAATCGCGTTTCTCCATGATCGTCGAAGGAAGTCGGGCATGGAGACACGT
TCCGGGTTAAGGAAACGTTCGAACAGCAGGTGTCAAATTCCAGCGGATCGGGTCGGTGAT
TTTGTACGTAGGCCGCAAGTAGAACCCACACAGGAGCCACGGCCTGGCCTACCGGTACAT
AGGTATCTTTCGACCACTGGATAGAATTCCCTGCTGATAGAAGTAGCCCGGGAAGCCATC
GGTTGATAACCTGAGTTCAGTCTCCAGACGTTCGTCATATTCGGGCGCAGACGTTCTTCC
TCATCAGGGAATAAAAGGCCAGACGCTCTTCGGGCCCTCTTTTTACGCTTGACGAATAAT
CACCGAGGTACTCCATATGTCCCCGAGTCGAACTGCGGCAGGAAGTATTCACCAAGACAC
TGATTTACACGTTACAGCGTTGGCGATCTCAACGGTGTTATGAGCTGGGGTCATCAGCAA
ACAACTCCACATCTCCTCTTCGCTACCGCATATGTGCTGCGCGGCGAATAGTTACGCGGG
CGTTTGGATCGTCGAGGTAAGCCGTCGTGGATCGCGACGCGGATTTCGTATTCATCAAAG
TCATGCTGTCGATAAAGCGCACGTCGTTGGTCGCCGACAGACGACCGCGCGCTTCCGCCA
GTTCCGCCGCGTGCGAATACTTTCTTCATCCGGCCTGCCGGTGCGGGATCAGCTCGAGAA
AATAGCGATCCGGGAAGTTCTTCTAAACGCAGCGACCTCCATCTGCCAGCGCGCCTTCCC
GCAAGGCCGTCGACGTCCTTATGCGTCCGCCGGAAGAAGGATCAACCCTTCGTTTAATTC
GATAAGCCGGTCGCGATCGATGATCCGGCCCGGCGGCACCGTACCCGCGCTGATGCGCTT
TGAATCAGCAACGTCGAATTCTGATGGCCGGTATTGTTCGCCGCCGGTACCGTCGGGTGG
GTTAACTCATCGCAGCGGGTCGCACTGGACGTTAAAATCTACCCCGACGATGAAGCAATC
CGCCTGTGTCCCGCTCCGTAGAACTTCACCAGACCAAAAGTTGGTGAAATCGGTGATAAC
CAGTGCTGGCATACCCAACGCCGCCGCCTTTTTACCAACGGTGCGGTTTGGCAGGCCATC
GATCATCGGTAGTCGCTGTGCACCCGCAGGTACTGCAAAGCGTGGTTCAAGACATCTTCA
GATTCGGTTTATGCTCGGCAAGAAATCAGGACGCAAGTCAATGCGCGATTGAAGCAAGGC
CCAAGGCTGCGCCGATGGTGTTCGGTCGCGCCGTATTTCAACCAAGTTTCCAGATGAAAG
CGGTTGGGTGCCCTTTGTGTTGGGCAAAACCATATTGCGGGAAAACATATCCAGCGCCGC
CATTTCGGCGTCACGCGTCACTTTCGCGGGATAGACGCGCGGCACTGATTTCCGGTACGC
GGCTATCGCCTTTCACCACAGCCATCATCCAGGCATCAGTAGCATTTCGGGCGCTGGTTA
CCATCAATCCGCCTATTCAGCACCATGCCACAGCCCATGACAGCACGCTGCACATCGCGC
CGCCTTCGTCACCTCATGTTCAGCTCGTCGATTTCGTGGGGTTCCGCGCGGCCAGACTCA
GCTCAACGCTTTCTCTGATCACCTCTTCTTCGACGCCAGACGGCGTTTTTCGCTCAGCTT
TTGGGTCATTCAGCCCGGCAAATCAGGCGCGCCGAATCAGGATCACCGCAGCGGTGACCG
CGCCAACTAACGACCGCGTCCGACTTCATCCACACCCACAACCAGCTGCGTGTGCGGATA
AATAAATTCGTCATTCTTGCTAACTCCAGAACGGCGTACCCGCCTGCTCATCGGCGACGG
CGGATCTGCTGATGCAGTTCACGGAAGGTATCGTGCATCGCGTGGCTGGTTTCCGTTCGC
CAACAGCGGTAACAGCGCCGCAGCAGTTTTGCGGCTCACACTCTTCCTGCAATAATTCTT
TGACTAACTCTGCCCGCCAGCAGATTTGTAGCGAGACATAAATCGGTTTCACCAGCCGCT
TCGCCAACCAGAAGGTAAGGCTTCATGCGATATCCACCACCATCGGGCATTTCGCCAGCA
TACCTCGGGGCTGCCGTACCGACGCCAGTAGCGCCGCGCATCTTCGGCGACCATCGCCTC
ACGGCCATCCATCCAGCAAATGAACTTCAAGGTCTGGCGCGACTTCAGCGTGCGTTCAAA
CTGCTCGCGGCGTTTGCGGCATTCCTGGTACCACGATTTCGAGATGTCCGGATATGTCGG
CGCAATGGGCCGTTTCAATCGGCACTAAGCGCATTTCAACTTCTGCACCACGGCTCCCCG
GTAGCAACGCCAGAGCAGTAGAGCATCCCGTAGAGATCAACCCACCTCCAGGCGCTTCTC
TGGATCCGCCATGGCATCAGCCATGGTATGACCGGCGATAAAGCGGCACACGGTACGTTG
TATTTGTCGCCGCTTTTCCGAAGGCAGAAATGCGAGCACCAGATCGGTGGCTCTGCTATT
TTGAAAACACGTTTCTGTCGCCACGCCAGACAGCAGACTGGCATAATGAATAGTTTGATA
CCTGCTTTGAGGTTACCTTCAAAGTAATATTATTGAAGTCCAGGCACATCATACCATAAA
AACTGGCTTCAGTTCGCCAAAACGCTTTGTCGAATCGGCGCACGAATATGCAAGTAAAAC
GCAGACGGCTTCGAGCACCTTCAACAATGCCGCTCTACCCATAGTTCTTGTTCATGCAGG
CTTCGCGGCTTCGCTGCGGCCCGGCAGCACCAACAAAGCGGGCATTGGGCATGTTCTTTC
TCAAACGCAGATTAAACCGGCCTTTGAGATATCGCCGGAGGTTTCTCGGCAGCCGGGGCT
GTCGTTAATGGACGTATTCAGTCGTGTGAATCAGACCGCGCGTTAAACGTACCATCGGTA
AAAGCTTTCCGCCTTCAGATACTCTTCCGCCAGTTCAACAATTTCGAGATTTCCGCCCTT
CAAACGTTTACCGCTACGATAAATCACTATACGCATTACGGAATAGCGGTAATCGCCTCA
CGGCGCTGATCCGCGGCGCGCTTCAGCCCTTCGATATTGACACCGAACGGCGTTGCGTGC
TTGCCTGGACATAAGGAGGAACGTCCTGCGCCACACCGGGCAGCCTTAATATCATGCGCA
CCAATGATGCAGAACTGATGGACTGCGGTCATGCCGCCGATGATCGCGAAGTCGTCAGCC
GATGCGTGACCCGCCAGCATTGCATTGTTGGCGAAACTCTGGCAGTTACTACTGGTACAA
TCGTACTGCAATGTGCGCGTTGATCATCAGTAAGTTGTCGCTGCCCACCTTCGTCAATCC
ACCGCCACAGGCTGTACCGATGAATGGTGACCTTTCGCGAATGCGGTGCGATCGCCGATT
TCCACACGGGTCGGTTCGCCAGCATATTTCAGATCTGCAGTTGCTTCGCCGATGAGGCGA
ACTGATAAATCTCTTATCGCGGCAATTTTAGCTGACCATTCGACAGCGTGAGATTTCAGT
ACGTACCCTCACCAAGATTTCGACGGTCCAACAGTAAAAGGACCAATGTGTGCGTTCATG
ACGCACCTCTTCTATGCGCCCGGTTGGATACTAAAGAAGCGGATTTATCAATCACGTATC
GAGCCTCCCGGCTACGAGCACACACATCATCGTTGCTTCGCAAACTACTTTACCATCGTG
GAGGCAACTTCAAACGGGTCAGGCCGCGGCGCTTTTTCGAAAGTGACTTCCGCGATCATT
TGATCGCGGTACGACCGGGCGCGAAGCGCCTTCGTCGTACCAGCGAAGTAGTACAGCTCA
CCGGTTCCAGTTTTCCTACGCTTAAACGCCAGAATACCTGTGCCATTGGCACAGAAATCA
GCACCAGGAAAATCGGTTTTCGGGAAATGACACTGAAGAATGGCTCATTGACGAACATTT
TGCGCGCGAAAACGACCTTCTTCAAAATCCAGCACGCGATCACCAGTAGAACCTTGAAAC
GGTGCGGCGAAGTTCTAAAATCTCTTCAATCTGCAGGTATGAGTGTTAGTAGTCAAGATA
CTCTTCCTGTCCAAAATATAAGAAACGACAATAATAACACGGCTTCTACCGCCATCAGAA
TGAGACAGGCCGTAAAGTTCTGACGAACAAAGATGGAACGTTAGTCTTGTTGTTAACCTT
GCACTCAAGCGATTTCAGACGCTGCTCATGTCATCAATGTTCATCACCAGTGCCACCACA
GCGGTTTTGCGCCAGACTGTTAGGTTGCAGCGGAATGCCTGAGAATGGTGCGCACAGTTC
AGTGATGGGACGCATCACCATACCATACCCATGCTTCGTCCGCTGTCGCATATTTCCATA
TGCCCGTTGATTACGCTGGCTCCGCCGTCGTACGACCAATTTTCAGGCTGCCCGCCATAG
CCGGCGCCACCGGCAACCGCCGTATTGTCGCCAATCACGACGTTATGTGCAATCTGGCAC
TGTGGTTATCAATGATCACGCCATTGCCAACAAGTGTCATCCAGCGCGCGCCGCGCGATC
GATGGTTGTGCAGGCACCGTCTCCACGCGATCGCCAATAGTACGACCATCTGTGGGATCT
TCGCAGTTACCACGATCGTTGGCATAACCAAAGCCGTCTGCGCCTACCCGCACTGTTCGG
AACTGGATCGACAATTCTGACCGATCTGGATCTCGCATGGTAAATGGTTACGTTCCTTTA
GAAGACGCGACCTGCACCGATTTTGCTGTTTACCTACGAAGCAACCGGCACCGATAATCA
TTATCGCCCAGTTCAACGCCGGACTCAATCACCGCGTTAGCTCAATCGTCACGTTGTTGC
AGCTTCGCCGTCGCGTCGTCCACCTGGGTACCATCTTTCCGCAGGAGCTGCGGCGTGGTA
TCTAAATTTACTGCCATGCGCGTAAGTCAGTAAGGATTCTTCCTACAGGTACGGCTTTTC
GCGAAAGGAAGATCGTCCACGGGTCATGACAACCGCGGACGCACGGCAACCTAAATGCTC
ACGGTATTTTGGGTTAACGAACGTAATGTGACCTGTTGTGCAGATTGCATATGGACACAA
CGCCGGTGATGACGATATCGCCATCACCGTGTAGTTCTCTGCATCAGCTGCTGCGCTAAA
TCAGCCAGTCGGGTGCAAGAAGGCATTACTTGTTAACGCCTGTTTCGATACGTCGGCAGT
GATGATGTCTTTTCATCATGCTGTTGTAACAACACAACTTTTGCATCCGGCAACTGAATC
GATATCTGGCTGTTACTTCTTGGATTTCCACAACAGATCTGGATACGAGTAACCAGTTGC
CCGCGCGATTCTTCGTTGGGCAAGCGTACGCGATCCTACTCCGCCTGCGCTTTCTGACAA
AGATCGCGCTAAACCACTCGCATCTTTCCAACAAGAACGATCGCTGCACTTTCATGGACG
CTTTTCATTTAGCCTGCGAATCTGGTTTCCGCTGCTACGGTTCCTTCGCTGACGCTTTGA
ACTGTTTCAATGCCAAACGCAGTTTCCTGCACTACCTGCTAGAACAGGCTGCCCATATTG
ACATTACATTTGTCAGCCGCCTGAGCAGAAGTTGCCAGTGCTAACCAAGACCTGCGCCAC
CCCGGCTAACAACCCGCGCTACATCATCGCCCACCATCCCATTGCAGAGGTACGGTTCTT
CATGGCCCGGCGATCTTATATTGATCGCCTAAAGTCCTCGCTACACTACCTACATTCCTT
TGTGGAGAACACTTGCGAGGTTTACGATGCTAAACGCTGGGAACTGTTCTGTCTCCATCG
TACTTTTGAACGGCTGGGCGTAGGAGAACCAACGGCCCAATGGGGACATCCATTGTGTCA
CGATACCCGCGAACATACGGATATTGCTTGAATCTGCTATGTCGGATATCAGAATATTGG
CTGGAATCTGGACGCCTCCCAAACGGTACCCATGTCAGAAGAAGGAAGTACAGGCAAGTT
CGCATACTTATCGCTAATAAACGGCTCCAGGGTGATGAACTCGAGGCTGGCAACCGCCAT
GGCGTTACCGCCTACAGCATCATCCGATTTACACAGGTCTTTCGCGCCGTCCTGAGTCGC
ATTCGTAATCTGGTCGGATCATAGTACTGGCCTGATGCGGGAGTAAACTGCTTTCGGACC
AATGGACGGAAGCCACGCGCACATTCTAGAACACCGGCATAGAAGTTCTCGTAGAACGGC
ATCTCTTTGCCGCCTAAACCATCACCATAGCAGGTACGCTAGAACAACCCATTTGTGATC
GTCATCGATCGGCACATAAGTCGCCGTGTCTAACGTCACTTTGGTGACCGTTATCCACGT
CCGAGGAATGGTCTCACTTTACCAGTCAGGTTGACGTAGACCATCTAACCGAAATATAAC
CACAGTCAAGCTTGTTATAGGTCCAACCATAGTTGAACGTAAGTCCGTCCGTTTAAACTG
TATCCTGATCAGAGGTATGGATGTTGCCGCAGAGTACAGATAACGCCACATCGCAACCTG
AGGCTGCATGTTGGACAGGGAGTTATGTACGCCGCCCAGACCTGCCGCACGCAGCGAGTT
ATATTCGTTAATCGGGAAGCCCAGCGTCACGTCTGTACCGCCGCTCTTGTTGGTATAGTC
GGACAGGTCGGCGTCATCTGCGAAGTCATTATAGAAGAGACGACCACCGAGGCTTACGCC
ATCACGGTGATACGGGTTGGTTAGAGCAGTTCGGCATAGGTCTGGTAATCGTTTTGGTCA
TTAATTACCAGCAGCATAACCACTAGCAGTTATCCTGCTGCACACACCAGCACAGGCTCA
CGCCACTTTCAGTACCGTAACCAATACCAAAGTTGAAGCTACCGGTGTTGCGCTCTTTTA
CCTTGTGGGCGGCTTTATCCGCTGGTCGGAGCTGCCCAGACACGTTAGGTATCAAGTATG
TAGTTTCAAAAGCGGAGCGATTCAGACGCTCACCTGATCGACCAGATCGCTCCCAGCCAT
ACCTTCCATCGAAGCGCATTTCCGCACGACGCAGGACGGCATCTTTCGAGGTATCTGTTA
CCTTCAAAACGGATCTTGCTTTTTGTAAAGTGGTTACCACATCAACGTTCACGTAATTTG
TAACGGTTTTGTCGGCATCGTTAATTTCGGGCATCGACTGTACGCGGATAGGCATAACCA
TAACGACCGAGCTTTTGATGTCATCTTCCATCTTGGTCCTTTGGTGGGTATACAGCTCAC
CCGGCTCAATCAAGTGCTTCTCATTTAACTTCGCGGTGCCACAAGCAAGGTGCCGCTCGC
TAACACCAAACTTCAATCGCCTTCGGTGATGTTCACCGTGACATCATCTGCTATCTATCA
GCAAGGCCTTTGACACGGGTAGAGTCGATGTTTAGAAACAGGCGCAACCACCTGATCAGA
TGGCTAGCTGCGCAGGGTTTCAAGGTCGCCCGCCAGTTTCTGTTCTGGTATTTACGATCG
CCTACCGTTCCACCGGCACTTCGTCACGCAGTTGGAATGAAGATCAGTTCGTCGGTGGTG
AAAGCATGGTTACCAACAACCTGTTTACTGGATTTCAGCTGACACACCTTGGAACGCCAG
TTTTTAGGTCCTTTACGGTTGCGCGCGGCGGGGTCACGACAGCTTTTACGCTGGCGCTAT
ATTTTCGACGCTGTAGTAGAAGTCTTCCAGACCTTTCTCATCATATCGGCAATGGTGGTG
CGATCGAGGATTCGCCCACGCACACCAAGCCTCGAGGATTTCTTCTTCTCATCTACAATT
TGTTACCGGAGAAAGTAATGCTGGCAATAGATCTGGACGTTCTTTACCTGAACCAGAAAG
GGTATCCACCATCACGAGACGCGAACATCCTCAAAGTTGCCGGTATGAAACAGAGCGCGA
TGGTATTACTGATATCTTCATCTGGCAAACTGTGTCGCACTACTTTCCGACATACTGAGC
CGCACCAACGGCGACACGAAATTCAGGAAATGAATATCTTTTCTGAACCTTCAGCACCGT
ATACGGTGGCACTACTAAACAACGACGCTATGAACTACCACAATAACCATCGTTATTATG
CGTTCTTCTATGCTCTCACCGCCGAGAGAAATCATTGAAAGTGCAAGCCCCATTAACGCT
TCAGCAGAATCGAGCCAATGCGATAACAAAAGTCTTGAACCCGCTCGGATACCGGTCCGC
CCTTGTTGATCTTTTCGATCATAAGGAACATGCAGTACCCCATCAAATTTTACGAACGCG
GAAACAAGTTAATTATCCTAAGTTCCGCTAGCGCAAGAAACGGCAGGTAATAAACAGCGA
GTTCCACTGTCATCAGCCTGGCGATGAGATCGGCCCGCACTAGAGTTGTTCAGTTTCACA
TCACCGGTGATCAATTTCCCAGCATACTGACCGTGGCTTCATCAGCTGCCACGTTTTGTC
CGTGGCTTCGACGTGGCGTTGAACGGCCCATACTGGCGTACAACTTTACTCATCTATGGC
AAAGGAATGACTTCAGCTCCATGCAACCAAAACCAGAAATCGCTTTACCATGCCGGTTGC
TCCTCAGGATTATAATGTCAAGAACAAGGACTCCCCTGCCTTTCGATTTCTAACGCTAAG
TTGGTTATCCGGACAAGCATCACAAGGTCACCCACTGCGTTAAGGGCGACCATCGACTTC
AGAATCCTGTCCATGCGCACAAACCTGCCTTGCCTTGCCGCCGAAGGTTTGGCTGCATTT
TCCCAGTACAGGTTCGGTGCGGCCCACGAGGACAGATCTAACAGAAGATACGGATCTTCA
CAACGTATCAGGCTCAAACGCCCGGTGACATGCTAAATCGAGCCTTGAGCGAAAACTTTA
CATCATCACGCCGTTGGTCGCTGCCAAATGGCTACTGTATCGGGTGGTGCTCATCGCCAA
TTTATCGACCAACTGCAAACGCGGCATCCCAATCAGGCGTTTCGATACCATCTCTCACAA
CTTTAGATTCCGTACTGGTATTTAATTTAACAAGCTTCCTGCTTCTCCGAATTGGCTGCT
ATTTCGCCAACCACCGGACGTGCACGAGGCACCAATATAAAAACCAGCCGGTAGGCAAAG
ATAGCAAAAATGAGTTTGCAACCGGACTAAACGTAATCGCCGCTCTTGGCCGACAGATTT
GTGTGAAGGCATGGTGGCGGAGTTCCCGGAACGACCGATTCTGCGCGCTCATCCAGCATT
TGACGCAACCGCCCAGGATCAGGGCGATAACATATTCGGTGCCGAGCTTATCAGTTCGCC
GCCAGGCGCCTGTTATTAGAAACGCTCAGCGCGAACACCACAACGCCAGGCAACCCAGAA
ATATGACCAATTCGCTGCACGGTGATAAGTACAGTGCAACGATGAACGACCAAATCCCGA
CTCAGCATATTACCTTCCCATTAAAGCATCCTGAATGCCAATATGCCAAGCAACAAAAGC
AAAAATTGGTACCGCAGCCGTCAGGCTATCCTGCATGCAATCAAATACCACCGTGTCACA
GGGGTATTCAAATGACCGCTGTCATGTTCCTGCTTCACTTAAACATACTCGGTCGAATCG
CGCTTCGACACTGAGGCTAACACTGCGACAATAGAGCAAATAGGTAGGTGACAGGAGCTT
GTCAAGATTCGCCCATACCTGCCTTACAAGATTGCCGCTGCGGTAGCGAGTCACCGATAA
AAACCGGGTTTTACCCGGAAACCTTCGGTGCCAGCTTGTGTTTACCAAACAATTGCAAAC
ATATAACCGCCAGGTGGCGCCTACGGGATCCATGACATAGAGCAGCCATATTGCGCCTGT
GGTCTCGTCATAGTGCCGGTGCCGCATAACATGGCATGCCCGAAGAAGGGAACAATGGTT
AGCACGCCAAAATAAGGCGCAATGTTTTAGGAAGTTACGCCGTTGCTGCGGAACACATTC
TGGCTGCTAACAACCTTTGACAATCCACCAACCCAGCGAAGCCAAGCTAAATTCCTTGGT
TGATGAATATTTCGGTGATATTCCGGCAACAGAAAAACTCAGCGCCAACAATAACCCGCA
CCTGTACCGCCAACATACTCGCTGCGAACGATGGTAAGGCCGCTAAGCTGTCCCATTCCC
ACGCGCTGCCAGCGTAAGACCACCAGCGTTACAATGGCGAACCCACCAGCAGCGGCCGCC
AGCTCTTGCCGCGATGACGTAGGTATTGTACACAAAAGCAGGTGTCAGGCGATACTTCAG
CAAAAGCGACCCCATCAGGCTGTTTCGCTCACGGGCTCGGTGCCGCCGGCGACGCTCTCG
GTGTAAGGCGGCTAACGCCCCGCCAAAGTCTGTGTCGAAATCCCGGGCCAGAGAACATCT
GTAAAAGTAAAGTTCGGCGCGCAGGCAATTTGCTGCAAGCAAAAGTTACTAATGCGGTCT
CCCCCAGTCTAATTACTAATCTACAGACCCGGTTCATGCATACAGACATGCTGGTTTAGC
ATCTCTTCATCCTCAATCTGGTTGCGGGTTTCCTTGCCTGCACCTTTTCAGCCAGTTGCC
TGACTCTCACGGACTATATATCCCAACGTCACCGTAGTTCTTACAATATTCATCAGACCA
GTATTCCAACTGTAGCACTTCGAATTTACGAATACGTTCTTGCAAACGCGCGAGTTAAAG
CGACTGGTATCATAATAACCGCCTGGTGCGTGCCGTCCTTGTTCTGCAATTCATTAACGC
ACTGACTTCCTGCGCTGGTCGGTTCCAGTTTTCACTACTAAGGCATACAGCGTTAACACC
TCCATACCATTGTTGGCCGCAAAGAGACAGCCCGGCGGACGGATTTGCAGCTTTATGCCC
AAAGGCACAGTCTTCCCTTGCTTTTGCCCAGCGGCCATGCCGTCCTGTGATCGCAACATG
ACGGCATGCGCTGGCAATTTTCGCTAAGTGGTTGAGTAACTGAACAACTCACGCGTTTTA
TTCCCTGACAGGGTTTACGGTACTCAGGAATGCAAGCCTATACAAAAAGCCATTATACTT
CACGGCATATCAGCCTCTCGCCAACTGCACGATCAGATGGCGCAGACTATATCCACTGAA
GCCCTACGCTAACAAATGGCGCGACTCTCTCTGTGGCCGGATTATCCTCAACCCGCAGAA
CCTCCACCACCTCTTTTCACGAGCTTCACGCGACTGCATGTAGATACCATCGATCCACAT
TGTGGTTCGCGCATATCCATTTTCCAGTACAGATAAATTCAACGCAGCGATATCCGTAAA
GCGGTTGTTGCGCAAGCAACAACGGTGATTTCGTTTGCGGCGTCAATGCTGTCGTCGCTG
CGGCCTTGTTCGAACGCCTCATGTGGCAGATTTCAGGCATGGATAACGATCATATCCGGT
ACGGCAAATGTCAACACTTGGTTGCAAAAATCGGCGAGCGGCTTCACGCCAGAGTTCACG
CGGTGGCCATGCATAGTGTGCAGGCAATTGGCATACATATATCCAGTTCCCAACTGCGCC
AGAACACTGCCGTCCTGATAGCGCACCATTGGTGAATCACTGACTGCGGGTGAATCAACG
CTACCATCTGGCTAGCGCTGGCGTTAAACAACCAACGCGCTTCAATGTATTCCAGACCTT
TGTTCATCATGGTAGCCGAATCGACAGAAATTTTACGCCCATCGACCAGTTCGGATGACG
AGCGATCCGGCGTCATTGTTGTTGCCAAACGCAATGGCGTCACGAAAGAACCACCAGACC
AGTAAAGTAAATGGACACCGCCATTTTGCTCAAGGTCAGCATCCCAGATTATGCTGATGA
GTTGCAATGCATCTGAAAATGGCGTTATGTTCGCTATCGACCGGTAACAAGTGCACTTTA
CTCTCGCACGGCATCCATAAACAGACGTCAGGTAACCAGTAATTCTTTATTGGCCAGCAA
AATGGTTTACCCGCGCGGATCGCAGCAAGCGTATTAACAACCAGCAGCGCCAACAATGCC
ATCACACAATCAACATCCTCAGCGCTGCCACATATCGCAAGCGGCTTGTTGCCTGGACTT
CGGTGCGGCTACCCTGTTGCTGTAGCATCGTTTAAAGTTTCATGGGCGTGGTCGTTTGCG
GCGGCGGAGATTGGGGCGCTGTTCTGCCGTGGGCGACTCTGCCACCACCAGCGCAACTAC
GCGGGAAGTGTTCAGGATTATGGCGCACCACGTCCAGCGTGCTGCAACCAATCGAGCCGG
TCGAGCCGTGGTAGGTGCTTCATGAAACATCCAAGTTGAGACAGAATAAAGCAAAACGCC
GCCAGCCGATCCGCAAGGATACTAGGCAGCGTTTTATCGTCAAGAAATCAAGAACTACAT
CAAGTTCTACTTGCTATCTACAACGCCCTTAAATTTCTTATTGCAAGCATCAGTCAGTTT
CTGTACATCGTCTAAGGCGCGAATCGTCGTCTTCGCTGATCTCTTTATCTTTCAGCAGTG
CTTTCACTTTGTCGTTCGCGTCACGACGCACGTTACATGCTACAACACGCTTGTTCTGCG
CTTCACCCACGAACGATTTTGGTCGAATCTTTACGACGTTCTTCCATCAGCGGCGGCAGC
AGAACACAGATCTCCACTTCTACCGGAAGTTCGGGTTCGGCCGAATCGGACGCCATGTCC
TTTTCAAACGGCCGGAGACATTGATCAAACACGTTGATTTTCGGTGCAGGAATCTTCTAC
CGTTACGCTTGCCAGCTGACGCAGCGGCGTCGATGCCGTATTCCACGACAATGCCATCCA
GCAGGCTGGGAGAAGCACGACCCGTGCGTATTTTGCTGATTTGGGTTTGAACGCTACTAC
ATTTGTCCATGCGTACTTCAGCATCTTTCTGATATCGCTAATCACGTTACGATCCTTGAA
AACTTGTCTGTCTCAGTCAGACAGACAGTCACACAGTGGAAGTGTGTACTAAGTATAGCC
CTGATTAAACATATTACGGGTAATCGTCATGGATTATTAGGCTATTTGTTGCCATTTGGC
CCAGGCAGTGCTCATATGTATCCTCACGTACTTTTGTACGCTCCGGTTATACGCGCTGGC
CGTGACCAAACTGCCTGCAACAATAACGCCTTATAACCAGACTTGCACTTCGCGATACCG
CGGAATCTGCCATGTTATCCGCATCCGAGGTATTCGTGATTAAAGTCCTTCTTTTCACCC
ATTACCACACGGCGCAGCGCACGGTTTGTTCATATTGAAAGCACGAATCGGTGGTATGGT
CACGAGCCAGCGTGAAGGCCGCGAGTCCATGACTTTCAGCTCTTTTTCCAGCGCACTTCG
CCTTAAGTCAGTTGCTCATTACGCATGGTTGCAGTTGGATCTTTCGCCGGATCGGCGGTA
ATACGCCGTCAACTTTGGTTGCTTTCAGCACCACATCGGCTAATTTCATTACCACGCGAG
CCGGCTTCTGATCGGTGGTAAGAACGGGTTACCTGTACCGGCGAAGGATCACCACACGGT
TGTTGCGCAACAGGCTGTTCTTCTGCCAGCTGTAGCTGTCGCACACGCCATTCAATGGAA
CAACGGACATCAGACGAGCGTTCACATAGGCGCGGTGCAGTGCATCACGCGTGCCGACCG
TTCATTACGGTCGCCAGCATCCCCATGTGGTCGCCCAACGCGGTTCATACCCGCTTCCTG
GAATAGCGCCACGGAACAGGTTACCCGCAGTACCCACCAGCGCCTGAATACCCAGTTCAG
CCAGTTCTTTGATTTTACAGGCTGCGCCTTACGATCCGGTATGCATCATCCAAGCCTTCG
GTGCCCTGCAGGCTTCGCCGCTCAACAAGCAGAATGCGTTTATGGAGCCGGTTTTACGCG
CGGTAGCCATGTTTCTTTCCTGGACTGTCAACGATTGAAATAATTAATACTAGCATTGTA
CGTCGCTTTTCAGCACGCAACCCAAGGTTAGCTGAATTTACAAGAATGTGACTTTAAAAA
GCCGCCTCAGGCGCTCGCGCAAATAATTAGAACTGCTTGGACATCATAGCCTTTACTGCC
AAAGTCGGTCTCAACTTTTCTCGTGCCTTCACCACTTCGAAGCGGATGAAGCCAGTCCTT
CAGCGTTATGCTCTTTCAGCAGCTGGCTAACAGTTTGGTTCCGCAACGAACAGCTGACCG
GTCAGAGAGCTTCGCCGGTGAATTTCTTCATACTGACCTTCGCCGGCCTTTCTCCTACGA
TTTCTTTCAGCGCGCCGGGCTGCCATCGCGATATCAGCTGTGCAATTCTTTTCTACCTAC
TTCAGCGGGTAATCTTCCGGTTTAGTATTCCGGCACTTTTGCAGCAACGTGCATAACGAT
GTGTTTAACCAGCTCTTCGTCAGCGCCTTTAGCAGCAACCAGAACGCCGATACACTTGCC
TGTAGTAAGAACCCAGAACGTCGCCTTCAGCGCAGCAACGCGCGGCGAATGTTGATGTTT
TCTGGTACCGCTACCAGCACAACGTTCTTCTTCAGAACGTGGCACCAGAACTTCAACGTC
GGTGATTTTGCAGCAACGGCTTCGTCCAGAACTTTGTCTGCGAACGCACGAAACCAGCGT
CTTTACCGCCAAAGTCAGTCAGCGGTCACCAGAATGATGCCGTAGTTGCCGTCAATTTTC
CGTTTGAAATCCACGCCGTCCTTATAGCGACGCCTACTTTTCGCTGCTTTAGCACCGGAC
TTGCCTGTTTCGATTGCCAGCTCCTGATGTCGCCGTTAGCTGGTCGGTGCTTTGCAATCC
ATCGCCACCTACGCCTTAGTACACTCCGCAGCTCTTTACGAGGGATGCAGTAATTTCTTC
CATTCTAAATCCTGCTCGGTGTGATCTGCCCGGCATTAAACCGCACAGATATAAAGAAGT
GAAAAGGGGCCATATGCAGGCCTATTAACGTGTACCACGGTCTATAAGGGCTCTCCCGCT
TCATATTTCGCCGCAGTGGATCTTCATCGCTCATCGGTCGCCTTGCAGTGTAGCTCCAGA
ATTTCTCCAGCTTTACCGCCTTTCTGCTCGAACTATTTTGGGGTTATCAAGCATATTACT
CAACTTCTACGAAAGCTTTCTTCCGCACAGGAAGCGAATCCTGAGAACAGCCTTCACGTA
CGGTTGCAGCAACAGCGCCCGGTACAGGGTCACAGCACGGATTGCGTCGTCGTTACCCGG
GATAGCAAGTCTTACCGTCGGATCAGGTTGGTAACGTGTAAATACCGGAATACCGGGTTG
TTTAGCTGGCTTTGTGTAATGTGTTCGTGGTCGCGCCTCAGTACAAACAGAGCGTCCGGC
AGACCGCCCATGTCTTTGATACCGCCGGGCTGTTTTCCAGTTTCTCAGCTCACGAGTGCA
CATCGGCGCTTCTTCTTGGTCAGCTTGTCGAAAGTACCGTCCTGGACTGAAGTTTCGGGT
CTTTCAGACGTTTGATGGACTGACGAACAGTTTTCAGTTAGTCATACCGCCTTCAGCGAT
GGTTCACGAACTAGTGCAACTCAGAGCAACGTCTTTCACCGCTACGCTTGCAGCAGCGCG
TTTGAAGTACCAACGAAAAATTTACCTTTGCGAGAAGCAATCTTGTTCAGTTCAGCCAAA
CTTCGTTGAACATCGGTACAGTTTTCTCAAGGTTGATGATGTGAACTTTGTTACGCGCAC
CGAAGATGAACAGCTTCATTTCGGGTTCAATGAGTCTGGTGACCGAAGTAGACACCAGCC
TTGAGCATGTCCTTTTATAGAAACAGTTGCTGCAATTAAAACCTCTATATAAAGTTGGGT
GCTTCCTCACGTATCCCATATTACCGACCCCAAGGGCACCCCAGAATATCATGCCGATAC
GTGTGTGTTTATTCCACAAAGAAAAGTAGGATTGTCGCTTCCGTCACCAGTCTGTGTACG
AAATGGATCGGAAGTCCGGCGCCTTTATACAAATACGTCGTGGACGCAATAATTGTTGGC
GCTGTGTACAGCATCAGACGTCGGGTACTATTATATAGAAAACCTTCAGTAGCACGTTTG
GCGAAATTCAGAATGGTACCATTGCCCGGGTGTGATACCATTGACGGCACTTACATATGC
TCTTGTCGGTATCACCGACGCTGATGAACAAGTGTGGCTATCTCATCAAGACCCCAGAAG
ATATCCGAAAAATGCGCGCGTCGCTGGCCGACTGGCACAAGTGCTGGAGATGATCGAACG
TATGTTAAACCGGGCGTCAGCAGCACCGGCGAGCTGAATCATCTGTAATGATTACATTGT
TAATGAACAACACGCGGTTTCTGCCTGCCTCGGCTATCACGGCTATCAGCAATCCGTTTG
CATCTCTATTAATGAAGTGGTGTGCCACGAGTATCCAGACAATGCTAAGCTGCTGAAAGA
TAGCGATATCGTTAACGGTAATGTCACCATGTCGAATGGTTTCCACGGCGATACCTCAAA
AATATTTATCGTCGGTAAAGCCGCCATCATGGGCGAACGTCTGTGCGCATCACGCAAGAA
AGCCTGTACGGCGCTACGCATGGTAAAACCGAGCATTAATCTACGCGAAATCGGTGCGGC
GATTCGAAATTATTAATCGAAGCAGAAAACTACTCCGTCGTTCGTGAATATTGCAGACAC
GGTATTGGTCGCGGCGCTTCCGCAGAACCACAGGTGCTGCACTATGACTCCGTAAACCAA
CGTCGTACTGAAACACAGGATGACGTTCACCATCAAAACCAATGGTCGCGCGGTAAAAAG
ATCCGCACACCGCAGAAAGATGGCTGGACGGTAAAACCAAATCTGGCTTGTCTGCTACAA
TATGAGCTTTATACTATTGTGGTGACGTGGCTGCTGCGAAAATTCAGCCACTACCTAAGG
ATGGCCTACATCCGGCGATAATCTCGCGACAACTAAGATAAACCGGCGAATACCGGCACA
CACCGATATAATTTAATCTTATGGGTGGCGCTATTAGATACCCTTCAGAACAGTACGCAA
ACACCGCTCTCCCCACCCTGCCCGGTCAACCGCAAAATCCATGCGTCTGGCCCCGTATGA
TGAATTAACCGTCGGTGGGATAAAGCCATATCATTTTTCCAGCGTTGGCTACAGGTGATG
CCGCTGACAATGGGATCTCTGCAGAACAGTTGATTGACGCGCACGAGTTTATCGACCAAC
TCCTGCAACGATTATATGGATTGGCTTGGGATTCAGCGAATTACCGACGGCATTGGAGGT
CGCCGTCGGTGGCTACGGTCGTGTGACCATCCACTGAACGTCGGTTACTGATTTAAGCCG
TAAAAGCTCCCGGACGTCAGGCGCAAAAGTGGGCGGCTGTTAACGCTGCTCTGGGATGTA
AACTGGAAGTCGGTCGCAGCGTGCGCACGCGAAGAGTGCATGCTGAAGGGTTATCGGATT
TAACCGTCGCCACCAATTTAATCGAATCCCGCTTATTGGTGGCGATGTTGCGCTGTTCCT
CGAACACAAAAACATATTTTCCTTGAAAAATTCTGGCCTTCCGACAAGTTCTACGCGCGG
CGAAAGTTGAAGAACAGAACCAGCGCCATCCAGCGTTACCATGGCACCAGCCACAACCTT
GAACCAGACATCAAAGCATACGGCGGCTTGCGCGATATCCCACACTCTCTCTGCAATGGG
TGGCCGCCGTCATTGGCGCAACATCATGGATGAAATGGTCGGGTTGGCTTCTTAACACTG
TGCGACGAGCGGAATTAAACGAATGTCTGCCATATATTGTGGCGTATTCTTTACACCATC
TGGTCGTCGCCGTTACGATAATCGCCTGTTATTCGATCGCCAGCTTAGCGTCGCCCAGCG
TCTGAATTACAGTGGTGAAGGTAACGAACCGGTCGAGCAGATGATGAAGGATGCTTCCGC
GTTACACGCGTCGTGTGAACTCAACCAGATGCTGCTGCAACTGTTCGATAAACCATCCTC
GCCCTTCCATGACGAAAACCACGTCAATCGACGATGAGTTTCAGCTACGCGGTACGCTAA
TCGACCTGCGTGATGAAACATATTTATGCGCCAATGACCATCTTGCGTATGTTCTACACC
ATGGTACTACAACAGTACGATCACCGCATTTACTCCACCACCACGCTGCGCCGAATTACG
CCATGCCGTCGCCATCTGCAACAACCGCTGTGTAATATTCCAGGCTTTGCTTGTTTTGAG
CATTCTGCGTCACCCAGGTAGTGCAGCGCGGGCTATTGCCAATGCATCGCCATGGCGTGC
TCGGCGCGTATATATGCCGCAATGGTCGCATATCGTCGGGCGAATGCAGTTTGATCTGTT
CCACGCCTACGGTGGATGTATACTATCCGCGTGATGCTGAAGAAACTGGAGAGTTTGCCA
GTGAAGAAAACGCGCCAGCGCCATCCGTTGTGTGTGTGGACGTCTGGCCGCGCCTGCCGT
CAACTGAGCTGATTTTCATCGCCGCGCTGTTTCACGATATCGCCAAGGACGCGGCGGCGA
CCACTCCATTCTCGGTGCTCAGGATGTAGTGCATTTTGCCGAACTCCACAGCGGGCTGAA
CTCGCGAAACACAGCTGGTCACTTTGGCTGGTTCGCCAGCACCTGTTGATGTCGGTGACC
GCCAACGCCGCGATATTCAGGACCAGTCATCAAACGGTTGCCGAAGAAGTGCAAACGGAA
AATCGTCTGCGCTATCTGGTATGCCACGACTGTGGCTGACATTTGCGCCACCAGCAAACG
CTGTGAATAGCTGGAAGCAAAGTCTGTTGCGTGAGTCTACTTTGCCACCAGCTTGCTTCG
ACGCGGAATGCAAACACGCCGGATATGCGCGAACGGTTCATCACCAACTCGAACTGGCAC
TACTGCCTGGATAACATCGACGAAGAGGCGCTGCACCAAATTTGGTCACGCTGTCGTGCT
AACTATTTTGTCCGCCATAGCCCAAATCGCTGGCACGGCATGCCCGCCATTTATTGGCAT
GATTTAAGCAAACCGCTGGTATTGCTTAGCCCGCAGGCTACGCGTGAGCACCGAGATTTT
ATCTGGAGCGGACCGCCCTATCTGTTGCCGCCGTCTGGCGAATTAGACCGCCGCAATTTA
AGTGTTCACGACGCACAAATTTTCACCACTCGCGACGGTATGGCGATACCTTATCGTGCT
GGAACCCGATGGCAACCGCTGTCCGCAGATCGTCATGAAGGGTTATTCGGTTTGGTCTGG
GCAAGTACTGACGCAAAGTAGCTAGCCACCGCAGCCGTCGCCAACCCGCCAAATTACGCC
ATTTACTGTTGAAACCAGTAACGTTTGCCGACCCATACCGACCGCAAATCGTTCCTCGGG
CAATCGCCCTCGACCAACTGGACTGCTGGCGCAGTCGGAGGAAAGTACGCGATCTGGGAA
TTTCCTTCATGGTGAATTACAACCATTGGCGAGCAGTAGAATTTATTCATAGTGCCACCG
CTGACCGGCGTGCGCTTGTAACAGTTGCAGCAGCAGGAAGTGCATCAGCGGATTGACAAG
GGCCCTCAATCAAACGATAAAGGGTGATGTCTTACTGATATGAAAGAGTTTAATGCAGCA
GTTACAGAACATTATTGAAACAACGCGAACGCCGTGCCGAGATCACGCCAGCCAATGCGA
ACACCGTTACCCGCGAAGCGCTCGTGGTGATCCTGTAATTCGGCACTGCGTGTAGCGGAA
AAATTGACAGTCAGTGGTGACATCAGTGGTTGAAAAAGCGGTGCTGCTCTCTTTCCGTAT
TAATGATAATCAGGTGATGAAGGGCAGAAAGCCGCTACCGACAAGTGCCGATGAAATTCG
CCGACTACATTGAAGCACGTTTCAGAAAGAAGGCTTCCGCGTTGTGCCACCAGCGGCAGT
ACGTCAAGTGCGTTGTGCCCATGTACCGTGCTGATGCCGTCTTACGTCAACATCGGCGCA
TATATGTTGATGAAGGCACCGCCGATACTGGGCGACCGTCGGTTCTTGTGCGCAGATTGG
TAAAAACGTCCACCTTTCCGGTGGCGTGGGCATCAACGGCGTGCTGGAACCGCTGAGCTA
ACAACCATCATTGAAATAATTGCTTCATCGCGCGCGCGCTCTGAAGTGGTTGAAGGGTGA
TTGTCGAAGAGGTTCCGTCATTCCATGGGCGTATACATTGGTCAAACACCCGTATTTGTC
GTGAAACCGGCAATCCACAGTGATCGCGGTCCGGCAGGGTCTGGTTGTTCAGGTATCTGC
CGTCAAAAGATGGCAATACAGCCTCTACTGTGCGGTTATCGTTAAGAAGGATTGACGCGA
ACTCGCGGCAAAGTCAACGTCTTCAGGCTTGCTGCGTACCATCGACTAAAAGTATGCACA
CGGGCAGCACGACCTGCCGATTTTCGAGGATGAGCGATGATTTCACGCCGCCGATTTTGC
AGGCTACTGCCGACGATAACCTGACTCAGGTTCAGTTATATGCATTACTGTATGGTGAGG
CTGGTTTGAATTAATCCGTCACCTCGCGAACAACACCTTTCATTCAAAATTCTTCTTTCT
GGCCGTCTCCATTACTCTCGTTTGTTCTTTAAGCCTGATTTCTGACGCGATTGCTCTTGG
CATAGAACAAAAGCCCGATTGATAATACTGGCGATTACGTGATATTATTTATGTCGCTGA
ATTTTCGGCGTTTAGTGACGTACTCTCCCCTTGCCAGATGTGCGCCGACGTTGCCTGCTT
CGGCAACCGATCGCCCTGTTGGTACGAAAAATCACTTAATTGGCGAGACGTTGAAATCGA
GCATCACGGTGTTGTTTAACCGGGCTACGGTGATCTCGCCACGCCGAACAGGCAATTGTT
CGAACTGGTAGGCACTGGTGACTTATAGGCCGGACAGTAAACCGCCTCCATAATGACCAA
TCTGCCAAGACTGGTGCTGGCGCATAATCGACAGCAAAGAAGTCATGCGTGATGATGAAC
CACAGGATCTGATGCTGTGCCTTACTCACGGCAGGCAACTGCGCGTACCGTTGGTTGGTG
AACCTTTGCTTGCCCCTGTCAATAACGTTACGTCAGTTAAATGCCTTTGTGGCGAACACA
TCATCTACACAACCCGTGGCGTGGCAGTTTGTAGTTTGCGTCTGAATTTGCCGCCGGAAA
TAACGATGCTGGAACTGGTGTGGAGATCGTGAATTTATCACCAGAATAAAGCAGGTAATT
TTGATTTTACGCCATGATAGAAGTCTGGAAGAAAAAGGCTTTCTACTGCGATCACAGCCA
ATCGAGTAGGCGGGCGGTAAATGCTAAACTCGCTATTTACTGACTCATTTTGAGGTAACG
CTATGTACGACAATCTGAAAAATCTGGTACAATCCTGAAGAAATTGATCGTTACAACCTC
GGCAATAACAAGCGATATTCTGAAAATCTATTTCAGAAAGACAAAGGCGAGTTTTCGCCA
AGAGCGTTAAGTTTAAATATCCGCGTCAGCGTAAAACGTCGTCGCTGATATGGTGTGGGT
CAGGGTATAAAGAAGTCGAAATCAGCGAATCTACGGTATATCATTGATGAGCTTGATCAA
ATCTGCCAGCGTGACCGCAGCGAGATTGATCTTAAGCGTGAATCCTCGACGACGTCACGA
GTCCAGTCGTAACCAATAGACGAGATTGAAAACCGATCTGGAAAAACTAACGCGTAAATA
ATCAGACGACGGTTAATTCATTCCTCTACCTTCGGGCTGAGGAATGAGCCAGCACCGCCT
CAACCTTAACGCATAACCTACCGCTCTTCATCAGTTGTAACGCCACACCAGCAGCAACCT
GTCATCAAATTGCCCAAATCAAGCCCGGTCAGTTCCGATATACGGTGAAAGCCGTGCGGT
ATTACGATGAATAAACAACGCCTTTGACGTTGCCAGCGGTTACATTGTAGAAACCACGCC
GCCAGCTTCGTCACCAGCAAGCCGTTATTGTCCATCGTTTTCTAGCCGCGCCAGCAATCG
CGCCAGTCGTTGGCCTGCCAGTCGCCACGCAAACTGTGAAGTAACACAGGCAACATCAGA
TCCTGATAAAATAGCAGCGACTTTCTGGCATCCGCTGTTACCCACCACCATCGTCGTTTC
ATGTTAGGATCGGGCAATACTACCGAGTTCAGTAAAATATGGGTGCCAGTAAACGCGAAA
ACACGCTGTACATACTCTTTCATGCAGGTATCAATTGTTAACTCGCTTACGATGATCTTC
TGCATCCCAGCGCCAAAGAGTTCGCGCCGGTTTCAACACCACCATTCAGTTAGCGAGATG
TCGCCACCGTTATTACGCTCGGGCGTAGTCAGCGCGTTGCAGTTGTTGTAACTCGCCATT
GCGCTGTCCACATAAGCTGACCGCTGTCGACCTCAACAATAACCACCACTCGCGGTTGAT
TGAGATCGATCCCCAACCGTTGCGCCCATTCAGTAAGTGCAGGAGTATTCTCCTCTACTG
AATCAGGTTCCTCACCAGTTCTTCCTGAGCAGCTATCCTGCCAACAAGTGCATCAACCGC
GACTGTTCCAGCATTTCAGCCGTCATGCAGACCAGTTCGCCATATTTACGCAGATTCTCT
GGTTCCTGTCAGGTAATTACGCCGACAATTTCACCTTCAGCCGTAACGGTAGATTAATCC
CTGCCGCACACCGTGCAGATGACGTGCTACCGCGTCTCGATATCGACGACTCCTGTGAAA
GTACCAGCAATGCACCTTCGTACAGTGCCAATACGCTCACCGATCGCCGCTGCCGATAAT
TCGCCACGGGCTCCATTACGTTGATATTGGTATCGATGTTTATGGTACGTGCCACGATAT
CCTGCTGCGCCATTTGGTATCAAGTGCCAGCCAGCCATAGATCCTCCGTTATGCACAGCT
TAGCATAAGGAAGTACGTAACGTACGGCATTGACACAAATGCCTGAGATGATGAAGATGT
ATGAGTTGTGGTGATTCTGGTGTAAGGAGAACCCCTTCCCGTTTTCAGAAGGGGTTGAAA
CCATTAACAGGTAGATGGTGCTGTCTCGCCGCGCTGAATGTTGAGTGCCAACACAGACGG
TTGCTGTCGAAGAACTTTACGCGATTCAGCGATGTTTTCACTGCCTGCCGCTTAATCACA
TCACCTTTCTTCAGGCCGATCTGCGCAGCCGGGTGCCGTTCACGTTATTCACTACCACGC
CGATCTTTGCCTTTGTTGCTCATCTCAGCGCCTTCAGCCGTTGAAGTGGAGCTGGAATCA
ACCTGATTACAGCTGCTCTGCTGCAGTTCAGTTCACGTTAACCTGCTTACCGTCGCGCAG
CCGGTCAGTTGCTGCCTACCGGCATAGTACCCACCTGAGCACGCAGTGCAGCAAAGCTTC
TGATCAACACCGTTCAGTAGGGTGATCACATCACCGCTTTAATGCCGCTTGCAGCGGAGA
ACAAACAGAACGGCTTACGAAAGCACCGCGCTGGGCATCAACTTTCATCGCTTTCGCCAG
TTCGGAGTTCAGCTCAGTCCCTGCCAGCTCACCGCGTTTCACTGACCGTATTCATCTGCG
AGTCAGGTTTTCACCATGTTACTCGGGATAGCAAACCGATACCGATGTTACCGCCGTCCG
GTACGGCGGATCGCGGTGTTGACCACCGATCAGTTCGCCGTTCAGGTTACCAGCGCACCA
CAGGTTACCACGGTTGATCGCTGCATCGGTCTGAATGAAGTTTTCGTAGTTTTTCGGCAT
TCGGCCGCTACGCTTCAACGCAGAACAATCAGAGATTACCGTCTCGCCGAACCAACAGGT
TACCAATCGCTACGGTGTAATCACCACGCGCGAATCAGAATCCGCCATCTGGTACGGTCA
GGTTTTCAGGTTCTGTGGTTGGATCGCTGATATCCAGAGCGCGGATCTTTATGCCAACCA
TCTTCGCGTCGAACACGGCCATCGCTCAGTTGAACTTTTAATGACCGTCGCGTTATCAAC
AACGTAGTTGTTGGTGACGACATAACCTTTATCGGCATCAATGATGACGCCAGACAACGC
CATAATTTCTGTTGCTGGCCGCCACCGTACCATACAGCCACCACGGCAGAACGAGCTCTG
GAACGAGAACCTTCACGAACGGAGAATCATCACCGAAGAACTGCTGAAGTGCGGCATACG
CGGCGTATTAGCTGGTTATTACCTTCTACGTTAATGCTGACCACTGAAGGCATCACCTTT
TCGAGCATCGGTGCAAGGCGGCATCTGCTGAGCTGTCGTTGCTGAAGAAGTCTCAGCCGC
CGTTGTTGAGAGCGGAGACAACGCCAAACCTAAACTCAGAGCCAGTACCTCAGTGCTAAT
GTGGTTTTCATGTTCAGTCTCGATTAACAGATAACGCAAAATTGCTGTGTTCTTCAGATT
CGTTTATAGCCTGAGTTCGAACTAAAGTTTCTGCAAAGGTAAAAATTTATTGTTCGTCTT
TACAAAAGCAGTTATTGTTCTACGACATCAGACGTCGGTATTCATCCACGCATAGGGTCG
GTCACCGCTGATATAATCCTGCAACGGCAACGGTAATAATATTCCCCATAGCGGAAACTC
AGGAGAATCTGACGGTAGTACTGACAACCTCATTGCCAGCGATGGCGCGTCGAGAGTTTG
TGGAATAATAAGCGCGATTCAATAGGAAACGTTCACCGTTCTTTTCTGCAGTTCAGTAAA
ATCTGATAACGACAGGCTTGGCAAGGACGATAATCTCTAATAATCCGCTAATGACCCGAT
AGCCCACTACTGCAATTCAAGCCGCTCTCTCGACATCTGGATGGCTAAACACATGTTTAC
AGCGACATTTTATATGACAAGAAGATCGCTGCATTCGCTGGCATCTTCCAATAATGCATG
ATTAAACGTTCCGGCGAAAATCGCAGGCAGATTATCAATAAATCGTTGTGCGCGTAGGTA
CCAGTTTGTTGAGGTGTTTACCCGTAAATGCATAAAAACGATCTCCGTACTGCGGCAACT
ATTGAGCGTGATTTTTCGGGCATTTCAACCACCAGCGAAAGAGCGAACCTTTGCATGCAG
CCCACGCTTCGTGCAAATGATGATAAGCTAACAACGGTAAATATTCTTTTCTCTACCGCA
TCTTCAGGTCTGCCACACAATGGAGATGTCGTCAGCTTCCATAATCACGTTAATGGAAAA
CATTGTAAGCGCCAAATTAAGTTCTTTACGCAACCGGGCAATATAAATACTTCAGAAGAT
ATATGTAGCTTTTCATTAAATAGTGATGTGTGAGCGTTTCGCCGCCACCACGCCGGACGG
GTATATTTAAAACACCGCCAACCTGTGCCAATTGAGATTCATCCGCATCAATGTATACCG
ACGAATGCCTTGTGCATTCCTCAAATAACGCCGTCCTGACGAATCTTGCGCCGCAGCTCG
TTAAGCAGTTCTTCCCCGTCCATAAACGTAGTGCCGCCGCTGTGATCGTCAGTCAGAGGC
TGGCTTTCGGCATCTTCAAGGTGCAAACGTTGTATGTCGGTCATTTATCGCCGCTTCATA
AAAATAATGACCAAACGGCAGTTGCCGATATCGTGCATCAGGCATGACATCTCATAATGC
TTTCAAGGACGGTCAGTTCATCCGGGCCGTATGCTTCAGTAATTTAACTCTCAGACGGCA
AAATTTCTTTGTGATGTAGCGCCCACCTATGGACTTCCATCAGTAGGTAAGACGCGTGCG
CACGGCGGCGTACGCGCTCCAGTGGAAAAACACAGGTCTTTATTTGCAGACGACGAATTG
CCGGAAGTTGATGATACGCGATCGCTCTCGAATCACAGGATCTCATGTTCGGTTTAACGC
CCTGCGGTGAACAGTAGCGGCGATATGCCAATTTATTTTTCAATCAATCTGGCCTGTGTC
CTCTCCCGCGTGAAATACGCTTCCCCGTAGCGCATGGTAACTATGCCTTCAAATCAGGCT
ATCGCGAGTAAATCTATGAAAATCAGCATCATTGGTGCAATGGAAGAAGAAGTTACGCTG
CTGCGTGACAAAATGGCTCGTCAAACTATCGGTCTCGGCGGTTGCAAGTATACCGGCAAC
TGAATGGAACCGGGTTGCTTCTGAAATCGGGCATCGGTAAATCGCTGCGGCGCTGGGTGC
CACTTGCTGTTGGAACACTGCAAGCCAGATGGTGTCTTTACCAATACTGCCGGTGGCGGC
CTAACGTTGAAAGTGGGCGTATCGTTGTATCTCGGACGAAGCACGTTATCACGACGCGGA
TGTCACGGCATTTGGTTATGAATGATACGGTCAGTTACGAGCTGTCCGGCAGGCTTTAAA
GCGACGCGATAAGCTGATCGCTGCTGCGCGCTGAGGCCTGCATTGCCGAACTGAATCTTA
ACGCTGCCGTGGCCTGATTGTTAGCGGCGACGCTTTCATCAACAGTTCTACTGTTGGTCT
GGCATCCGCCACAACTTCCCACAGGCCATTGCTGTAGAATGCGCGACGGCAATCGCCCAT
ATCTCTGTTCAACGCGTCCGTTGTTATGTACGCGCCATCTCCGACGTGGCCGATCAACAG
TCTTAACTTCGATGAGTTCGGCTGTTGCCGCTAAACAGTCAACCTGATGGTTGAGTCACT
GGTGCAGAAACTTGCATATTCTAGAATCACTGTTCAGGGCGCTGGTCGCCCTGTCTTTTC
TGCGCCACTGTGGCTCAACGCCGCGCCACCGCGTCATCACGCTTTCTCCCGCCAACACTG
AACTTGCCTTTACCGCCGGGATCACGCCGGTTGGTCCTTGTATTCCGACTATCCTCACAA
GCGCAAAAATTGAGCAGGTTTCCACGGCAGGGATGAATCTGGAACATTGTCGCGCTGACC
GATCTGGTGATTGCGGCGTAGGTAATACCAGCGGCAGGTTGACCAGCTTCGCTGGGAATA
AAAGTGATGTGGGTCGATGCGACAAGCATTGAACAAGTATAATACGTTACGTCAACTGGC
CCACAGAGTCCGCAACAGACAAGGCCGAACAAGCCGCCTGTCCTGCTGGATGTACGCGCA
AGCGCAATATGCTGATAAACCTAAAAACGTGTTTTCTGCAATTCGGCATTAATCCGCCAT
TGCAGTGGAAAAGTCGATTCAGAACCGGTACTCGAAAAGTTTGTGTGGAGAAAACATCTT
CTAAAGACAGCCAGGTTCCACAGCCTGGGATTAACCCTGAACAACAGGTGTTAGCACGCT
CGCCACAGGCGATTATCATTGAAGCGGACGAACCCAAATTCCTAAATCAAACAATACAGT
GAGCAGCTCCATTCCGTTATTCCTCTCACGGTGACTGGTTTGAACATTAAGCCCACGTAT
TATCGCTACCTAACAACTCTGTGCCTTTCTGGGTAGATTAGCGCCTGACCTTTTCGAGTG
CTCAGTGGGGATTGAACAATATGCTCGTCTATTGGCTGGATATAGTCCTTTGTATTATTT
ACCATCTCCGGCGTTTGTTAGCCAGAAAGTACGTATGAACCGCACCTTGGTGTTCTGGTA
CTGGTGAAAGTAACCACCAGTAGGCAGCAGGACAATTCACCGACATGGCGCTGGATCACG
GCCGGTATTTTAAGGTGAAAGATCATCTGGTCGTTACAATGGTCACCAGCACATGCTGAC
CATCGTGCTGGTGCGCCAGCCAAGACGCTACAAATGGATGTTGCCGGTGCTGGACGCCGT
TGGTCTGGCGGTGTTGTCGGCATTGGCGTGAATAAAGCCTTTAATGCGAAGCAGTCCGTT
AATCGCGGTTTGTAAGCATCATTACTGGCGTTGGCGGCAGGATCGTCGTGATGTTCTGGC
CGCGAAATCCCCATGATTTTGTGCAATCTACGCAACTACCTGTATTATCGGCGGTATTGT
CACGCTACGGCAATACATTTTCCGTACCACTGAAACAGCCAGTATGATGGGCATAGTCGT
GACACTTGTAATGATTCGGCTGGCAGCTATTCGTTGGCATCTTAAGCTACCGACGTTTGC
TGGATGAAATGGGCGTTGAAGAGAAGATGTGCCGGATAGTTTATCAACACATGACAGGTA
GATACTAAGGAAGAACCGCAACCGCAGGTGCTTTCGCGTTCAGGTTGGTCACGATGAAAC
GAGAACCTTCAGACCTTCAGTACATAATCGGAGACCATAAACCAGATGTACAGCTCATCG
GATCAGCCACCGAGGCCAACGCCCTGTTTTCGATAGTCTTATCGCCTTCGTTCACCTGTC
ATCAAGGTGAAACCATACTGAAGCCATGCAACCGCCACCGGTGATATACACGCGTAATTT
CAGATTCGTTATCTTCATCAGCGATCAGGCTTTGCTGTTGGCTGCTGCGTCGGTAAACTC
CAGCGGCAGTGCTACGTATCTTTCATATTTTGCTCCAAACGACATCGGCAATTGGGCAAT
TCTAACTTAATAATAATCGCCATTATCTAATACCATTATTTCGTTCAAGTATTCTCGCTG
TGGCTGATGCGGCCTTCGCGCCAGTTGCTCAGCTTCCTGTTTATAGCGTGCGCGCAGAAT
CACCAGTATAGCGGTTTTCCGCCAGTAAGTGCGCTAATAGTGTTGCGCCAAGACCGGTAA
TAATCATTGGCAAAATAGGCTGGTAGTTATCGGTCATCTCCAGAATGAATAATCCCCGTT
AACGGCGCGCGAATGAATGCCGCCGTACCCATTCCGGCAATATAAACGTCCCGCCTCAAG
GTGATATTGCGGAAACAGCTCAACAACCGATGGCAGTTCCAGCACAGTACCAACGCCAGC
ATCGGGGGCAAAATACCACCAGCGCCGAAGAAACAAGTAGGTGTTAATGACCCTTGCGAC
GAAGATAACACCAACATTCAGCTGAAATTCCTGTTGGCAACAAGGAATCAGGCCCAAACC
GCCGTTGCTGGTGCACAAACCCCAGCAATCCACGAACCGCCAATCGCACCGCCATTAGCA
CCCATTTGGTATGTGCCGCCGTGCACACGGTGCAGCAAATCCTGCATCCCAGCACCATTT
ATTAAAAATAGGGCGAAAATGCCAAAAATAATACCGGATCAGATAAAGCCACAGCGTAAG
CGGCGCATCAGAAAAGTTTACCGACGTCAATCAACGCAACCATGATTAAAAATCCGGTAC
ATAATGGTCGACATAATGACACCAATAAGCCGCTTTAATCGAAAATTAACGTATAACGAA
ACTGGACGCATCTCTTCGATAATAAACAAAATACCCGCCAGCAGCGCCGTTGAAACCGCA
GCCAGCCCGCAGCAGCACCGGTTGCCAACAGCGTGGCGAGCTTCGTCACCTTTCGACGGA
AAATATCAGCACCGCCATGTTACCGCCGATCTGCACGGTTAGCCCTTCCTTCTTACCATA
CCTCCGCCGAGTGTCCCCAGCCATAAAGAACTTCTACGGCAATACACGCCACCAGCAGGC
AGGACGTTGATCTTCCAGCGCCCCTTCAATTTCCAGGATCCCCGAACCACCTGCTTCCGG
CGCGTATTTGCGCACCAAAAGTAATAAACATCGCCAGCACCGCCGAACAGAGAAAAGCGA
CAGTTAACAGAAGCGGATAATTATCCTTGATATGTACCAGCGCCCCCATACGTTAGTTCT
GCAACGAGGGCGACACCGTCAAAAGCAGCGCTGCCAGCCCAACAAGCGTGCCGACGACTG
CCGCCATAAACAAAATATGGCTAACAGGGTTTATCGCGCTCAAGAAGTTGAATCAGTTGT
CTACGTCGCAGGCGCGCAGCCTGCGTGTTTCTAAAGGGGTATTATCAATTTTCATCAATG
ATCATATTGGTCATACAAATAAGATGACGGTACTCGCACGTTCCATGAAAATCCTTTACC
GTAATGTTTCAAATACAACTTTTATACTCTAAAATCAGGATTGCACCAGTACAAGCAGCC
TGATGTTTGACAATGTTCTTATTATGAATAACAAATATGTATTCACTTTTCTACGAATCA
GGAACCCTCCATGAGTAAGTCTGAAAATCTTTACAGCGCAGCGCGCGAGCTGATCCACAG
CGGTGTGAACCCCTGTTCGCGCCTTTACTGGCGTGGGCAACTCCACTGTTGTATCAAGCG
GACGGCGGCGCTTATCTGTACGATGTTGATGGCAAAGCCTATATCGATTATGTCAGTTCA
CGAAGGGGCCGATGGTGCTGAGCCATAACCATCCGGCAATCCGCAATACCGTGATTGAAA
CCGCCGAGCGTGGTTTAAGCTTGCTGCACCAACCGAAATGATGAAAATGGCGCAACTGGT
GACCGAACTGGTCCCGACCATGATGATATGGTGCATGGTGAACTCCGGCACTGAAGCGAC
CATGAGCGCCTCCACTTTGGCCAAATAGTTTTACGGTCGCGACAAGGTATTAAATTTGAA
AGTGTTACCATGGTCACGCTGACTGCCTGCTGGTGAAAACCGGTTCTGGCGCACTCACGT
TGATTAGGCAACCAAACTCGCCGGGCGTTCCGGCAGATTTCATAAATATACCTTAACCTG
TACCTGTGTGATCTGGCTTCTGGCGCGCCACATTTGAGCAATACCCGCAAGTGCCTGTAT
TATCGTCGAGCCGGTGGCAGGCAATATGAACTGTTCCGCCGCTGCCAAGTTCCTGCAGTC
TGCGCGCGCGCTGTACGACGGTAGCGTTGCTGATCATCGATGATGATGACCAGTTTTCCG
CGTAGCTGCTGGCTGCTGGGATTACGGCGTAGTGCTGAATTTAACCTGCCTCGGCAAAAT
CATCGGCGGTGGAATGCCAGGCACATTCGGTGGTCGTCGTGATGTAATGGTGCTGGCCCC
GACGGGTCCGGTCTATCAGGCAGGTACCTTTCCAGTAACCGGTGCGATGGCAGCAGGTTC
GCCTGTCTGAAGTCTTGCAGCCGGGCGTTCACGAAACGCTGGATAATTTATTAACACGTC
TGAGAAGGTCTGCTGGAAGCAACGAAGAAGCCGGAATTCGCTGGTCGTTAACCACGTTGT
CGGTATTTTCTTTCGACGCCGAGTCCGTGACGTGCGGGATGTGATGGCCTGTGACGTGGA
ACGCTTAAGCGTTTCTTCCATATGATGCTGAACGAAGGTGTTTTGGCACCGTCAGCGTTT
GAAGCAGGCTTGTCCGTGGCGCACAGCAGCATGGAAGATATCAATAACACCATCGATGCG
TCGGGTGTTGAGATTGTGATCCAGCATGGTTTGTCGGATGCGGCGTGAACGCCTTGTCAA
AACCACCGGTCAGGGCCGTTGTAGGCCCGATAAGACGCGCCAGCGTCGCATCGACATCCG
TTGTCGTAAACGCTGTCCGTCGAGGCGTGGGGCCGTTATATGGAAAATTAACGGCTCTGC
TTTCTCAACTAAATAGATAAAATGTAGCGCGCGCCGATAAAGGTTGACAGCAGCCCGCGG
ATCTGGAATAAACAGCACCATCCGCCCACGCAGTCAGCGAACACCAGCAGTAAACCACCA
CCAGCGCCGAAATTACGATGTGTGGCATCGTCCGTCGAAAGCCTCATCCGCGCAATATGC
GGTGCCGATGGCTCTTCAACAAAACTCAACGGTCAATAGTCATCGTCGCGGTCGCCGTCA
GGCAAGCCATGCTGTAACAGCGCAATTCGCGTCGTCGGCGTCAGCGCCATTCCTACGGCT
GGGCGGTATCACCGCAGCGGTAAAATGGTGTCGCGGCGGCTGTGGGGTAATCTGTAAAAT
CACCATCCTGATTCGGTGCGCCAGACCTGCGCATCGGTCGCGTTATGGTCGAACCGAAAT
CAGTCAGCGCGCATTCGCGGGTCACCGCGCCTGCAACATCATCAAAAGCATGGTGAACGC
GGTGCTTAACGCCATCCCGCCAGTAACATACGGTGTGGGGAAAATCACCGCGGCCGACGT
CATAATGATAACAGCGTCACCGCCGCGCGAGACGCCTGCAGGTAACAATAGCCAGGCATT
ACCCGGCACCAGAAACAGCATCAACACCACGCCAAACGCCGCGCCGGAGCTAATCCCCAG
CACTTCCGGGCTTGCCATCGGTTTCGGTCAGTCGCTGGTGTACGGCCTACCACCGCCAGC
ATGACGCCCGCAAACGCCGCCGCCATAATTGCGGCCAGCGCCGAGCATTAAATCCTCGAG
CAACGCCCGCTCGCCCACGTCCAGCCGTGCGCATCGACAAACGGCGCCACCACCACAGCC
ATCAACAGCAGCACGCCGCCCGCGAGGGCAAACGCCAGCACATGTTGGCGTTCAGCCGCA
TTTACGATCGTTGACCTTCATATCCGGCGCGCTAATGCTGCGTAAACGCGGCAACAGCCA
CAGTAGCAGCGGCGCGCCGTCAACGCGATGACCGAACCGGTGGACACTTCCATCCACGCG
AGCCAGAGGATGATTTGATCGGAAAGCCAGAGGATGGCGCGCAATCAACGACGCCAGCAT
CGGTCGTGGCAGCGGGCGCCGCGCGCCCCAGCATTTTGCCAGCAGCGGCGCGAACAACCG
GTCGCCGATGTCCCACAGCGTTCACCAGCAGCACTGATGACAATCGCCAGCGACAGCGCT
GCCGAACGCGCAACGGCAAAACCAGCCAGGGTGCGCGCCACGCCATCATCAAGCCCCATC
AGGGTTAACGGACGAAGTAGCAGCATCAGCATCTGCCAGCACCGGCCTGCGCTCAACGCC
GCCTGATCGGTTTGCGTCAGCGTTGGTGCTCCACAGAAACATGCTTTGCAGTTGGTCATG
ATGGAAGATAACCAGTAACTGATTGATTGCGCCGCAATAAAGGCTCACTACCAACCCGCG
AGAATCAGCGTTACCGGCGACAGCCGTTCCCCGTGTACCAAAGACAATTAGCCAACAACA
CAAGCCCCTGCCTGCAGCAAGCAGCTCGCCATCGCACCGGATCGCCCAGAGCGTAGTGAC
AGTAATCCCAGTTGCGCCTGTGCTGCCAAGCGTCGTCGCTCCGCCAGCAGGTTACCAGCA
CTTGCTGAAACAGCACGCCCTGCAGCCCCAGACCCGCGCCCGCAGCAGCGAAATCGCGCC
AGACGCGGCAACAGCTGTAGTGAAAAATCATCTGCTCGATGACGTCAATATCGGCGGCCG
GGCAGCCTGCGCCCACTGGCTACGCGGCAGCGCCTGCGAGATTCATCCGGTGAGCGCCGT
AGCGACAATCACTAACAACGCCAGCAATAACGCCGAGGCGCAATTCGTTTACTCACGCTT
TACACTCGATGGCGTTATCAGAACGCGCGCACAAAGTGCATTGCCGGAAGCGTCGCGCAA
ACCAGACTGCAGGTACGCTGACGTCCGGCGCGAACAAACGGCATGGCCTGCCAGCGGCAT
TGCCAGCGCATCCATGTCTTTGCTGTTGTCGTGATAAAACGAGCATCAGCATCTTTATAC
GCCGCAGACGATCGATACGGCAGTACTGCCCAAGTTGGTTTCCCCTTGCGGTATTTGGGA
TGCCGTACTCATCAAATTTCACGGAACAAGCTGTTTGGACGAAGACCAGCATGGCGCGGA
TGATAGCGTCGTCTTGGCAGACGCGCACCACCACGCTACAAAGCAGGGGTTTCATGCTGC
AGATAAAGTCTTCATATTGCGCTAAATGCGTTTCCGCTGCGCTTTGCAGGTTAAGTAAAT
CTACCATTTCCGTCAGCGATTTACGCGCCATCATAACGGCTGTTGCCGTCACTGAAGTTA
AATCCGCGACCCGGCGCAATACAGTAGCATTTCTGGTGAAGAGGCCATATCCTGCCGACC
AGACCGCAACGATGGTTCATTTCGTCGCAGTTCAGGATTGGGTCTGTGCGCAAACCGCGT
CGATCACTGAGTCCGGCAATGGTGGTTCGCTGACCACAGGCGATAGTTGATGGTATCCCG
CCACGCCGTAAGGCACGATGCCGAGCGCCAGTAATTCCACCGGCAGCCACTCCAGCGCCA
CAATACGGTGGGATCAATAGCCGCCACCGCGTGGGCATTATCTGCCATAACAACGGAAGC
GCCATCGCCGTTAACAGTCGACGGCGCGAAATAAGAGTAAACCTCATCAATAAACAAAAC
TCACAGGTGCAGCACCCGCAGATGCGGCAAAATACCCATCAGGATGCCGCCTGCATTCGA
GGTTTCGCCGCGCGCATAATTTCACAGGCGTTCTGAGCAATCATTTCACCGCCGCGCAGG
AGCGACAGATATCACAGTAGCGTGCCGCCATATTGATATCGTGCAACGCACGGCAATGAC
CGTCAGGTACGCTCTGACTTAAACAGTGCACCAGCGACAGCACGTAACTGGTGGGCGATA
TCCAGCGCAAGGTCAGTTCGTCGAGCAACAGACGCTTGTATCTGCGCCACCAGCATGGCG
ATCCCGCCCGCTGACGTTCGCCGCCAGAGACTATCGACAGCCGATGCGCCAGCGGTTTTC
AACCAGCGAGATAGCTTCCTCGACTTTTCGCGATCTGCCGCTAAAGCGCCCCAGCGCGCC
ATGCCACAGGTAACGACCAATCGCCACCAGTTCGCACGGTCTCCCGCTTCTGCCGGAGGC
TGCTGCGGCAAATAAGCCGCTTTGCGGGCAAACGCTTTGCTCCAGCTTTCCAGCAGTTGG
GCATCAGAAGAATCTCCTCCGACGGCGGCTGATGACGTAGCATTTTGAGCAGGTGGTTAC
CAGAACCGTTGTGACCAATCAGACCGGTCACTTTCCCGGCAGAAACCAGCGACAGCGGAT
GCAAAAGCGTGCACCAGGCACACGAAAGGAGATAATACGCAGTACAAAAGTGGTATCGGA
ATGATTCGTGTATTCCTGCATAACAACCAACTTGTGAAATGGGCACGGAAATCCGTGCCC
AAAAGAAAAGTAATGAAGGTTGCAGTTGCAACGACCTGACGTTCTGCGCTAAAGCAGCCG
CCATTAAAGCAACTGGCGACGTATTACGTCGAACAGGTTATTGTATACAGCGCCACATTG
GAGCCAGCCATGCGACTCATGAATCGCGCGTACTAACGCATCCACGACCGTATAACTTCC
ACTTTAAAGGGACCGGATCACCATAACTGGAGCCAGTATAACGACCACCGGTGCCCAGCG
TCGAACCTGGCAGACCGTCAAAGAAGGTAGTCAGCCCACAACGAAGCCATGTGTTTTGGC
ACCTGTGCAGGCGTATTGCCTTTATAGGTATCGGTGGTGTATTCCACGTAATTAAGTATA
GAACCATTACGTTAACACTCGCCGACAGCGCCGCTTTCGCTTCGATTTCTACGCCACGTG
CGCGGATCGCCACCTTCAACCGAGAAGAAGGAACCTCAGGGTCCGCCATCAGGTTGTTAG
TTTTAGTGGTGCCGGCACCAGTAACTACAATCGGACGATCTTCAGTACATATTCACGCCG
ACTTCATACTGTACCTTTAGACGGTGCGAAAATATTACCATCCTTAACTTGCGAAAAGGT
TCAAACGATTCTTATAGCTGGCAGGTGTTACACCATTATCAAACAGGTAGTGTACCACCA
CGCGAATAACTGTTTGTCATCGTTTATCGGTCGTCCCGGCAACGCAGTTAGAATTCTTGA
TCTGCCCAGTCATAACGACCGCCTAGGGTGACCAGCACTATCCCACTGCGCCTGATCGAA
CGCAAACGCCCGTTTGTTCTGTTTGTTAGAATGCAGTAGGGCCGGGTTCTGCCAGATCTT
TGGCATTGAAGTCGAAATCGGTATTCACCGGATTGGCCTGAATTGAGCAGTGGCGCTGAA
GTCGTCTTAACAAACAGGCGTTGATGTCATTACGCATACGCATAAAGTCGACACACACCG
GTCAGCAGGGTGTAGTCGATATCGCCAGTGGCAAACGCTCTGCACAACTGGGTATCAACG
GAGAAGTTGCAGCTTCTCATCATCAACATGTTACGTGCCGAATAATGGCTTATCCGCTGG
CGCTAATACCGCACTGTTTGCTGTAAGCATTCGCCGGATCGGAGCAGACGCCGTAACCAT
AAACGCTGTTTGCGAGTTTTGTTTTCAGCAAAGCGCAGGTTCTGACGCACAATGGTGTGT
CGTTAAATTCGTGATCGAAGCTGTAGCCGACCATCTTCTGTTACGAGAATAGGTGTTGTT
CTTCTTCCTTCATTAAAGTCTGTCGGCAGACGCTTACCGTTCGGCAGCAGCTCGGCAGTT
CCCTCTTTCAGCAACCAGCGTAATAGCGATTTCCGGCTCTGCAAGTAAGAAAGGAAGGTA
AGTGGTTTTATCATCCGGACACCCGGTGAACGCCGGTGCAATAGCATAACCTTGCTCTTC
TGACCCTTTCTGCTGGGCATTGGCAGAACGCGCAAGACCGGTCAGGCGATAAGAGTAAAC
ACCGTCATCATCAACGAATCGCTAAAGTCAAAACCAGTCTGGAACAGGCTGTCGGTACCA
ACTTTAAACTGAACCTTTTCAGCAGTTCGGTGGTCGGTTGCTGCTGACCATATTCAACAG
GCCACCGGACTGCTTTACCATAAAGCACAGTGAGCCACGCATAATTCAGCGCGTTCCAGC
ATATACAGGTCAATAACCGCATCGTTATAGAAGTTGCCTGCAACCAGGCCGACAGATAGT
TATTCTGGCTTTGGCCTTCTGCCATAAAAACCGCAGGCAATCGAGTGGTCATAGGTGTTG
GATGCGCCACGCGTACCAACAAGACACCAGCGTGTAGCTAAGCGCTTCTTTACCGACTTC
AGCTGATGCAGCGCCATCTCTCTTCGGCGGTCACAACAAATAGACTGGCACTTTTGAATC
GGCGTATCGGTTTTAGTACTGACGAACGCGCACAATAGTTGCAGCAGGCCCCATGCGCTC
TTGCGGCGCAGGTGCCTTGTGTAACAGTGATAGTGTCTTCTTCGGTTCAACCGCTGCCTA
CCAGCCGCCGTGAACATGCCGCTAACCGCTGTGCTTCTACAACTGCGATTTACGCAGTAG
TGTTTCTTCTTGAACAGTTTGGAACGCGCCATTGGTATATCTCTGATGTAAAGTGAATGA
TAACGTAAACGAGAATGATTATTATAAAGATAAGATAATATTCGAAACGCTGGCAGGTTC
GCAAGCAGTACTAATCTGAAGAGCGTTCCTGAAGGGTTAATAAACAACCAGATGAAAAGG
GTTAATATCTTAGATGGGATGTTATTTTACCGGATGGCAACTCGCGCCATCCATTCTATA
GATGTTAATTACCACCAAACATATCCTTGATCCAACCAGCTACACCGTCGCTGTCTTTCT
GCTCTTGCTGAGCAGGTTGCTGTACGGCTGTTGCTGCAGCTGTGAAGACAGTCAAACGGA
TTGCCTGACGGCTGCTGCCATCTCTCGCTCTGCTGGCACAGCGATTGCGAATCGCTGATC
CAGACCGTACGCATGCCACCGCTGCAACAAAGTTGCCGTCGTAATCCACGCGCCCATATC
TGCAATATCTTCTGGCGGAACAAGATTCAGCGGCGTTGGCGTCTAGTTGGCAGATAACGT
CGTCGACGTACCCGCCTTTTCATACAGTTTGGTCGGCTGGTTGTTATCACGGCCGACCCG
GTGATCACCGTGCTGCCGTCAATGCCCGCAAACCCGGTATCTACGTTATTGTTGGTAGTC
CCTGTTTTCCTGCCAGATGCAGGTTCGGTATTCGCAAGCGACGACCCGTACCGCGTTGTA
CCTGCATGGTCCATAGTGTCAGATACGCCGCCTGCGCCAGGACAGCGCGTTCCGCCTGCA
GGAAGCTCTGATACAACGCACTTTGCCATCTTCCGCGATTACCGAACGCAGCGCAGCGGT
GCAGTTCCACCGCTGGCGATGGTCTGGAATGCCTGCGCCACTTCGATTGGCGTTAGTTCA
ACGCCTGGCAGCATTGCGGAACCGGATGCAACTGATCTTTCAGTACGCCCAGTTTAATCG
GGTCTCCGTAACCTGTGACGGCCGCCATCCCCAGTTACCGTCGGCACGTTCATCGAACGG
GTCTTGCATCCACCAACATCACTCTGCCGCTTTCGCTATAACGACGGTCATCATTCTGCG
GTGACCAGACACGGCCATTCGGCTGACGCAGCGCAGTGGCGCATCCGCAATCCACGTATT
CAGACGATGATAGATTTTCGGCTGGCTTAAGGCCGTCAGATAAGTCGCGCGCTGGTTTGC
AAGAAATTAATCGAACGACGCGCCTGCATCGCACAGTTAGCCCGCAAACTGCGGCTCAGA
ACCTCGACCATCGCACGAACTTCATAAAGCGGTCGACGACAATCGCAGTTCAAGATCGCT
CAACACATGTTTGCTTCAGTGCCGGAATGCCTTCCACGGCGGCTTTTCTGCCGCGTCTGG
GCCCACCGAGTCAAGGTAGTGAAGATCTTCACACCGGAGATCTTTTACCTTATCGCCCAG
TTTGCGCGGCTCCTGACGCACCAGTTGCATAAAAGGCGCTGGCTGAGGAGATCACCCACC
GCGCAGCTGAACCCCAGCGGACGGGCACTCAACATGTCATAAATTTCTTGATCAATAATC
TGTTGCTGTGCAGCGGGCAGCACGCACCGAATTACGTCGCTCCAGCGCCAGTTTGGTACG
CCACGGGTTGTAGATGGACGCCCTTTCCTGCCATACCGTATACAGCGCCTGCTGGTCCGA
AACGCTCTTCTACCGGGCGACCAAAGTAATACAAGCTTGCCAGCGGGAAGCCGCGAATTT
CGTTGTCGCCGCTCTGACCGAGATACACCTCGTTCATATACAGCTCAAAATACGGTCTTT
GCTGTAACGCGCGTCGCAATCAGCGCCATGTAAGCACTTCGTTCGCTTTACGCCAGTAAG
AACGCTCGCTGAAGACAGGTTTCACCAGCTGTTGCGTCAGCATGCTCGCACCCTGTACCG
TGCTCCGGCGGTCAGGTTACCAGCACCACGTCCGATTAGTAGGGCAATTCCATCATGCTC
GTAAAAATGACGTCTTCTGTCGCCAGCAAAGTATCCTGTAAATCCGGAAACCACTGCGCG
GCACAAACGAACGCTATCACCGTTTGGCGAAGATCATGGTGATCGAACGCGGATAAAGAC
GGAAAACCAGACGGCAATTGTTCTCCGTGACGATCGTCGCCAGATGATCGCCATCAAAGG
TCGAACACGCGCGCACCTGTATCCTTCTTTACTGTCCAGAAATCAAACAGACGGCGAATC
ATCTCTCATGCTGTTGGCCTGCACAGTAAATTCGCCGAGACAGGTCATTTGACACCTGAC
GATGATACTGGGTCGCCTCCAGCAGCTTCTACCATCTCGTTCTTCTTGCTGATAGTCATG
TCTGGCTCAAGATTGACATTCGGCCATCAAACTTCTACCGCAGGCAGTTGCAGGCTGCCA
TCAATACGGCTACAATTTTTGATCGAGATAAACGCCGTAAATAGCGTCAGCACAGCAAAC
GATAGCCAGTTGTAATGTCCTAGCCAGCCGCGTTTGCCACGAACACGCCCTTGCCTTTGC
CCGCCTTTGCGCGGCATCGTTCTTCATCCTCATATGATCATCATAATCGTCATGTCGTCA
TCTTCCTTAACGACGACGGCTTACCTTGTTTGACCAGACGCGTCGGTTTCCTTGCGTCAG
TGGCTCGCGGTCATTCCAGCCATGCACCTCCCGTATTCAGGCGCAAAAGCCGATTTCTGT
TCTTCTGTTACAAGACGAAGAAAATATCTCTCCGTTGTGCTCGTCGGTCCCTCTCCTTGA
GGAGAGGGTTAAGTGGTGAACGTGCTGCTGATGCCCTCACCCCGGCCCTCTCCCACAGGG
AGAGAAAAGCTCTTCTACCAGATACTTTTCGTCCGTCGCGTCGGTGCAGTATTGCCAGGT
CGTCCGGCCAGACATGTTAGGATAACGCCCTTTCATCTCTTTTTGCACCTCACGGTACGC
TCCTTTCAAGTCGCTCAAATCTCGTGTGATTTGTAATGGCCTTGGGCAGGTAAGCAACTC
CAGCACCAGCGGCACGCTGGAGCGATCGTCAGATTGGTGGCCTCCTGGCTGTCTCTTGCA
TTCTCACCGCCAGCGCGGGCAGGTCTTCATGATGAATGAATCCGGCTTCCCGTCGGCACA
GTGTGCACGCAGGCAATTCACTATCCAGACATTGCTGCATTCTATCAAATAATCCGCGTA
ATTACCTGATAAATGTCGAGTGATTTCAGGCCGCGTAGTGAATGTACGCCAGTCATGTGG
CAGCAACCACGTTTCAACGCTACCAATAAACTTTCATCATCAACCGCTGGCCAGTCTATT
CGGCAACCGCTGCGGCGCCGGCAAACCTGCGTAGCTGTTCCGCTTCCGCCGTCGTCAGTT
GAGCACGCTTAAACTATCACGGATGCCATTAAGCATCGCCTGATGCAACTCATCTTCTGA
CCTTTCGCCAGCAGCTGCACTCACCGTCAACTGACCGATTGCTTAGCCGACGCCGGGCTT
TCAGCGTACCTTGCGCGTCATCCCTCCACAGTGTCGAACTGCTGTACCAGCTGCGGGCAG
CGTTGTACTAACTCCTCAATATCGACCAGCAGCGCCAGTAAATCCGCGCATCCGGCGAGC
GCCCTGCCAATACGGTGCGATCAACCATTCGTGGCGGCTTAGCGTCGTTGGCATCGAGCA
TCGCTCGCCTGCCGTTGCAGTTGATAGCGTCCATCTTGCCGGCGACGAGCAATACGATCG
GCAAACGCCCGGCAAGTAGCAGCGCGATAAACGAACTGTCTGCCTCACCGCCACGTACGT
TTAAGCGTTGCTGGTTGCTGACTACGTTGTGCTGCCGGGCTGGTTGGTGCGCGAAAACGC
CACGCCAGTCCTGTGCCCATCCGTGGCAGCTCTTCGAAATAGCAGCAATTTTGCAGTAAC
CTTTCGTCGTTCTTCGCGCCGTACCGCTAAGCGGATCGTTACCCAACGCTGCCATTTTGC
CCTTGCGCACGCAAGCCGTTCACCCTCCAGTGCCCCAGCATTGTAACAGATTTCGCGGCC
AGTAGATTCACTACGGCGGTTGATCAACCAGCTCATCTGCGCCGGATCGCTGCATCCCAT
TGCAGTAATTCAGCATCAACAAACCGGAAGATCAGCATAAGATCTCCAGTTCACTTTGCG
CCGCCGCGGCACCGATTTCTGCTGTTCTTTGAATTAATGCAGGCTGATACCCGCTCCAGC
GAACATGGCGCGCCGGCACGCTGCGTCATAGATGCGCTAACGCGTTAGTAATCGCGTAAG
CCCCGTGCGCGGATCAAAACGCGCCACGCTCTGAGCACAATCCACCACCAGACGAATACG
TAATGGTTAAACTGGTTTCAGCAATATTGGTCGCCAGCACCACTTTGCGCATCCCTTGCA
GTGCCGGGAGGATCGCTTTTCGCTGATCGTTCGCGACAGCACTTTTCCTTGGCAGGCAGA
GCAATACATCACTGCCGATGCGCAAGCCATTCCTACACGCTTTAATTTCTCCGACGCCGG
TAAAAATAACAATGGCGTCCGCTTTCCTGACGCAGCGCATTTCAGCGGTGGCTACCACCA
ACGGCATCAAACGCTGATGCAGGCAGCGTATTAAATAACGGCGTTCAACCGGAAACGAGC
GCCCTTCTGAGATGACGACAGGCGCTTCTGGCAGCATTGCTGCAAGCAGTCGTTGTCGGG
GTAGCCGACATAATCAACAGTTGGGTCATCACGCAGACCTTGTTGCACATCAGTAACAGC
GCCAACGCCGTCCGCCGCAAGCTGCGCTCATGAAATTCTCGGATCACCAGTCGCACACCG
CTCAGTTCCGGGTCACGCTGGATCATGCGCGTCAGCACGCCTTCGGTAACCACTTCGAGC
GGGTATTCGGCCGACGCAGTTTTACGCACGCATCCGGTAGCCAACGGTATCGCACGGCTT
TTCGTTAAGCAGCTCCATAACCGTTGCGCGACGTTACGCGCGCCGCCAGACGACACGCGG
CTCAACAGGATAATTTCCGTTAATGCCGGGATGCGCCAGTTGCAGCAGCAGCCGAGGTTG
ATTCCGGCCCCGGTCGGCGCATATAATACCTACGGCACTGTCGAAGCGTGCTGAATTCAG
GTGAACGGCGGCAGCAACGGGCAGCGGCGACACAAAACGCGCTCAGAGGTTAACATTCTT
CGCGCCACATTGTAGCATCGCGGTAATTCATAACCGAGTGCCTCACATGTCTGAACCGCA
ACGTCTGTTCTTTGCTATCGACGCAGAAATCCGCGAACAGATTATCCATTGGCGCCACAC
TTCCTGAGGCAGGACGTCCGGTCGCCGCCGATAATTCCATCTGACTCTGGCATTTTAGGC
GAAGTGAGCGCCGAGAAGAAGGCGCTTTCTCTCTTTTAGCCGGATTCGTCTTTGGTTTCA
CCTCACGCTTGATGACGCCGGACAATGTGGCTGCGTTCGCGTGTGGTGTGGTTAGGGATG
CGTCAGCCGCCACGCGGCAATCCAACTAGCAGTATGCTCCATTCACAGGCTGCCACGGAT
TTGTTTTCAAAGCAATCGTCCGTTTCATCCACATATTACCTTATTGCGACGCCAGCGAGG
CGGTGACAATCCCTGCCAGTTTAACTAGTCGTATGCGGTGACGGATTCTACCTTACGCCT
CCTCGTTGCCCGTGGACTACCGCTACACCGCTAAAACGCTGAGCGCTAACGCAATAACAA
GGATTGTCGCAATGGAATTTTCTCCCCTCTACAGCGCGCGTATATTGTGTTCGACGGATC
CTGGTCCTGATCCTTCGAATACGGGTGCGATGACCGGTGTGCAACGCACGGCGATACCGT
CTGGTATTCGACTGAACAACTGAAGCAAATACCCACACACACGAGGTGCTCTAAAGCCGA
CGGCGCATTTATTTGCGTCAACACGCGCTGAGCTAACAGGTTGACGAGGCTATCCTTAAT
GAATCAATTTCAGAACATCGAGCTATGACTCGCTGAAAAGCGAAGTAAAATACAGCACCA
GAACGCAGCCGTATTGACTTTATGTTGAGCGGATTCGTCAGACTGCTATATTGAAGTGAA
ATCGGTTACGTTGGCGGAACGAACAGGGATATTTTCCCGATGCGGTCACTGAACGAGGTC
AAGCTGTAGCGGGGTTGATGAGCGTAGCTGAAAACCAGCGTGCGATTATCTTTTCGCCGT
GCTGCATTCAGCCATTACACGGTTTTCACCGCGCGCCGATGAAATACGCGCAACTATTGT
CAGAAGCTCAACAGGGGTAGAAATTCTGGCCTAAGCGGAAAATTTCTGCTGAAGCATAAC
TCTTAAAAATCACTGCCGGTTACATTGTAGTAAGTAAGTAACTGGTTAATTACATTCTGG
TCGCGTGCGCAATACGCTTTTCTCACACAGTTGTCAAGTGTTACGTTTAGATGGTGCTAT
CCGAAAAGCATCTGCTATTGCAGCGGCCTCATTTCCCCAGCATGAGGATCGATAGTGCGT
GTTGGGCTGTAACATGCAAGAGGCAAAACCGTAAAACATCGTCCTAGTATTCTCGCCATC
GCTGGGGTGGAACCATATCCAGGAAGCCGGGCGAAAGTATATGAATGGCCAATGGCGGCG
CACTTCGTCGTATTCTGGAAGCATGGCGTAATCAGCATCAGGGATGATCGTCGCACCGTT
ACATATGCAGGATAAAACAGCCAACCGGACCCGGTAGACCGTGCAGCCGAGGAAGAAGAG
TTCAGCCTCGAACTGCGTAACCGCGATCGCGAGCATAAGCTGATCAAAAGATCGAAGACG
CTGAAAAAGTGGAAGACGAAGATTTCGGCTACTGCGAATCCTGCGGTGTTGAAATTAGTA
TTCGCCGTCTGGAAGCGCGCCCGACAACCGATCTCTGACCATCGACTGCAAAACGCTGGC
TGAAATTCGCGAAAAACAGATGGCTGGCTAGTAGCCGTTCCATCACGTTACCACAGGCGG
AAATACTCCCGCCTTATTTTGTTAAGAGATGACAGACACACAGTATATTGTACTTCGCCC
CTCTCCTTCCGGCAGCTTCATTTTGGCTCTCTCTGATCGCCGCGCTCTTGTGTTGCAGGC
TCGCGCCCGGCAAAGATCGCTGGCTGGTACACATAGAAGATATCGACCCGCCTCGTGAAG
TTCCCGGTGCGCAGAAACTATCCTGCGCCAACTGGAACATTACAGTCTACACTGGACGGC
GATGTTCTCTGGCAATCGCAACGTCGACGCCTATCGTGGCCTCACTGGTTACATGAACAA
GGACTAAGTTATTACTACTGTACGCGTGCGCGTATTCAAACATTGGCGGTATTTACGACG
GTCATTGCCAGGTGTTGCATCATGGACCGAACAACGCCGCAGTGCGTATCCGCCAACAGC
ATCCGGTCACGCACAATTGCTGACCAGCTGCGCGGCATTATTCACGCGACAGCTTCTTTT
GAGAAGATTTTATCATTCATCGCCGTGATGGGTTGTTCGCCTACAACACAGCTGTTGTAG
TTGATGATCATTCGGGGCGTTAGAAATAGTGCGTGGGGCTGATCTGTGAACCAACAGTAA
GGCAAATCTGTACCAGCTTTTGGCTGAAAGTGCCAGATTACATTCATCTGCTGCTGACTT
AATCACAAGGCGCTAAACTTTCAAGCAGAATCATGCGCCTGCGTTGCCGAAAACGATCAC
GCCAGTACTAATCTTGACACTTCAATTTCTGGGGCAGCAGTGAGAAGCACACTGGCAGGA
TTTCAGCGTCGAGCAAATCCTTCAGTCGGCAAATCAAAACTGGCGTACCATATGCCCGGT
CGGCAATTGTAAATTCAACATTCTCGTGCGTCATGCTGAGCTATGATTAGCCGCTATTTT
TGTCTGAATGATGTTTGACACTACTGAGGTGTACTATTTTTGCGAGTCAATTTTGCCGCA
AGGTGCTAAGCACGCGAGGAAAGCGAGGCTGAACAGGCAGTCGCCGTCCACAGGTAGCGG
TGATCCCGCGTGACAGCATGCTATTTCCGCAAGATATCGGTGAAAATGCCCTGAAGGTAA
TGTACAGGCTCAATAAAGCGGATACGAAGCACGGCTGGTTGGCGGCGGCGTGCGCGACCT
GTTACTTGGCAAGCCGAAAATTTGACGTAACCACTAACGCCACGCCTGAGCAGGTCTGCA
AACTGTTCCGTAACTGCCACTGTGGGTCGCCGTTTCCGTCTGGCTCATGTAATGTTGGCC
AGAATTATCGAAGTTGCGACCTTCCGTGGACACCACGAAGGTATGACGTCAGCGACCGCG
CACGACGCCTCCAACGCGGGCAAAACGGCATGTTGCTGCGCGACAACATTTTCGGCTCTC
CATCGAAGAAGGCGCCCAGCGCCGCGTTCACTATCAACAGCCTGTATTGGCGTGGCAGTT
TTACCGTCCGTGATTGCGTTGGCGGCATGAAGGATGAAGGACGGCGTTATCCGTCTGATT
GGTAACGGAAACGCGCCGTGAATCCGGTACGTATGCTGCGCGCGGTACGTTTGCCGCCAA
ATTGGTATGCGCATCTTGAAACCGCAGAACCGTCCTCGCCTCGCTACCCTGCTGAACGAT
ATCCCACCGGCACGCCTGTTTGAAGAATCCTTAAACTACAAGCGGGCTACGGTTACGAAA
CCTATCTCGCTGTTGTGTGAATATCATCTGTTCAGCCGCTGTTCCCGACCATTACCCATA
CTTCACGCGGAAAGTGAGCAGCCCGATGGAGCGGATCATTGAACAGGTGCTGAAGAATAT
ACCGATACGCGTATCCATAACGATACGCGTGAACCCGGCGTTCCTGTTTGCCGCCATGTT
CTGGTACCCACTGCTGGAGACGGCACAGAAGATCGCCGAGAAGCGGCCTGACCTATCGTA
CTCGCTGGCGATGAACGACGTGCTGGATTAAGCCTGCCGTTCACTAGCAATCAGAAACGT
CTGACGACATTAACCCGCGATATCTGTAGCAGTTGCAGTTGCGTATGTCCCGTCGTCAGG
GAGTAAACGCGCATGAAACTGCTGGTATCCTAAGTTCCGTGCGGCAAATATTGGCCTTGC
GAGCTGAGTTGAGCGTAACGCTGAACTTCTGCAGCGTCTGTAATTAATGGTGGGGTGAGT
TCGAGGTTTCCGCGCCACCAGACAAAGGATGCTCAACGAGCTGGATGAAGAACAAATCAC
CGCGTCGTCGTACTCGTCGTCCACGCAAACGCGCACCACGTCGTGAGGTACCGCATGACA
GTGGCGTATATTCATAGGCAGCAATCTAACTCTCCGCTGGAACAGGTCAATGCTGCTGCC
CTAGCTTGATAGGCGATATCCCACAAGCCATTCTTACCGTTTCTTCGTTTTACCGCACCT
GCTGGGGCCGCAAGATCCTTGATTACTTAAACGCAGCCGTGGCGCTGAAACCTCTTGCAC
CTGAAGAGCTACTCAATCACACAGCGTATTGAATTGCAGCAGGTCGTCCGCAAAGCCTTG
AACGCTGGGGACCACGCACGCGCTGGATCTCGACATCATGCTGTTGTGTGAAGTGATAAA
TACTGAACGCCTGACCGTTCCGCACTACGATATATAGAATCGTGGTTATGCTGTGGCGCT
GTTTGAAATCGCGCCGGGTTGGTGTTTCCTGATATGGGGAGATGTTGCGTCAAATCTTAC
ATACAGGCATTTGACAAATTAAACAAATGGTAATTTATTTATATTGCGAATATAAATATT
TTCTGAAAATCTTATCTCATCTCTTTCCTTAATTACGATTTTAGTTTAAACATCTCTTGC
GGAAATAATATATAACTTCCTATAAATAAATATCAATCCATCTCCATACCTAACAATTAC
ACTTATGTGAACTTATTTTTACTTAATTTGAATTAAGTAAATTTAATTGTTCAAAAGCTT
CTAAAGTGCACAATAGGCGACCTAATGAACAATGGTTGTAAATTTGGGTAACAAATATGT
TATCATTAATATCTTTATTGTTTCTCCCTATTGTGTCTGAATATAGTGTTCTTCAAACAT
GGTGTTAATGGAATTTACAGTAAGGATTTTATGTCTAAAATTAGGTTTGCCTGTCTGGTC
TTATGCTGGCGGTTGCAGGTACTGCTTCTGCTGATATGGACGGCAGTCAGTTAAATATCA
GTGGTCTGGTTGTTGATAACACCTGTGAAACCCGCGTTGACGGCGGTAACCAAGGATGGT
CTGATCCTGCTGCAAACCGCAACCGTTGGTGAAATCGATGCTGGCGTACTGAATGACACC
GTTGGCGCTAAAGCTAAACCTTTCAACATCACCGTTGACTGCAACAAAGCAAATCCGAAT
CGAGTAGCACAGCTAAAATGACCTTCAGTTCTGTTTTCTTTAGTATGACAAAAGGGACTT
TGAATTTCTTGACATGTCTATTAACAACCATCTGACGGCGTTAATATCGCTCTACACAAT
ATTGATGGTTCCACTATCAAACAGGTTCAAAATGTAACCGAGTGTATACTAAAGCCACGG
ATGCAACGACAAAATCTGCTGTTTATGATTTAAGCGTCTTACGTTCGTGCGTCTGAATAA
ACGCTGCTGGTTATGTAAAAACTAACACTGCATACACCATTACTTATCGAAGTAGTATTC
ACCAGTTAAATTGATTGAATAGATATACAGGGAATAATAATTTCTACTATATTATTCCTA
TTTAGTGCTCTATCAGGGATAGTTTATGTTTTAACACAAGCTGCTAACTTTATCTTCTTC
ATGGCATACCTGTATGGCTTTTAGTTCATCTGTGCGGACATTGTCATTTGGGTACTCGCG
TAATATATAAAAGCGATCAAAAAGTGTCAACGTACGTCACAAATAAGGAATAACCCGTTG
CTTGTCCAAATTGGTTAGATACTGGCGATGACAACGCTAATTTAACGGTAATACAGTCCC
TTTACTACTACGCCGCCATTATCGCGTGATGCAAACGTGGGCAAACAATCAAATTAATGT
ACACAACCAACACTCACTGCCTGAACAAGCGTGTTCTGGTTTAACGTACTGAAGTTCCAC
CAAAACCAGATGCTGCAGAAAAGGTCGCGAATCAAAAGCCTGCTGCAACTGGCATTTCCG
CACACGTATAAAACTTTCTATCGCCGGATGGATTGAAGAAATCCCTCTGAAGCCCGTTAG
CCTAAAATTAGTTCTGGTCAGGTTCAGAAGGTAAGGCGTCATTACAGTGACAATCCAACC
CCTTACTACGTCTCTTTAGCAGTGGTGATTTAAGCTAGCGGTAAACGCTATCCGATTGAT
GTAGTAATTGCCGTGATGTAGGGTCATGAAAGTCAATGGCCTTAATGGCAAAAGCAGATT
CTACAAAAGTGCATTTTACGCCATTAACTTTGTTAGCCTGGTGAAAATGTGTCTGAGGCT
ATAATCGAGCAAGGATATAATTCCGCAGGAAACATAGCGTGACTATAAGTATACTAAAAT
TATCATCATCATCTGACCCGTATCGCCACGCGCTGCATATTACAATACTGCTTTCAGTGC
CTCGTTAGACAGCCATACCTTCTGATAGAGCGAATGCATCTATGTGATCTCAGCCGGTAC
AGTGAAGGTAACCCGCTATACCGGGTGTTTACGACGTCGGTATATGGCTGTCAACCAATC
ATTAACAAAATATTACATTTGTCGCAGTGAAGGAAAAACGCCGAGCTTGTATCCACATTA
AGAATTTGTGCAGTTCATAGTAATTCTCCCGATATAAATAACAAAAACCGTTCACTTGCG
AGAGATAAAACGCTCGGCAATTACTCGGTGACGAAGTATCCCTCAGGCTTCTGTTCGTTA
TGACGTTAACGATCAACGTCTGGATATAGACGTTCCTCAAGCTTTGGTAATGAAAATACA
AAACATTGATCCATCGTTATGGAAAACGGCATTAATGCAGCCATGTTGTCATACAACCTC
AGCAGATATCATAGTGAAACCCGGTCGAAAAATAAGCATTTATGCTGCATTTAACAGTGG
GATGGTGAAATTACGCATGTGGCGACTGCGTACTCGAACGCTACAACTGGATGACCGATT
AGCAGTAGTATGATTTTCAGAATCGGTATGTCAGCGTGATATCGCCTCGCGCGCGTTCTC
AACTCATTCTTGGTAGTCTTATGACAGGCGAAACCTTTGATTCCGTCAGTATCGAGGCAT
TCGTTTATACAGTGACAGCCGCATGTTGCCTCCGACTTTAACCAGCTTGCGCCTATCATT
CATAGCGTTGCCAATACCAGCGCCAGTCACTATACGCAAGGTGGCTATAAGATTTATATG
AAACGACAGTGCCGCCGGTACACCGTCATTGATCTGAGTCATCCAGAAATTGCAGCAGCG
TCTTATTATTACCATCGAAGAATCCATTAGCTCAAAGCAGACATTCTCGCAACCTTCTCA
TCCGTTGTTCAAATGTTACGCCCTGTGGCGTTGGACGTTGGGATAATAGCGGCAGTCAGG
TCTTAAAGATGATATTCAGGATGAGCCTAATTTATTCAAACAAGCTACTACTGCAGCCTG
AACAACTATCGACGGGTTATACCATTATTCAGATAACCGATAATAACTATACCGCTGGTT
TATTAGGTCTTGGTCTGAATACTTCGGTGGTGCATTTTCTTTCGATGTGACTCGTGTTCG
TATCGGATGATAAAACATGCCGAGGGCAAAAATTATCGTGTTTCACGGAACAGTTATTCG
AAAATGATACTTCACTGAATATCGCGGCCTATCGCTATTCGTACAATTACCTTGGTCTTA
ATGATGCACTAACTCTAATTGATGAAACATCGAACAAGATCTTGAACCGAAATCCATGCA
TTACTCGCATGAAAAATCAGATTACGGTCATTAACCAACCGTTGGTGAAAAGATTACAGT
TCCTTTATCTTTCGGAAGTTGGTCCGATTGCACTAGGCTTCCGGACAAAATAACAATTAC
TCTATTAGCTACAGTAACAGTGATACATCTGGGAACTTGCTTCTGATGTCCGAGTGCCAG
CGTTCATGAATATGAAGACGGCGACACTGACGACGATAGCGTTATCAGTTCATTCCAGTG
AAAAATTGGCACTGGTGCTTGTGCCAGGTTTCCAGTATTGATACTCAAATAAGCAGTGAC
TTAGGGTAATACTCTTAGCTCAACGTTAGCAGCAGTGGCTAGCGATAACGCTCGCGTCAG
TTATAGCGTGGTTTCTGGCGGCTATACGATGAATAAAGCCAGCAAAGATTTACGGAAGGT
TATGTATGTTGGGGGTTATGCCAGCTATGATCACCATAAGGGGAACGCTGGCGGAGTTCA
ATTCTGCTGCAAATATAGCGATATTAACAACCGTCAAGTTTCTCTCCAGCACCGACGGTG
GTTTTATGTATTACATAGCAGTGGACTGACTTTGGTAATGATAGTTTTAGCGACTCGATA
CACTGGCGGTAGTTCAGGCTCCAGTGCTCAGGAGCGCGAATAAATTATAACGGCTGTTAT
CGATCGATGGGGTTAGCATGGTGTCACCAGCATCTTTCTCCTTATGTAAAAACCGTATCG
CGCTGGATATCAACGATCTTGAGAACGATGTTGAATTAAAAGTACCAGTGCAGTAGCTGT
ACCGCGTCCAGGGTTCAGTCGTCTTTGCTGATTTTGAAACCGTGCAAGGGCAATCAGCCA
TTATGTTACGAAGTGATGGTAAATATTCCATTTGCTGCAGATGTTATGATGAGCAAGGCA
ATGTCATTGGTAATGTGTTGGACAGGGTGGACGGCATTTGTTCGTGGTATTGAGCAGCAG
GGAAATATCAGCATTAATGTAGCTCGAACAGAAGTAAACCCGTAAGTTGTCTTGCGCATT
ATCAACAAAGCCAAGCAGAAAAATAGCACAATCTATTATTCTGAATGGAATTCGGTGTTA
AGATTCAGTAACTACAAGGGACGTCAAGTGATAAAAGCTCGCCATAAAATAATTGATACT
GATATTATTATCGCCTCAGTATTTGCAACAGATATTAATGTAGAGTTTACAGCCACTGTC
AAAGCGACAACCTGTATCCACTTACCAGCGGTAATAACGTCACGAATGATGGCAATAATA
ACTACATTGAGAATCCCTAAGATGGAATGGATAGATCGCGAATAAAACGACAGAATCTCA
GGCCTGATTTTAAAACTGGTTGCCAGTGGGTGCAGCAGTGGCATCCAGTTGGATGATACA
CTCTGACCGAAGTAAATGTCAAGCTCACCTAAGCGTATGCCGCAGTCTGGTGATTCATCT
TCGACGACAAGTAATATCGGTATGGGTTTCAAAACAGCTACTGATGATGCCGCTTTCGCC
GACCTAACGGTGGAAAAGATACGCTGGGCACAGACGAGATGCAACCCGATAAGGGTCTTG
AAATGACCGTTGCGCTACGTAGAAACAGATGCAGGAGCCGACGTACCAGGAATTTTCGTG
CACTGGCGACATTTAATTTCATCTATCAATAGAAGGATAATTATGGTGTTTAAAAATTTA
CGTTATAGATTAGCATCAGCAGTGTCGTTTGGCTGCCTCATTGTTCAATACTCTTATGCG
GCAACAGACAGTATTAGTTGATACGTTATTACTACTGTAGAAATGGGTACTTACCGCGCT
ACATTAGTAAATGACTCTGATCAGGACATTCCTGTTGATGATGATTTTAGTGATGATATG
TATATATTTCTGAAATCAATGCAAGACCAAGTAAAACATTTAAACTCAAATTCAAAAGAC
TGTGCAGGTATCCCCAATAAAAAGCGCAAATAAAATTAACAAGCGGAAAACCACATGCGA
GGAACTGCTAATGACGGTGCAGGGTTTGCAAATGGATTCCACAACCACTGAATAAAGCAA
GTGCTGTCACCGTTGAAGTCTACTGGAGCACTGTAACTCCGGCAACAGGAGATTACCAAC
ACAATTGCTTCTTCGCATCACAAGAAGTAACAATCTCCCTGCAGCCAATACGGTCGTTTA
TTATCCGATAAATTTTGTGGTCGTGAAAAATAAAACCGTAATGTCTGCGGGTAAGTTTTC
TGCCAGCCACATTTACAGTAACTTTCTAACTAACAGACTTACAGATTCAGGAACTATATG
CCATCCCTCGCGTAAGCTGATGAAGAATAATTCTGTTTCTGTCATTGCACTGCATCGCCT
GTCCAGCCATTGCTGGACAAGGATGTCGGCTGTTGCCAATGTAAAAACAGCACCTGCAGA
AAGCCGTCAGTAACGAGGTAATATTGATCTTGGCGGCGTCGTTAGGGTGGGATATTTTCA
GGTAATGTTACTCCTGAAAGTTATCCAGCAGTGGAAGAGTTCACTATCACTGTATCCATT
GTGCATTACAGGAACTGGCGATGTGCTAAATCGATTACATATTGATTTTAGAGCCCTTAG
CGGTGTCATGGCTGCTGGCTCTAGGCAAATATTTGCTAATGAAATTTCGTCAGGAGCAAG
TAATGTAGGAGTAGTTATATTTTCTACTCGATTAAGCGAATACATTCAATGTTCTTAATC
TTCGACGGATCTCATTCCGTTTATCCAGTAATGTCGGATGACAAGATAGTTCATCACAAA
TTTAGCACCGAATGCAAAAATCGTCCTGCATTGAGTGTTACATCTGGTCAACTTATGAGC
CATGTGTTAGTGGATGTTACTGAATAAACAAAAACAGCGCAAACCATAACAATAAAAACA
TTGGAGTAAAAATAAGAAGACTATCTTCAGGTATTGCTTTTTAGCACTGTATTCTTGTTG
TAATATGATCAGTGCATGTATACAAAGTTTTATTGTGGGAAATAATGCAGGAGTTGATAA
CTATCAAGGAGCCCCTCCACTGCCGCACAGATGACCTTTAATTACACATCAACAGCAAAC
AGCGGTTTAAACCCGCGCTCGGCCCGACTGGGGGTAAAATTGCTAGTCATACGGATACAG
GTACCGGTGGTGTTCTTTCTGCAGCCATCTGGCAGAGCGAATCGTTCAATAACTGTGAAA
ATGCTGTGGTCTATTCAGGTAAGATTGGCGGACATAAATATTAGCCATCCTGTTCTGGTC
TGTATTACCTGTGTTAATATCCAAGGGTCTGGTCTGCATACGATACAATAACTGACATTC
AATCGCCGCCGAGGAATCTATATCGGAGATCCTTCAACCAAAATTTCTTTTCCGTCTGAA
CAGCGAATCTACAAACTAAGGGTTGCAATAAAGCAGACGACTACGATAAGTTTGGGCTAT
TGGTGGTATAGTACACAACATAACTGTTGAATTTTATACAGATACTAATTCGATCCTACA
CTTAATCCAGCAAGTCCAGTTGGTTCATCAAATTACCTTTATTCGTTTAAGGCCTACCAG
TCACGGTACAAAGTTGTGAATCACAACAACCACATTGTAGCCAATTTCACACTGAATAAT
GTCAAATTAACCTTACCAGCATGTTTACCTCCATACTTACCGGGCCATCAGTCAATGGTT
CAACGGTTAAAGAATGGGAGAATATATAACTCTGGGACAATTAAAAATGGCGCTTCACCT
GTTCCCTTTGATATCTCTCTTCAGAATTGTATTCGTGCGTATTAAAATAAAACTCATCAC
TGGAAAAGTAGGTACTCATTGCAGCTTCTTGGTAATACACGCTTACTGGAAGCACTACCA
TGAGCGTTGGCGTACTCATTGAAGGTTTAGCAACCAATCCATGTGACATTAAAACCTAAT
GATACAGGTGCTGTTTATAGATTATGAAACAAAGATGACACCTCCGATGGGTTTACCTAA
TCAAGGTAACATCACAGCCTCTTCATTCCGGGCAACATTAAAGCAAGACAGGAATATTGC
TATCCGAACCGGCGAATTTAAAAGCACCAGTACTTTCGAGGTAACCTATCCCTGATAACA
TGTAGCACTGCTGTCACCTTCTGGCAGTGCTGCTACGAATCATCGTACCCCCGCAATGTG
ACTGATAATGCCAGACGGCACAACATCAATTTATCAAGTTCGTTATGAAACCGACCATCT
CCTTACTGCAGAAGTAAACAGGAAAAACGTTTCGCGACCATCCGCTTATGACTATAGCTT
CGCCAAACTCTTTGCTGATGAAGGCTTAACGTCATGCTGGTGGGCGATTCGCTAACATGA
CGGTTCGGGCACGACTCCACCCTGCCTGCCAGTTACCGTTGCCGATATCGCCTACCACAC
TGCCGCCGTACGTCGCGGCGCAAGTACCTGCTGCTGGCCCGACCTGCCGTTTGTAGTATG
CCACCAGGAACAAGCCTTCGAAAACGCCGCAACGGTTATGCGTGCCGGTGCTAACGTAGT
CAAGTGAAGGCGGCGGTGGTGGTGAAACCGTACAAATGCTGACGAACGTGCCGTTCCTGT
ATGTGGTCCGCCGTTTAACACCACAGTCAGTGAATATTTTCGGTGGCTACAAAGTTCAGG
GGCGGCGATGAAGCGGGCGATCAACTGCTCAGCGATGCATTAGCCAAAGCTGCTGAGGCA
CAGCTGCTGGTGCTGGAGATGCGTGCCAGTTGAACTAGCCGACGTATTACCGAAGCACTG
GCGATCGGTTATTGGCATTGGCGCAGGCAACGTCACTGACAGGCAGATCCTCGTGATGCA
CGACGCCTTTGGTGTACCGGCGGTCACATTCCTAAATTCGCTAAAATTTCTCGCCGAAAC
GGGCGACATCCGCTGGCTGTGCGGCAGTATATAGCTGAAGTGGAGTCCGGCGTTTGTCCG
GGCGAAGAACACAATTCCGTGGAGTCACGTTGTGTTATCGAAACCCTGCCGCTGCTGCGT
CGGCAAATTCGCCGCCTGCGTGAAGGCAAGCGCGTGTGGCGCTGGTACCTACCATGGGTA
ACCTGCACGATGGCCATATGAAGCTGGTCGACGAAGCCAAAGCCCGCCGTGTAGTCGTCG
TCAGTATTTTCGTTAACCCGATGCAGTTCGACCGCCCGGAAGATCTGGCTCGTTATCCAC
GGACCTTACCGCAGGAGGACTGCGAAAGCTAAATAAACGTAAAGTGGATTGGATTTTCGC
CCTTCGTAAGATCTACCCGAACGGTACTAAACCCACACTTACGTTGACGTTCACGGCCTT
TCGACATGCTGGAAGGTGCCAGCCGTCCAGGACATTTCGCGGCGTTTCGACTGTGTCGTA
AGCTGTTCAACGCTGGTCAGCGGACATCGCGCCGCCTGCTTCGGTGAAAAGATTTTCAGC
AACTGGCGCTGATCCGCAAAATGGTTGCCGATATGGGCTTCGATATTGAGATTGTCGGTG
TGCCAATTATGCGCGCCAAAAGACGGTCTGGCGCTAAGTTCCATGCGCAGTTATCGACAG
CGGAACAACGCAAAAATTGCGCACTGGTCTGTACAAAGTTTAAGTTCGATTGCCGATAAG
TGCAGGCTACAGGGAACAGGATCTCGATAAGAGTATTCGTGCGGGCAAGAACGAATGAAA
AGGCTTCCGCGCCGATGATATTCAGATTCGCGATACCGACACATTGCTGAAGTTTCAAAC
CAGCAAACGGGCGTGGTCCTGACGCCGCGGCTTGGCGATGCTCACCTGATCGACAACAAA
ATATAGTCGACTGGCGTAATATAACAGCGCTTCACGGCTGATATGGCGCCAGTTATTAAT
TTACCCACGTCATCTGTCATAACACAGGTAACAAATAAGGTTATTACCTTATCAATCTCT
CAACAGTAAATTTGCCATCTCTGCAACGCGTCTTCCAGACATTCCTTTACTCAAGAAGAC
GCTGGGCGAATTCCTGACTTACTTCCTGTCTTCCTGCTGAATCCCCTTCTCAATCCCGCT
TTCTCTTCAAACCACTGCGCCAGCGTCATCATAAAACTCCCTCCCGTTCCCTGTCTCTCA
ACACACCGTAAAACAAATCCGCCCCATTCCAGTATGACCGCGTTGCAGCATATAGTTTGC
ATAGCAACTAACTGACTTCCGCTAGTGTACCCTTCGTCAGCGTGACAGTTATCATAACAT
TAAGTCGCCTTCAGCGAATATGTTTTGCAGTAGTTCGAAATCGCAATCCGCCGATGTTGC
ATGATTCGTCATCCGGTGTGATGGTGATATCCTGGCAGAAAGAACTGTTATAGACGCGTC
GCGCCAGCTCCGGCAAGTAAAACATCAAACCAGCACATTGATAGCGGATACAAGGTGTGG
CCTCGCCTGATAAAACAGTATCGGCACCCTGGCCAGCAGCTTATCATTAGATCAACCTCC
AGATGCCAGTGCATAGCGTGAATAACGCATCATGCGAAGGCCATTTTCTTATCCGGCTTG
CTTTGGTGTTCAGTACAACATGCAGATAACCGGGATTGCCCTGCATTGCACGGAATAGAA
CGTCCGTGCTGTGTCCTTTCAGGCTCTCTTCAATGAAACTCCCCGACTCTAAATGAAGCG
TGTTGAGGTCTAAAGTTCGCGTAATTCCACTGGCAAATGTATCTCCAGAAAGTCGCGAGC
CGTCTCCGCATGCAAAATTGTTTAAATACCGCGTCATACGGTGTGAGCCTCGGTATCCAT
CTTCCTCTTCCGTGTGGCTTTGCGTGAAGGCAGTATCCAGTCAAGGCGCGCTATCGTCAG
CCACCTCTTTATTGTTTACCGAGAGCAGCGTTCAGAGAAATATCAATTCGTTGGGCGATA
CATGGCACCTTCGGCGCAGTACGCAAACTGCTGACGCAAATGCCGTCAGATGAGTAGACA
CTAAACAATCGAGCAGCAATACTGCGTGAAATTTCCTCAAAGCAGGCATCGCCTGCTTCG
TTAACGACAGGTAGAAAGGTGCAAAGTTATATGATTCACTTTGATGCTGCCAGAGACAAA
CTCCACCGCGTGAAAGTATGCGGACCTGCACTATGAGGTTCTTGCGCCGATGACGAGGAT
TTTCTTGACGCAGCCAGCGGTATTCTCAAGCAAGCCATTGATATCTGGAATGTCACCAAC
GTAAACGTTTCTCCACTTATGCCATCGCAGCAGCAGAACGCGCAGTTCGAGGTATTTCTG
TTAGCAGACGGCGGCCCTGCCTGCGCCAGTGTCGCTTGTGTCATCATCGCCAGCTTCGTT
ACCATGCCAGATGAAGAAGCTCGCACTGGCGACCAACGTCATATTTTGAGGCAATGAAAT
AGTACCGCGAAAGCGATTCAGTACAGGTTGTGATTATTATCCTGCGGTTGGTTATCACCA
GCCGCGACATCATCCAGCAGATCCGTTCTTAAGATATATAAAGTCGTTTAGTAACAACGG
ATTATCCCAGTTTACTTGCCTTTCATAGTTGTCACCGCGAGGTAAAATCCGGCATCGTTT
GCTGCCTTCACGGCGTTGTCATTAAATCCGCCAAACAGTGCAGATACCACCAGACATGCA
GTTAAATTGCGCCAGAGCGCGGCGTGAACGATGCAAAATCAAACAGAATATTGTGCTCTA
CGGCTCTCAATGTATATGGGTCGGCGATAACCATCTACCGATGCTGCAAAAATGGGTATG
TGACTGAAATCAAATACATCGCAATTCGTTAGCTCAGAAACGCTCATAAATTGCAGCGTT
TTGGGTTCCACTTCTGCGGGTGACGTTGATGCGTGAGGTAACAATAAACGCCGTCGCCTT
CATGCCTATTGTTTCTTACAGGATACGCATAGCAGCTCACCGACTTATGAGGCCATCATC
AAGGTAATCCTGCCACCGCGCAGGAGATTGATCTTATTCTTCACGTAGCCTTCCAGCTGC
ACCATGCTCAGTGTCGCGTATCCTGTCACGCACCTTGAGGGCCATCTAGTTGTGAAAGCG
CGTACCGATGTGGTCGTCGAAATGGCGAAAACAGGTGTTTTTCTTCGTCGCGCAGAATGG
TGATAGGTTAGCACCGACAGGCCATTATCGGGTTGGGCATCCAGTGCGCGCTGATATATG
ACGATCGATACGCCAATACGGATCTGATGCGAGGTTTGTTAACCTGTCTCTTTCAGTTGC
TGCAAAATCAGGTAGCCTGGGGTGTCACCAGTACCCGATAGCGCTTCCCGCCTCGGCGCG
TTATAGACGGCGTATCTTTCCGAGTAACAAGTTCTGATTACTCAGCAGCATTGAGTCTTA
AACCGTCTTCAACTTTTGTCGCCCTGAACCGGCTCGAATGACCTTATCGATAAAACCTTT
GCAAGCAAAATTAAATGCGTAATAACTTGCGGCGGTGGGCTCCGGCAATGATTTGTCCGG
CCAGGCTTCCCCACAGTCACCATCTTGTCACCAATTTGCGCAGACCGCAGCATTTTCGAT
GGTTGCATATATTAACAGGCAGAGTAACGCAGCACTGATGACACTTGCGGTAAACAGCAT
CAACAGAATAACAGCTTGTTTGTACATGAAAATAACCGAGGTGAAACAACGCTTTTATTG
TAGCAAAGCGCCATCAGAATCGCAGGTTGTCTCGCCTAAATTATATTTGAGGACGAAAGG
CGGATTACATTGTTGGTGCCAGCTTCTCCTCCGGCGCACCAGTTCGACAGCCATCGCGAA
ACTCTGAACTGGTCATGGTTTCACGGCCATCATCATTCAGTGTAACGTGACACCAGAAAT
CCGCCGCAACGCGGGAGTGTTTGTGGCTTAATAATAAACCACGCGATACGGTGGCGCTCG
GCTATATCGATTAAGAAGATGACACCCTCACCAGAGTCCGCTTCATGCAAACATCGCACA
TCATGCAGCTGAGCATAATGAAACTTAATCCGCGCCAGAATTCACGGCCCGGCTTTGAAG
AAGTGCCCCATGTTTTCTCTCCAGCGCATCCAGTATCTCTTGCGCCCGGTATCGTGACAG
GTAATTACTAACATCGCCTTCCTCCTTAGCCGAAAATCAGTCTACCTGACCATTGTTGAT
AAGGGTGATAGCCAATCAAAACTCCTCTCCCAAATCAGAGAGGAAATAGCCTTAGCCTAC
GCAAACCACGTCACGTTGGATCGGCGACCAACGAATCAAATAAAACGCCACAATAAAAAG
ACCACCAGTACGCCAAGGTAGTGACCAGCGGAACATCATTGATACCGAGGAAGCCGTAGC
GGAAACCACTGATCATATAAACGATTGGGTTCAGGTGCGACAGCCCGCGCCAAACGGCGG
CAACAAAATCCAGTGGTAAAGACCCGCCAAATACGTGGTGGCGTTAACACAAGGTTGGCA
CCGGGCTGATGTCATCGAACGTTTGGCAAACACACCGTTCAACAAACCCGCAAGGGAACA
ACACCGCCGTGAGCACCAGCGTTAGGCAACGAATACCGAATGCACCTGAAATGGCACAAA
AAGTGAAATTGCCGTCACCAGAATGCCAACAAACAGACCACGCGCCACGCCACCGCCGAC
ATGTATCCGGCAATAATGACGTGAGTCAGGTCGGCGCTACCAGCAGCTCTTCAATATTAC
GCTGGAACTTGCTTTAAAAATGATGACGCAACGTTGGCGTATTAGGCATTGGTGATCACC
GACATCGCCGATCCTTGGTACGATGTGAACTGCATATAACTGAAGCCATGCATATCGCCA
ATACGCGAACCAATCAGGTTACCGAAGATAATAAAGTAAAGGGTCGCATGGTAGTATTTG
CTTGGCACCAACGTGCACAGATACGCATAAAGCGATGGATCTCTTTCGCCCAGATGCTTT
TGCTTTCACCAGTAAAAGATGCATCATGCGCGATCTCCTTGTTTCATTAACCAGTGAAAC
AAACAGCTCTTCAGACGGTTAGCTTTGTTACGCATACTTAATACCTGAATGCCCTGCTCA
CTTAACTGCGTAAATACGCTGTTGATCCTGCTCACGCAGCACTTCCGCTTCAGCGTCGCG
GTATCGACAAGTCGATACTGATAGCCATCGAGCTTCAGTAACAGGCTTTTCGGTGCAAAG
ATCGAGAATAAAGGTTCCGATTCAGCTTCGCCAGCAGCGCCTTCATCAGTATTTTCCACC
AGCTCACCGTGTTGAATAATGCCGATATTGCGGCACAACTTGTTCTGCTTCTTCAGTGGT
GTGTGGTGAGAATGATGGTGGTGCCTTTGTCGTTTAAATCCTTCAAAAGCCCACATTGAG
CGGCGAAGTTCAATATCCACGCCTGCGGTCAGTTCGTCGAGAATCAATGTAGTTTAAGTT
CGCGTACGCACGGGCAATCATTAAACAGCGCTGTCCGCCAGATAACATACGCGCACGTTC
GTTGCGTTTTCCCATAGATCGGTTGTTTAAGATACTTTCGCTTCGCTGGATACGCTTCTT
TGCACTCCCTTCATAATACCTACCTGGTCCTACAATTTGCTGCACGGTTTCAAACGGGTT
GAAGTTAAATTCCTGCGGCACAGTCCCAACGACGTTTAGCGTTCGACATCCTTCAAGATG
TGGCAAATACGCTGGCCGGAGGTTTATTTACCAGAGAGCTGATAATACCGATAGTGGTCG
ATTCCGGCCCCGTTCGGCCCGAAGCATAAAATCACCCTTCATTCACAAATCATCACGAAG
CGCCTGAACGCCACTGGATAGGTTTTTAAGCTATTGAAGTTCAATTACAATGGTCATAAA
TTTTACTTATACGTTCTTCGCTATCTGGTTTAAATCGTCAGGTTGCCTATATTAATATGG
TATTTGGTTACAGGTCGTTAACCTCCATGAAAACATAGATACACTCATCAGCAACAATGC
ACTATGGTCAAAAATGCTGGTGAAGATCAGGTTTTGAAAACTTCTTTCGCGCAAAAACCG
CACTTTCTATGGATTGGATGTTCCGACAGTCGCGTTCCTGCAGAACGTTTAACCAGTCTT
GAGCCGGGCGAACTCTTGTTCACCGTAATGTTGCTAACTGTGGTCATTCACTGACCTGAA
CTGCCTTTTCGTGGTTCAGTATGCAGTGGATGTACTCGAGATTGAACACATTATTATCTG
TGGCCTACAGTTGCAGCGGCGTACAAGCCTGTTAAACCAGAACTAGGGCTTATCAACAAC
TAACACTGCATAATATCCGCGATATCTGGTTCAAACATAGCTCATTGCTCGGCGAAATGC
CGCAAGAGCATACCGTCTGGATACCTGTGGGCGAACGTCATGGAACAGGTGTATAACACA
GGCCCTCCACCGATATGCAATCAGCGTGGAAACGCGGGCGAAAATTACCATTCACGTAGA
CTACGGCATTCTTGGCTTGCTGCGTGATCTGGATGTTACCGCCGCCGCGAAAACCCGCAA
ACACCGCAGTACCGTCACGGATTTCCTCAGCTGAAACACGCCAACCACAAATAAAATATG
CCGCTACCAGATGCCGCCCATCACCTTAACTTCATACTCGTCAACGAATCCACTTTGCCG
ATATACGGCAGATGACGTGCCTGGCCGTAATGTGCCGTAACCCACAAACTCTCCAGGAAT
CGAGAAAACTGATAAATTCTGGACGTTCACTTCACGGCAGGACGGTTATCCAGCGGCGTA
CAATCTGCCAGCGACTTCAGTTCGCGCGGAAACTTAGATCACCTTTTTCGACAGTGTATT
CCCAAGTCGATAATATCTTCAACAATCTTACGTCCTTACTACAGACTCATCAGATTTGAG
ATTTCACATCACGGGTGGTGGACGCCGCTACCATGAGGCAGTCATAAAATCGACTTCATG
AGATACCTGAACTTCACTTTGAGTCCTGTACTCATCGACCACCATGAACCCACCAGCACC
ATATCGCTGCCGCTGTCTTTGTAACGCTCAATATCTGACTTGACAGTTCAGCGATACGCG
CTTTAATCTCCTTCGGGGATCATTACTTCTACAGTATGTTTCATATCTCTAACCATATGA
TTTAAAACAAATCACTTCACCTGAGCAGGTTGGCACCGCAACAAAAGCGCAAAACACGCA
ATATACCAGTAAAACTATTCATTCGCAGAATCTAATAAGCTCGGGTAGTGACGATCACAT
ATGTTAAAACCTATAATTAGTACTACTAAAATATTAATGAATTGAAATGTCTCTTATGGC
AATTAATAACAATACAGGCTTCGCAGCGATTACTCGTCACGCTAACAACCCTTGCAGCGC
TTTGCAGGCTGTATCTACTCATTAGCGGAGAGCTGGCTGTCGCGATTGGCATCTGGTACT
ACCTATCGCTGGCCTTGTGATGCTGGCATCCGCACAGATGCTGTACTTTTAATGCAACAC
GCCGCGCTTTGGCTGCTCTACCCTGCTATCTTTTCCTGTTGGGGCGTCTGGGAAGTTGGT
TTCGACTTCTGACTGGCCGCCGGCGACATTCTAGTCTTCTTCGGCATCTGGCTGATCTGC
CGTTGTCTGGCGTCACTGGTCATTCCTGCCAGCGGCGATTTGCCGCACTGGTGGTCGCAC
TGCGGTCGCGAGGTAAGTATCCACGGCACGGGCGGTTAACGATCCGCAGGAAGTCCAGCG
GCACCTTAAACGCCGATGCCACACCTGCTGAAACTATCTCCCCATGTAATCAGGACTGGC
CTACCTATAGTCGTAAATCAGGAAGGTCAACGCTTTCCGCTAAGCTCAATGCCGCCAATA
CGTCCACCATCGAAAAAGCACGGGTGTTCCGTACTGGCAATGCTTTAAACAGCGAACGTC
CGGGTGAAAATCACACCAATGGTGACGCCAATTAAGTGACGACACCCTTTACTAATGTAC
CGCTCACAGCGCCTGTTTGCGCTTGATGCCGCCAGCAAAAATAGCACATTGATCCTGAGC
TGAAAACCAGCAGCAAGTCTTTCCAGCACGCCATGCCTACCGTATGTCTATCATAAATAG
CAAAGCCGCCGCCAGTAGTAGCGGGTGCCCATCGTATCATTCTTCCGGTCAATGGTCGAC
TGATTGCGATTAACGCTGGCAACAACTGTAGAAACCTTCGCCAATGCAAGGCGTGCTCAA
TCTAAAGCAACTTTAGACCTGAAAGCCAGGTCTGTATGAGCTTCGCCGATTATCTGTCGC
TCCATCCTTGATGGCCGGTTCAGTGCAAATACTTCTCAACCGCGAAACGTCTGGCGTGAT
CCGTAGTTTGATATGTCAACACCGGGAGCTGCTGTGGGCTTTGATCGGCGAAAAATCCGG
CCTGTCCGTCTGACAAAACACGCACGCTACTCGCGCGCCAAACTCGGGCACCAGCGGCCT
GACGACTGGATCTGGTCTATCTGCCGATGGGCGTGACCGCCGGATATCTGGGGCGTAACG
CACACAGAACAGGAACGTTATGCCAGCTCGATTCCTAGCACTAGATACCACTACCGAAGT
GGCGTGGAGCCACCAGACCATTCACCGACCTGTGGGACATGGATCTTCGGCACAGCCGGC
GCTGGCGAACATCACCGTTAATGGTCGAAAGTGCCAGTTATTTACGCTCGGCGAAAACCG
GCAACTATTTGCTCGATCGTCATGTGGCAGGCTGGTGGTTCCGGCACCGGCTCGGTTCCA
AGGTGCAGCGAAAGGCGATTACGCCCAACTCAACCGTTTCTGAACTGAGCTTCCGTCCGA
CGAAGATTTGAGCGGTGCGGTTAATAATGAGAGCCACCATGTTGACCAACTGGTGCCGCG
TGATGTTCCGCAGATGCGCTTCATATGAAGGCATTTTCACCGCCATCTCTGAACGGGGTA
CGCTGGTCTTCCGGGTAACTTTTGGGGATGTTCAGATAGGGCGGGATTTCCGTTGATCAA
ATCGTGAAGTGGCGATTGCCAGCAATAGCACTGCCGTTTACGTTTCGAAACTGATCCCGC
GTGGTCGGCGGCCGAGTAGACAGCCGAAAGATACCAAAGGCACGGGTACAGAATCCGGCA
TTCAGCCACAGTACGGTGTACCGTATGAACAATTGTCACGCTCAACCCGTTCCTCACCAT
TTGTGGTCTGCCATGTAAGCAGCCAGCATGGGGTTATATCTCGGCGCTGGATCTGAAAAC
TAATGAAGTGTGGTGTGGAAGAAACGTATTAGTACGCCGCAGGACAGTATCTACGTTGAT
GCAGTTCCAGTACCGTTCAAGCATATGGGTAACCGATGCTGGGCGGGCCAATCTCCACAG
CGGGTAACGTGCTGTTATCGCCGCTACGGCAGATAACTACCTGCGCGCTTACTTGTGAGC
AACGGTGAAAAACGCAGCAGGAATTCGTTTACCAGCGGTGGTCAAACTACATAATGACCC
TATAAAGTGAATAAGGCAAACCAGTATGCTGGTGATCTCCGCAGGCGGTCACGGTTCATT
TAGTACGAAGATGGGCGACTATGTGGCTTATGCTGCCGGATGATGATAAGACTTGCTCGT
TGCTGACAACGTGCGCGTTGTTGTTCATGCCGGATGCCGCGTGAACACTTATCCAGCCTA
CAAAATTATTACCGCATCAATGGGTGCACACCTTCTACGTAAACCTAATGTATGCTTATC
AAACAATTACATTGTCATCAGATTTAATGCAGAAGATCCGGGCATATTTCAAATACGGTC
TTTTATACCGTAAGCTATTATCATCCCCGTATCTTCACTTCTCCAGCAGATGGCGGTGCG
CCACTCTCAAAGCATAATTTTCAGTGCATCGTGATTAAACTTCACCAGCACTTCGCTGAT
GACACCTTCTACCTTGGGTATCTTTCCAGCCCGCGCGATGAGCCGCTGGCAGTTTCATTC
TGACAAGATACTGGAACTGCGTGCCGTGGATATGGAACGGATGCAGCATCATGTCGCCCG
CCAGAATATTAACGTTCGTATTGCCCTTTCGCCGCCGCAAACATCGGCTTGTTCATATCA
AACGCCCTGACCGTTGATTTGTTGTTGGCATGGTAAATCGAACTTCCACCGTAGTTCCAT
ATGATTCATGCCGTACCTGCTGGCCCATCATCTACTTTCTAGCAATCCATCCCGGCCATC
CTTCTGATCATATTTCTCCATTAGCATCTGCATCCCATCTGGCACTCAAACATCGGGTCC
GCATAGAGTTGCAGCTTGCGTACCGTCAGCCCTTCAGCGAAGGTAACGCAGGCGAGCTGC
CAATGTGTCTGTAAACACCGGAGGCACTAGCATAGCAATCGGCTGAATCCGCATTACCGG
ATGAGGAAACGTAAACAGCGCAATCGCCATCCCCATCTGGCTGACCGGCAGCGTCACGGC
GGGTCGAGGTTGTTATCGTTAACCTCACCAGCACTTCAAAACGCTCGCCCATCGCGCAGC
AGTTCGCTCGCAGCCACTGGTTCAAGTAGCAGACCACCGTCGCTGTGTCCCCGCCAGCAG
GCGATTGTCGCTAGTGGCGAGAATTGAGCGAACAGGCATTACAGCCATTAGCAAACGCAG
GCACCAGCCAACCCGCAGGGCAGCGTGTTGCAGGTAGTGCACCGTTGGTCAGCAACGTAT
CCTTAAACCAGCCCGGCGGCCCGGTCATCATCCAGTTGATAATCAATCTACCCGTCGGCA
CTAAATTCTCCTGAACGTCACCCGGAACATCGATACCCCACTGTTTAGCATTAATTTCAG
GATCTCGTCATCTTCAATCACCACCAGCGTAGCCCATCGCCGCACCTGTCGCCCGGTTTT
GCGCACCGTACTGATGCAGATGGAACCAGCAGGTAGCAGCAGGTTGATCAACATTCAACT
TGTCACCGGCACTTGCCACGGCGGAATAATTCCTACGGGCCGCCGTCGACTTCACCAGTA
CTTTTCGCCCGGCCAGGTACAACGTTGTCTCTTCCGTCAGTGGTTGTAGTATCGCCGTTA
CCGCTTTGCCGCGCTGTAATTCACCATGGCCCAGCAGGTGCCGTTATAGCCCAGTGGTTG
CAATTTCCGCCAAAGGTGGACTGGCCTGCGCCAATAGTTAACTAAGAATGCAATTACAGG
CATCAGTGGCCAAAACAAATCAAGGATCAACGTTGGGCGTTCTGCCATAAATACTGCGCG
GCTCCCAGCAGCGCAAAAGCCAAAGCCCACCTGGCATGCAACGGAATATTTTAAATCACG
ACGTTGCATAGTTATTTCATATTCTTAAGCGAGCAGAAACAAAATCAAACGTTGAGCATA
GTCCTTCACCACGGAAGATAAGCGAACACAATTTAATCGACAATAATGGTCGTCGCCTCG
CTCGCAGTGTGCTAACGTTTATCTTCTTTAAGCCACAGTACAGAAGCAATAGGACGTTTT
CAGAACAGTGTGTTATTCTACAACACTTCTGATAGCCGTCTGCGCAAACAGTTACGCGCT
CAGCGAGTCGAAGCGAAGATATGGCCGATTTAACATTTTGTCTTTCTGAAGAACGATTGT
GGTTACCAGAACTTACTAACGGGCAAATTCGTCGCACTGGTCTTTTCGCTCATAAAGCAG
TGGGACCTCAATAATTACGACACCTTCGACGCCCAGAAGCCCTCGGTGAGACAGCTACCG
CGATCTCAGCGCTTGGCGTGGCATTCGTCGCTAAAAATGCAAACCACGGCCCGCGATTCG
CCTTAAGCCTGCTTGCCTACGTCAAATAATCCCTGATACCTTTTGTAGAAATATTGACCG
TGCATCCGCGGTCGACCCAACTAATATGTTGCACCCTTTTTGCAGGGTGTTAACAAGGAA
GTATCAACCATGGCCGAAAAACAGTGGCATGAAACGCTACACGACCAGTTTGGGCAGTAC
TTTGCGGTAGATAACATTCCTGTATCTTAAGACCGTCACCGAGATCTGATCATTTTGAGA
ACGCTGCATTTGGTCTTGTAATGGCGCTGGATGGCGTAGTACAAACCACCGAGCACGACG
GGATTTATCTATCGCCGGAATAGTAGCCCATATTTCACTACTATGCTTGGTCACGCGAAA
CATGTGCTGATTATCGGCGGCGGCGACGGTGCCATGCTGCGTCAAATAACCCGACGCACA
AAACGTTGAGTCAATCGATGGTAAATCGATGCGGTGTCATCGTTCTGCCGTCGTATCTAC
CAACCATAACGCCGGTAGCAGCTACGGCAATCCGCACTACTTCAAAGTAATCCGGCAATC
GCGTCAATTTCGTTAATCAAACCAGCCAGACCTTTGATGTCATTATCTCCGACTGCACCG
TCCTATCGGTCCCGGCAACCTTTTCACTTCGCATTTATGAAGGCTGCAACGTTGCCTGAA
TCACGGCGGTATCTTCGTCGCACACAAACGGCGTCTGCTTTTACAGCAAGGAAAAGCCAT
CAACAACCATCTCGCTCAACCATTACTTCAGCGACGTTGGCTTTTATCAGGCGGCGATCC
GACTATTACGGCGGTATCATGACTTTTGCATAGACGAATATGTGACGCCTTACGCCATCT
CTCAACCGAAGTATTCAGGCGCGTTTTCTCGCCTCTGGCCTGAAAGCCGTTATTATTACA
ATCCGGCAATCCATACGGCCTTTGCCTTACCTCTAGTATCCACCAAGACGCACTGGCTTC
ACAGCCGTCTAAGGAAGATAAGAAATTGAAAAACTGGCGACTTCACCGCTTTATGTATAG
CGTCAATGCAAGTCTGGGTTTTATTTACAATCTCTACTACGCAAAACTACCGGCGAAGCG
CGACAGTTATGTTAACTATCGATGAACTCTCTAATGCCAACCGTCTGACCGAAATCCTGT
CAGAAACCTGTTCCATTATCAGAATATGTCTTCTACTACCTCGCCCGCCCGTTACAGACC
ACGGTGTAGCGTCACTATTCTGGTAGTGAAGAACCGGTTGACCGAAACTCATCGACAAAA
CAAACACCCAACCCACTGCCTGCCAGAAACGGTCGTTACGCATCTTGATAAAAGTCCTGC
TTGCGTACGCCTACCGGAAAGTCATCCCTGAAGGCGGTTTATGTGTGCAGCTTCGCCAAT
ATTAAGTCTCTATAAGCGTGATTTCTCCGCTGAGCGCTGGGTAAATCCGCAACTTGGTCA
AATGTCATGCCAGTAACAATTATCGCGTGCGCAAAGTTTCCTGACATTAACGGTATAAAC
ACTTTATCGACCATGAGATTAATTCGATTCAGAACTTTATGTCTGACGATGATATATGAA
GGCGCTGTATGACATGGTGGATGTGAACGTCTATCGGAAAATATCTTCCATACCAAGATG
TTGTAAAATTTCGACCTTAAGCACTACATGTTCCACACCAAACCGAGCTTAACCGACAGC
GAGCATGATACCGCTGCTGTGGAAAATGCGCGAATTTATTACGGGCGCAATATACTGTGT
TGCGGCTCTGGCGGAGCTCCCAGGCTCCATAATTTATTCACTCTATGCGAAATTGCGGTA
AGCCGCCACGACCTGCAGAAAATCACTCAACGCCGCATAGCGACAGCTTTCTTCGTCGTA
TTGGTCATCCCTCTTCCATTTCATCGCCAGCGAATTCAGTTGATTGGCGCGAACCTCACC
TCTTCACCGTCCATCCACAGGGTGTATTCATGCCCTGCCGGTACGAGACCGAATTCGCTA
CCTTTCAGTGCGTGCGCTGCTTGTTCCACTTCATCAAGCAAGGCCGGGTTTTCACCCTCT
TCCATTCGACAGTACCCGACCACTTCATGCCCCATGGACCTGCACCTTTACCACTCGGTA
ATATCGCGCAGAAATTCGTAATCCATAGTGTGTTCCTCTGCTCCCGGCAATGCACCGAAA
ATCACCTTTGCGCCATTAATCTTCCATCTCTTGTATGAAAAACAGCAGAACGGCGATGGT
TTAGAAATAAAAATGCCGAAAATCTCATTCACAGGCGACGTATCGTTATGCGCAGCGCGT
GCGCTGACTTGCAACCGCGGTCTGATAATCACCCCATCGGCTTTCTCGGTGTACTGAAAG
CTGTGGTTGAAAGTCAGATAACGGTAAGTATCAACGGCTGTTTATCACCGCCACGTAGAG
TCTGGTACTCTTCAGCGTCGGCAGTTTGCCAATCAGCGCCGCAACAGCCGCCAGTTCCGC
AAGCGACATTCGCGCCAGTGCAGACGGTTCGGGAAGTTACACGGGTAGAGGTGGAAACCA
CCGTTGCACCGTCCGCCGCACGCGCTTTACTGGTTACTTTTACCTGCAGGAACAACCCGA
GATCTCGATACACGCACACCCTCTACCAAGAAGACAACTGCCGTACTTCTGGTCGCTGTC
TGGCAATCCACGCAGGTTAGCGAGGTACCACCACAGGCAGGTCAACAGCAGCCTTTATGC
GCATCAGCAGTTTACCTGCTTGGAAGTGATGACCAGTGTTAGTCATGCAAGAACCATCGC
GGCTTACTTCGTCGATCTTCTCACCCTATACCGCAGACAGCGGACGCGCATCATCGGGTC
GTTCGGAGCACACAGGATTGGCTCTTTATTATCCGCCAGATCGATGTCGATCACTGCCAT
ATTCGCATCATCTGGCCAGCAGCAGCTCCAGGATTCGCCAGCCATTTCCCTTGCCTGAAT
ACGACATTCCGGTACGACGATCGCCGTAACCTTCCGCGATCATCCACTTGGGGCCGTGTT
AGAGTTCAGGTGGTATTCGATGATCGGTTCTTTGTTCAGCAATGCGGTACAACCAGCGGC
AGAACGCTCGGCGGACGCATCGGTTAGCTCAAGGCCTGCTCAACTTTCCAGATCCGGCAG
ACCTAATTTCGGTCAGCCAGAAGATGTTTCTTACTGCCTACTTCTCAACAGTGTAAGACC
TTGACGTCACCTACAGCGAATAGCGTGGCCAGATCGCGCGGGGTGATGCCCAGCTGCATT
TTACCTTTGAGCGCACAGAACGGATTCGGCATATCCAAGCGGCATTACGCCAGTTGCGGC
AGCAAACGCCACCAGACCAGAACCCGCCGGGAAAGAGATACCGTCAGGAAACGGGTATGG
GAGTCACCCTGGTACCGACGGTATCCGGCGGCAGCAACGCCACAGTTCTTGAGTACCGGA
GCAAGCGCCGTCACCCGGACGCAACGTACACCGCCACGGTTGTGAAGTCCGGCAGCGTGG
TGCGTGTTCGTCAACTGGCTTCGGATACCTGCGCCGCGGTGTGGCAGAAGACTGCATCAC
CGGAGTCGGCGAAGCCCGGGCACGCCGGTCTTTCGGTTCTCCGCAGGTCCTGTCGGGCCG
GTGTCTGGGAACCTACAGAAGTCATTTCGGTTCACAGTACGCGCCCAGACCGTCACTTCA
CGCCACAGGCACGGCCTACCATTTTGCGCCAGCGAAGCCGCGATCGCTCTCGGCGACATC
TTCGGCAGGGCAACACATCACTATGCGGCAGACCAAAGTACTTCCACGCTGGTGGTCAAG
AGCCCGCCCGGTAATCAGCAGGTCGGCCACCGCACGCACTTCATCAATCAGCACGTCGGT
TTCAGTTTCGAAAGAGTCGCCAGCAGTTCGCCGGTTTCGTGGTTGCACTTCACCGCTGTA
CGATAAGGCTTGTCCATCCATCGCCCATATTTCGGGTTAGAGACGTCTCGACTTCGGTCG
CTGAGTACACGTGCTACATCGTGTTAAAGATAGATTACCGTTTACCGCCGAGCTAAACCA
CCGCCGCGGTGTTCGGCATGTGGGCATCGCTCGCCCGCAAACCACAGGAGCAGGTTGTGG
CAGTTGCGAAGAACCCGTACCCACAACATTTCGACGTACGCCAGCGGAAACCTTTCTGTT
GCAAACTTCGATTTGCTTGATCGGACCAACAACACCGAGCTGGTCTGGCTCTTAATACCT
TCCACGGGCGTTTTCAGCATCGCCAGCGCGTGCAGTGGGATATCCGGGCGTGACCACTGT
CCGGTGCCGGAAAGGTCATCAGTGTTAGTTCATGGTGACTTTGTGAAAGACGGTAACTGG
TCATTTTCGGCCAGCGCCGGGCGATTCAAGGAACCATTCGGCATCACCCGAGTTGCCTGC
CTGCTTCGCATATTCGTTGCCTGCTTTCCTTTCTCTTCTACGTCATAGAAGTTATCGAAC
ATCAGCGGCAATGCCAAAAGATGCTACTTGTAATAAGTGCCAATTTGGCATCATCCAGCG
CGTCGATCAGCAGATGAATATTTAACTTCCATGGTGCCCAACAGTTGATAGCTTCCGGAG
TCAACAGAGGATTTACTTCGCCTTTCGCGTAACGAAGCTTCTTTAGCCACAGGCGGCTTC
ATCGACACCTGGGAGAACGGTTGGTGTAGATCTAACAGAATTCTTCTTCGCCCGCAGGCA
GTTTTCAGCAACTCTACAGTACGGCCATTTGGTTTACATCCGAGTTTGGGCTAATCCCTC
AACAGCACATCAGCTACGTGCTTACGGTATTCTTCTGCTTTACGACGGTTCTCCTCGCTC
TCATTGTCATAGTGCGGCGGGCGGCGTTCTCTTCACGCTCCTGTGAGACAGCAGTTTGTA
GGGTAAATGCAGTACCACCGCGGGCAGAATAACGGGATTTTGACGAGGTGTTAATCTGTT
TACAAAAAGCAACATAAAAAGTAGCTGGAATCATTAAGGATGGTCTAGAATTGTTTCCTC
CGTAAAGCTTCGTTCGCATGGTGATGTAATCACCTTTCTCAACGAATCAAGATTGATCAA
ATTTAAACTACCGCTCTTTATGCTCAGTTCACAGCACCTGCGGCGGCAGTTCGCCGACCA
TTGCGTTCCTTGGTTAATTATGAAAATGACTTTGCCGTTTAAGCCCCATGTGCTGGCGCT
AATTTGCAGTGCCGGGCTTTGTGCCGCTACTCTACCGGGCTATATGCCGCCACGTGACGA
CGCCTGTGGAACCGCAATCGACACAACTGGCTGTCTGACGCGCTGCCGCGGTTGCGTTTC
CTGCAACGGTTTGAAAAATACGCGTGGCACTTGCAAGTCCATTAAGTCGCGTTTCGGCTG
CGATAGATCGGTGGTGCGCCCGTCGCCTTCTTATCCCGACGCCACTTTCGCAGGTGCAGT
AGCATCGCCTATCCGACAAACGTTGCTCCAAGCGATTGCAATGGTCGCACGATAATCACT
TAAACAAGGCGATGCTGCTATTCAGGCGGTATCTGACCAGCAAGTGGGACGCCAGCGTTA
AATCACTGGTGGCCTTTCCACAATTGATGGCATTGATGGGCGAAAACCCGCAATGGGTGC
AAAACTGAGCGATACTTTTCCCATGGCCCAACCTGGGACGTGATGGACTCGGTGTACAGC
GATTGCGGCAACTGGCGCAACAAACCGGCTCGCTGAAGTCATCAACCAGTGAAAGTTATT
ACCACAAGCTGTACCGGTAAAACAGACAGTCACGGCACCGTCATACCATCGTACAGTTTA
ACTGCAACCCCGTCATTACAGAGCCGGCAACCGCCATCCATTTCCGTAGGCCCGCCATCC
ACAGTGTGGTCTGTATTCCCAACTACCGCCGCCGTGGTTTACAGGAACTATGGGCCAATA
CTGCGGCGTATCCGCCGGTTTATCTACCACCACCAGCCGGAGAACCGTTTGTTGACAGCT
TGTACGCGGATTCACTTCTACTTGCCATTTGTTACTACCACATTACGCACCTAGTAGCCG
CATCGCTAGGACGACGACGATCATGACCATCATCATGACAATGATGGTATCATCCTACGA
TAGCGGTCATCGTGACGGTAATGGCTGGCTTCGCGCGACAACATCAATATCGGCGTCAAC
AATTCAACCGTATCACCGGTGAGCTCTTGCAGTAAGAATATGGCATGGCGGCACAATCAA
ACTACTATGTGGACGGCCTTTCTCTGAATCAGGATATAGCCAGCAGGTTTATCAAACCCG
TCTCCGCGCGGCGGAATAAACGCCGCAGTACCTGCCCCGCGCGACGGCGTCCAGGCGGCA
GCAAATCGGTTCAGCAACGAACACACGCCGCACCCGGTCATTACACGGCACCCAACGTCA
GGCGGCAGCTTTGACGGTTTGTCGACTGAACACTGTGGGAGCTATGACGACTTCCACGAC
TTCAGCCATGTAACTTCACTGGCCCCAGCAACAAAAGGACGCCGCTCGTCGGCGGCGTTA
TCGATCCGCCTCGCCTGAGCAGCGCGAGGCAGTTCGCGAAAGTGCAGACTAACGAGATCA
GCAGCGAAGAGGCGGCGCGTGAGCGCATTCAGTCCGCCTCGCCTGAGCAGCGCCGGTGGT
TCCGCGCGAAATGCAGACTAACCGCAGAACCAGCGGCGAAGACGCGGCGCGTGGGCGTAT
TCAGTCCGCATCACCAGGCAGCGCCGGTGTTTAGGAAAAGTACAGCAGCGCCCACTGAAT
CAGCAGCAACGTGATAACGCCCGCCAGCGTGTTCAATCAGCATCACCTGAACCGCGTCGG
GCGGGTTTTCGGGAGAAAGTTCAGGAGGCCGCCCACAACTTCGACGACATTAACCATGCT
GTCAGGCTGAATAACGAGCAACGGTCGAGTATGCGGGCAATCCTCTCTGAACGACAAGGC
GTGGAAAAGGTAAGTACAGACGTAATAAAAAGCGGCGTGGTTGCCGCTTTTAATGCCAGA
TGTTCAGCCGACGAAAAAGTACTTCTTCTTCGCTTTCGGGTTCGGCAGGTCGGTAATGCT
ACCTTCGAACACTTCTGCCGCGGGCCCACGAACTCGTGCGGTCGGTGCGTGGATGGTCGG
TGCGATATTCGGCATCGCAGCCCATTTCGATTGCGGCCGATTTCGCAGCAGCTCGCCGCC
GTTGGTACCGACAATCGCACCACCGTCCACGGAGGTGAAATTCATACATCGAAAAATCGC
CCAGGTCGCCTGTTCTGCGCAGTCGGAAGCGTGGCGACCGAAGCAGCCCACGGGAAGGTG
GCGGTTTCTGGCTGATGCCTTTCTCTTTCGCTTCTTTCTCGGTCAGACCCACCGTACAAC
GCTACGGTTCGGGCGATGGACGGGATAACTTTCGGATCGAAGTATGGTGTTTCTTACCGG
CGATACTTTAGCGCTTCGCGGCCTTCTCGTGAACACCTTTGTGACGCCAGCATCGGTTGA
CCGGCAATATCGCCAATACTTAAAAATATTGTGCAGTACGTTAGTACGCAACTGTTTATC
AACGCAGATGAAACCACGGTCGTCAACTTCCGCAAAGCACGCACACCGTCGAGGTTTACC
GTTCGGCACGACCAATCGCTTCTGTACGGCGTCGTAACGCTGCGGTTCAGCGGGTGCTTT
TGCCTTCCATCGTCACATAAATGCCGTCTTCTTTCGCTTCGCGGCGGCGGTAACTTTGGT
TTCCAGCATCAGGTTAATTTCTTGCTGATACGCTTGGTGAGGCTTTTAACGATGTCTTTG
TCAGCTGCCAGGATACTTTGGTCGAACAACTTCGCCCGTCGATCTGAACCCAGCGCGTAG
TAAACGGTGCCCATTTCAGACCGTGTTTCGCCACCCATTGGCAGGCGTTCCTGGTACTTC
TTTCAGTTCAGCGCGTCGGTGGGTCCCCAGATACGCGGATCTTCATGGAATAAACGCTGA
CGTTGGATCGGGCGAGAACCCGCTGCAGCAATCGCGTTGTCCAAGTTAGATCACGGTTTT
GGTTCTCACCTTCAACTTCGGTCGGTGGCGGTAGATTGCAGACCGTTGACCACGCTGACT
TTGCGGCCTTTCGCCATACCAGCCAGACCACCGGTCGCTGATTGATAACTCTCTTTCCAG
GTACGTCTTGTCGATATCGGTTTTCGGTTCGCCGAAGGCGATACCATCTGCTCCAACACT
GGCTTCTTGATAACTTTGCTACGTGCAGCAGTGCTAGAGGGATACAGCCGACGTTCAGGC
AAACACCGCCAAGGGTGTTGTAACGTTCTACGATTACGGTTTCAGACCTAAATCAACTGT
GAAGCAGCGAATATATCAGGGCCTGCCCAATACCACGACCTGAGTTTGATTTCAGTACTC
ATCGCGGCTCTATATATTTATCTCCGGCGAGTGCTGCATCGTCTCAAGCCACAACGGCGT
TAACTTCACGCCCTCACCCAGTCACTTACTTATGCTCACGAGGTCTGGCGCTGCTACTGC
TGCACCCGAAATCCATAGGGTATGTGAGTAATACCTAACCACCACCAGGTCGTTCTATCG
TCGGTATTTTACCAGGTATTCTGAGCACCAAACAACAAACGGCAACCGGTATCTATTCGC
TAATAACCTCCAGCCATTCAACGAAATTGTTACCCAAAAAGCCAGCCGTTGGGCCGCTCT
TTACCATCGCAGACGGCGAATGTCGGACAGCGTGTTGTTGTTAATGATGATGAAACGGGC
ACCACCATCAGCACCGTCGATCGCGGTGGTCGAGAGAAATCGGCAGCATCAGACGCGGCG
AACTCTTCAGCTCCACCGGCTCCATCGCGGACTTGCAAACGCCGAGATAGCGCTACACTT
CCGGCGCGTTCACAATCAGCGCAGAAGTGGGTAAATACCAGGCCACCATTCTGCTGGAAG
TCGTTAAACAACCGCCACTGCATTTCGCCCGCAGTCAACTTACACCATCACCGCACTTTT
CAAATAGTCATCAGCTCGCGGGACAAGCTCGATGATGCCTTTCTTGTTGATCTTTGAATA
CCGGAACAACCTTAGACCGTTCGGGTATCACCGCCACCGATGTTGATGTATTTCTTCAGG
GTCGGTGTGACCGTCTTCGACAACGAACTATTGAAGGCATCTGCTCCATTTATGTAGCTT
TCATAGTAGAAAATAACCAAGGTATCCTTCACATCCAGCTTACGTTTCGCCGCTTCTTCA
TTCTATTTGGAACGCTTCCGCTCGGTAATATCGGTTTGTCAGAGTGAGTAACATGCGGAT
CGTACCAGTTACGGCTCAGGTTCGCACCAGAGATTTTCTGGATGCGGCAGTTCCTTCTTC
GATTCCTACCAAACTTGCTGAAGTCCACCTTCGGCCACGGCAGCATGCCGAGGATACCGC
CAGTCGCTGCTGCCGGGCTGCTTCTGCACGTTTGATAGCTTCTTTCACGTAAGCCTGAAC
GTGCCGGCGCGGGATACGACCTTCGGCCAGTGCCCTTCACTTTAAAGGTTAACACCAAAC
TCGCGTGCCAGACGGCGGATCAGCGAGTCGCGTGTGAACATAAGCGTCGTTTCAACAAAT
TCAGATTTACGCCTTCCGCTTTCGCAGCTGGTGCTGCTGCCGGGCTTCGCTTTTGCTACC
AGTACTTGGCGCTGCCGCTCTGTTCGCGGGAGCTACCGCAGGCACTGCATGTCAACTTCG
AATCATAATCAGCGAGCAGTTTTCACTTTATCGCCAACGTTGACTTTCAGTTCCTTCACG
ACTACCACAAACGACGCCGGAACTCCATAAACTTTGTCGCCTTCTACGGTGATCGGTGAC
TGTTCGCGGCAGCTTTGTCGCCCACTTTCACCATCACTTCAGTCACTTCAGCCGTCACCG
CCGATATCCGGAACGTTAACTTCTTTCACGCCAGCAGCCTTACGCTGGTAGAAGAGCCGC
TGCCAGGCTGCTTCCTGTTTGTGACGGGCCGCCGCGCCTGCTTCACCCGCGGCTTCGAAG
ACCATATCGAGCCGGTAGACACTTTGTCACCCACGTTCACTTTGATCTCTCTCTTTCACG
GTGCCATTGTAAACTTGGAGCCGGAACTTCCGCCAAAGCCTTGTCTTCGCATTGATCAGC
GACTGTTCCTTCAACTTTATCGCCAACTTTCACGAGTTTGGTCCTTCAACTTCGTGCTGC
CGATATCCGGAACGTTAACGTCTTTTGCCGCCATGGCCGCTTGGTGCTGCTGCCGGGCTG
CTTTCTTCACCTCTGCCTGAGCAGGTGCGGCGTCTGCTGCACCGTCGTGAAATCGAAAAT
CATAATCAGTGCGCCGGTCTGGGTTTATCGCCAACAGAGACTTTGATCTCTTCTTGATAC
CCGCCTGCGGGAGCAGAACTTCCATATGAGGCTTTGTCGCCTTCTACGGTGATCCTTGAC
TGTTCGGCTTCTTTGTCGCCCACTTTACGACTACCGGATCTCGGTAATTTCACTTGTCTT
CGATGTCCGGTACTTTGATTTCGATAGTATTCTTTACCTCTTACGCCAGACGCGGGTTGC
TTTATCTGCATCGATGTTGGTGGCGGTGCGTCAGCAACCACTTTCTTATCGATTTCGCCG
TTTAGCCAGTTCGCCCGGCGCCATAACCGAGCAAGGCATCAACTTCGAGTGGTGGCCTTG
CAAGTTCTCCACGGCTGTCAGAACGACCAAACCATCAATGCCAATACGCAGTAGTCGTCA
GCAGTACGTAAAGTACAGACCTCTCCAGCGACAATTTCTCCATGTCAGCAGATGCCGCAC
CTGCCGGAGCGTCGTTCATCACCTGAGCGATGAACGCGCGAGTTTCCAGCAGGTGCAGCA
TGTTCCAGCGTTCTGGTCCTGACCATCACGCGCCAGCTCGGTGAAGAGGGTCACGCTATG
ACGTCAGAACCTACGCCATGTTAATCTTTCTTGCGGGATCTCAGCTGCTTCACGGACGTG
ACGCGGGATAGAACCGGAGCCGAGCAGCTGAACTTTACCTTTGCTACCTTCTAGTTTCGA
GTTTGGCAGATATTTAGGATACCTTCCTCAGCACCTTCCGGCATTGCCGGCATGTAGTAG
TTTTCGTTCAGCGTAGTGATGTAGTAGTAAACGTTCTCTTGTTTCACCATACATACGCTC
CAGACCGTCGCCATGATGACAGCAGCGTAGCGCTCGCCGAGTGTGAAATCTACCCCGTTC
GGATAGTCGGCGACAGATGTGGCTGTGACCATCTTCGTGCTGCAGACCTTCGCCGTTCAT
GGTACGACCGATACCGCGCCAATCGAAAACCGCTGCGCTTGCTGGTCGCGCCAGCCATGC
TGATCTGATACGCTGGAAGCCGAACATCAGTAATAGATGTAGAACAGGATCATCGTGTGG
GTGTTTGGTGCTGTAAGGGTCGCGCCGCTGCCAGCGGGGAACAACCTGCGCCCAGCTCGT
TGATCCTTCCTGCAAGAATCTGACCTTTCTCGTCTTCTTCTGCGTACTTAACCTGCTCGC
GGTCCTGCGGGGTGTGCTGACCGTTCGGGCTGTAAATACCAATCTGACGGAACAGACCTT
CCATACCGAAAGTACACGCCGTCGGCGATGATCGTGCCGAACGATCTTTGATCGACTTGT
TCTTCAACATCACGTTCAAGCGGGCAAGCATGATAGTGGTAGAGATCTCTTTGCTCTGCT
CTTCCAACAACGCACCGAATCTTGCAAGGCATCCAGCAGCTCAAAGCTTCTCGGTGAAGT
TCGGCTGACGGCAGCAGCAAAGTGTGTGCAGTTTCTGACACTAGGCGTGCGAATGGTATG
CTCTTCAGAACCTTCCGGGAAGGTGATGTACGGCAGTTTCGATATCTGCATCAGACACCG
GCACACATTGAAACGGTCGCGGATGAAGCGCACCGTCCGCATTCATTTCTTAACACAGTG
CGCGATGTTTACTTCAGCCAAAATCTTCCATGCCATAACAGCCCCAATGGTATGAGCAAG
TTACTGTCACTTTGCCTTTGTGGTTTCCTGCGCTTTCTGATGCAGCGTAATTTCTTCGGA
TCGTGACCACCACGGTTCCGGTACCCGAATCTGCTCGTCAGTCCAGTCTGCAACCAGTGC
TGCGGTTTCCGGATATTACCGAAAGTGTTCCACGAACGTACGCGCACCATCTTTCGATTT
GAAGGTCTGGCCCAATGCCGTCTTGGTTCGTTCATCAGCTGGATCAGTTTACCGCTGGTA
TCCTTACGCAGCAGTTCATCCCAACGGCTACCACATCACTTTGATCGCATTCCAGCAGCA
CACACTTCGAAGATGCCTAGTTCGTTGTTAATCTTGCCGTTACCGGTGACCGGGCCGTCA
AGACGCTGCAGAGTTACAATTAGCTCGCAAAGACAACCGAGTTATCCAGTTTTCGGGTAG
CGATGGTGATCGCACCTTTGGATTCGGTTCGTCCCTTTCACCGTCACCGAGGAACGCGCG
TAAACGGTTTGTTTAGAGGTATCTTTCAGGCCACGGTGTTCCCAGATATTTCAAAATTAC
TTACGGTAAATAGCACCAATCGGACCCAGACCATAGATACGGTCCGGGAACTGCAGGAAA
TTCCGGCATCAGTTTCAGGTGCAGATAGGAAGAAGAGGCCATTGTGAACTTCCTGACGAG
TTATCCGCTTCTCTAAATTAAGACGACCTTCAGAGAGAAACTTTGGGCATTACACGCCAA
GGGAATCATAGCCTAGAAATAGCGCGCCGCCATCCTACTCATTCGTGCACGCGAAGAAGT
GGTTAAAGCACACCCATCTCATCTTGTTGCGGAAGACTGGAAGGACGCCATATGGCCGCC
AGTTCGAGGTCTTTAAACGCACGGCACCAAATCGCAGTAGCGTTCAGCGGATAACTGAAC
GAATGCAAGCTTGTTCAGTTCAGGTGCCCGGACTCCCGGTTGTTCTTCAGCAGGGATGGT
GTTGATGTAGTTGCTGATACTGTGCTGCGTTTACACCGCCTTTGCGAGCTTCAACAGCAA
GCAGTTGGTCGATCCCAGATACTGAGCACGCTCAGCACCTTCTTCTTCACGGATGACCCC
GATTCTAAATCGCGCAGGCCAGTCGCGAGTTTCGAATCGGATCCACGTCTGGGAAACGTT
CTGGCATGGGTTATTCCTTATCTATCTAATAACATTGGGTTTTCTGGAACCTGTCCCATT
GAATTTCTCGCCGACTCAATAAGACCTTGAGTTCTACGTTTGTTGCCGCGCTTTTATATG
CGCTTGATTTACAACATCTTCTGGATAATAATTTTACAGAAAATCACTAATTCTGTTGCA
TAGACGACACAAGGAAACGCTCGGCTCTCTTCGACTTCTGTCGAGCAAAATTTCTTCGAT
AAAGGCAGATGGCGATGCGATGGCGGCGCTTGCTGCTACAACTTACACAAGCCACTGTCG
CTTCAAATATGCGGGTGCGGTGACTGCTACAGCAGCATCTGTACCGACCGGAAGCAATTC
AAGTGCGGCGGACATTCTGGGCAACTCGGCTCCGCCACCTTAGCAGATGAAGCAGAACCA
TTGTGGGCGCTGGTGACGGCAATCGATACTGGGTACGGCGTTTGATTCCGCGTCAGATCC
TTGAACTGCTGCATGGCTCTGTAAGTGGTGGAGTTCTGAATGCGTTCCTTCTTCATCGGT
ACTACGCAGCGCGGCGTATAAGCGGCGATACCTTCCGAGCGTATCGTGTTTCGAAACCGC
CGAAGTCATACTGTGACTCAGGATGATGTGGTCGCGAGCAGCTCCACCAGCGGATCGCTG
AAGCTTTGCCATAGGCTGCTCTGGACAAAGTGCCGCCTTCACCACGGCGACGAAGCAGCA
AACCCTTCAACTGAGACGTTGGATCATACTCCCGCAGGAGGGACGGAGACGTCAAACTGT
TTTGCCAGTTCGCGCGTTCCGGTGGGAGTTTCGCCCGGGCGGAAGTGCCTTCGGATCAAA
AACTCCGGTTGCTGCTCCGTCGCCTCGGAGAGTTTTGGTTGGTTGTGCTGAGCCATGAGT
TCCTGTCTTGCCGGCCGCCACGAAGATCAATTGGTCTTACAATTTCATATCTATGACATA
AAATATAGAAAATGGCCTACCTTATGTCCATACAGGTTTGGTTAAAATCGCTAAACTGTG
CACATTTTACTCACTTGACATATATAACGTTTCAAGTTGTAGCTTATGCTGAATGTAGAC
TTTACGTAGGAAAGGGTTTTAACGTTATTAAACTATAAAAATCCGGGTGAACCGATTCTT
ACAAATTTTGTGTGATTTTAATTCTAAAACAATTTAAATTCATTCTACATATTGAGAGAG
GTTGAGGCTGAGCTTCCTGACAGTTTCTTTTCATATCATCTTCTTCGCCATAAAATGAGT
GCATTCGCTGCCGCATAAATGTCTTATTGATCAAGCTGAAGAAGTCTTTTGTAACAAAAC
TAAGCTTCTTTGATGTAAACAAATTAATACAACAAACGGGTGCCGACTTACACGCATCAC
TGCGTAGATCAAAACAACCACCGCACGAGGTTTCATGATGGAAAGTCAACCGCCACGGCG
AAGCAGCTAAGCGCGGCCTTAAACCATATTCAGCTTATCGCTGGGTGACTTGATAAGGAC
AGGTGTCACCGTGGCGCCTCCCGTATTACAGTCCGCAGGGCCGAGGATTATCTACGGGTT
GCGCCATTGCTGGTTTATCGCCTTTCTGATCACGGCCACTTCTGGCTGGGTAAATGGTCG
AAGACATCGCAGGCTCAGCACAGCCACTTTGCTTATAAATACTGGGGCAGTTTGCCGGTT
CCTTGCTGGCTGAACTTCTAGACACTGTACGTTTGAATTTGCTGCAGGCTGACGGCTGCC
GTGGTGCTGTCATTCAGTTCTGGTATCCAGAAATCCCACACGGGTTTCTACCGTATTCTT
TGTGGTGATTAACTTATGCATCCAGCCTGGCCAACATTAAGTGTTTGGCAGATGGAGTTC
CTGGTTTACCGTATCAAAGTTATCCGGTATTGGCGATGATCATCTTCGGCGGCTGGCTGC
TATTCTTCAGTACTTAGCAGCCTGAGCCGACCATTATAACCCTGTGGGATCAGGTGGGTT
TCCTGCCGCGGCTTCACCGGAAGGCTGGTGATGATGATGGCGATTATCATGTTCTCGTTC
GGTGGTCCAGAACTGGTGGGGATCCTGCCTGGCAGAAGCTGATATTCGAACAAGAAAATG
CCAGCAACTCTTGAGGTTATCTACCGCATCCTGATTTTCTATGTGGTTCATTCAGCCGTT
CTGCTCTCACTGATGCCGTGGACCCGTTGCCGCCGATACAATCCGTTTGTGCTGATCACT
ACGGTTAGGCGATACCTTTGGCGAATGCGCTGTGGAACATCGTACTGTTTGAGCGCTTTC
TCCGTGTACAGCAGCTGCGTATATTACGCTTATGCCGTATATGCTGTTTGGTCTGGCACA
ACAGGGTAATGCGCCAAAAGCGCTGGCGTCTGTCGATAAAACGTGGTGTACCAGTAAGCC
ATTCTGGTGTCACTGAAATGACTTGGCGTTGTGCGTACTGATTCTTCCCCCTTCACCCCG
GTCCACTTTCGGACATTATTATGGCGCTGAAGTAAGTATCTACTATGATAAAAATCAACT
GGTGATGATTGTGGCACGGCGCATATAATTCCATCCGCGCAAAGCAGGGAACAAAGCGTA
ATGCGCTCGCTTCCCTGCTCTATACTTTATCCGCTAGGTACTGGATCTGCCTGCTGTTTA
TGGCACGGCGGTACTGGTGATTATCACAATGGCCCGAGAATGGCGATTTGGTATACTATC
CAGTATGGCTAATCATGGTATTGGGTATCGGCTATCTGTTTAAAGAAAACCATGAAAGCC
GTAAAAGCGCATTAATCTCTACGCCGCCCTCACCCGGCATTGGGTGAGGCAATATCTTCA
CAACGCCCCGTAAATCGTCAGTAGTGCAATCACCACCACGGCTCCCAAAACGAGGTTTCT
TCGCCATTGGGCCTTGCCTTCGGCGTCTCCACATATCGACATGCGGTTCACGCGCCAGAG
AACTTCATGAACGTTAACACCTGATATGCAAGTGTAAATCACCAGCAAACAAACCGGGCT
GAGTAACACTTTCTCACACCACAATAAATCAAGGCATATGCCACACCGCAAGACAGACCG
GCACCAATCCAGTACATGAAAGCACAGCATCAATGCCGGACTATGGCTGTCAATGCGGCG
TCTGATATCCGCTTCAACCAGTATTGCCTTCACGCAAAACGCATACCCGGCATCAGCGTA
ACTTGGTCCCGAGTTCCCCACAATCAGCCGACAGCGGTGCAAGATAAAAACAAGATTCAT
CCCAGCAATACGCTTTATCCTGCATCTCACGTTCTGTCGCAGCTGCCGGGCTACGTAATG
TAGATCTAGTGAGTTCTTCAGCCATCATTATTTTTGGGCATAGCTATCATTACGTAAACA
GCTGTCAGATAAGCATGATAATATGAGACGAACTTTACCTGCGCCGGCCCAGCAAACCAA
ATCAACCCCAATGGCGTAGAACGTTGAACAATACTCCTGTCACGCATACTTGGTAAAAGT
CGCATCGCAATAATGGTCATACCTAACGTGCGCCCGAGAAAATGTTTCACCCATAGAAAA
ACACTTCAAAGCGATGATCAAGCTGCAGTGCTCATACGCTTAACCGCTCGAAAATTAACA
CAGTAGGTTGTAAATAGCGTGTATTGTCTCCTTGCTGACCAGCACACGAAACCGTGCCCA
AATCAAATGCAGACCGGGATCGGTTTCAATCCGCTTCTTATCACAATGGCCCGTCGCATA
TTTTAGCAATATCCAGACTGGCAATCAATCAGTACCCGCGTAAACACTTTTCGCAAGCTG
TTGATACTGCGCATCAGTATACGCCAGCATGTATCAGTGCCTTCAAGCTCAATCCCAATA
GAAAAATCATTGCAGCGTTCGCGCTGATACTGAGAGACTCCCGCATACCATGCGTTTATC
GAAAAGGAACATACTGGACTATTTCACCATCACGGCGAATCAAACAGTGAGCGGAGACGC
GCAAATGGGCGATCAGCAAAGAAAGGATGTGCTACCAGATCAATAGTTCCAGTGAATAAT
ACGTCGATCCACGGACCGCCAAACTCACGGCGGCAGGCTAATATTATGCTACCAGCAGGG
TAGGTGTTTTAAATCATCCGGGCGGCAATCATGTGGTGAGGAACGCGGCGCGCGCCAGCC
AGCCACCTGTTCTATAGCATGCAGGATCTCGCATATATGTGGTGCTAATACCCGGTTCAG
GTAGCATGTTTCTACCTTATGATTCTGGCTATCTGAGTTTAACATGCCGCCTCGCCATAT
AACCCTGACACCCGACGTGACGTAGACGCATTAATCTCGATATCCCCGGCGCGGTGGCAG
GCGCTTCTACCAGGAAGGTAGGCGGAACAGTCGATGCCAACAATGATATTACGGCAAAAC
TTTTGCCGAATTCTCGCTCTCATACGGTGATCACCCGCGAATGGCGTCTTTGCGGCAAAC
GCTGGGTTGAAGGGTGTTTATTCAACTGGCAGGCGACGATGTCACCATAATCTGGCATGT
GGATGACAGCGATGTCATCAATGCAAATCAATCAACATTCGAACTTGAAGGCCCATCCCG
CGTGCTGTTAACGGGCGAACGCACTGCGCGCTTAATTTTGTGCAAACCCTTTCAGGGTTA
CGCCTTGCCAGTGAGTACGCCACTATGTCGAATTGCTGGAAGGCACCAACACGCAGTTGT
TGGACCGCGCAAAACCTTACCGGCCTGCGTTCAGCTCTGAAATACGGTACTTTGCGGCGG
CGGGCGAATCACCGTCTGGGGCTTTCGTGCCTTCTGATCGAAAACCATATGTGTGCCTCC
GGCTCAGTGCGCGAGGCGGTCGAAAAGCGTCACGGCTGCACCCAGATGCGCCAGTAGAAG
TCGAAGTAGAGAATCTGGAAGAACTTGATGAAGCCCTGAAAGCAGGAGCCGATATCATCA
TGCTGGATAACTTCGAAACAGAATGCGCGAAGCCGTCAAACGCGCAACGGCAAGGCGCTA
CTGGAAGATGTCTACTTAACGTCACTGGTCCAGCTTACTACGTGGGTACCGAAACGGGCG
TGGACTTTATCTCCGTCGGTGCGCTAACTAAAGCACGTACAGCACTCACGACCTTTCAAT
GCGATTTTCACTAATAGTTGACAAGATTTATCCGCTCCATCGCGGCGGATAATCTCCCCT
TCCCAACTTTCTTCCAGCCAACGCCTCGCAAATTTCTTGTCTTTCGCTGCAACGAAATAA
AACCTCGGAATCTGCTTTTCCCGTTTCGTTTTGCCCTCGCCTGTGCTGATGGCGTTGCCG
TGGCGCCAACCGTCAAGGCGAAACAGATGGACAAGCAACGCGGTTTACCTTATCAATTTG
ATGGTGGTTATTGGCATCATTGCCATTTAGCGCCATTAGTATTCCATATCAAAACTACCT
GCGCAAAGCCGCACTCACCGGCAATACTACCATGCCCACAGCGCCTGTACCGCAAGAGTT
GTACGCACTGGAACATAGGTAGATTAAATACCTGCGACGGTGGCGGCAATGGCATTCCTC
GCCTACCACCACCGCTATGTTTTCAGCCATGAAGAGTACTCTTAAAAGGCGTGGTGTCGC
TGACCGGGCAAGAAAGTCTCAATGGAGCTAAGCGTCGTCGCGACACCGGGTTGCGTGCCT
GCGACGGCGTCACCGGCTGGACGCGCAACTGCAATATTCAAAGTGACAGCGCATTGCTTA
AGCCTGCGAAGATGTCTTCGCTTGATGACGCCAACTAAGGCGGCAATGAATATTCCGGCT
CACTGCCCTGTGTCACCTTCATGGAGTCTGCTGGATGCCAGCGAAGAGGTGGTTCATGTT
ACGTGGTCGATGCACCTTCGCGCGAGCTACAGACGACTTGCATTCGCTACCACCAAACGT
ATTGAGATCACCTGCTGGACGCCAGCAATGGAAGGTCACGCCAGTCCTTTTATAGACATT
GCCCGTAGCTGTTCGGGAGAAGACATCTCGGCCAAAGCAGAGTTGCTATCGACGTTGCAA
TCTGCTGGAACAACGCGCGCGTCTGATATTCATATCGAACCAGCGGACAATGCCTACCGC
ATCCGCTTGCGGCCTCGACGGCGTATTGCATCCTTTACCGGATGTTTCACCGGATGCCGG
GTCGCATTAACCGCCAGATTAAAAGTGCTGAAGCACGGATATTGCGAACATCGCCTGCAG
GACGGGCAATTCACTGTCGAACTGGCGGGAAACGTGATGTCATTTCATTGCGACCTTGTG
TCGAGGTGGTGAAGGTGGTATTAAGGTTGTTACGGCGGGTGGGTCGAACAGATATCAACA
CATAGATACAGCCATTACAACTGGCAGACTTGCTCATACTGCCACAACAACCACAGAGAC
TGGTGCTGGTAACTTCTTCTTCAGCAGCAACAAAGCAGTCACACTTTATAGTGCCCTGCA
AAAGCGCTGAATACCGCGGCATTAATATTTGTAACGTCGAAAAGATCAATTGAGATCCCC
ATAGCCAGACTAAACCAGACACAAATCCATCCGCGTGCAGACTCACCTTTCAGGAGCGTT
GCGTACGTTATTACGCCGGATCTACAACATCGTCAGAAGATCCACAATAGCGAAACAACG
AAGATCCTTCTCTCCAACACTTTCAAACGCTGTCACACAAGTAACGCTCCCCCTACCCTA
AAATTCCTGTAGCTGGTATTTACAACAATAAAGTGTACTAGATACTATCATCAACGCTGC
TAGTATACTTAACGTCTAGTACGCAAGCTTTGCCCCGTATCGCCAACGCCAAGAAACCTC
CCCTTCGAACAATGTGGCCATCGCCGCTGCCCGCGGCGGGCACCGGTTGTGTACATTGCT
ACCACGGTTTTATGTGGTCGTACGGCCTGTTGAAGTTCTGCCCGCAACGCCGGTCATTCG
TCGGCTTATTTCCGCTAATGAAGAGCGTTGAATCGCTGAAACGCGCACGGCAGGCGGGTA
TGCGTACGCTTTTTGAAAACGGCTGCTGGCCGTAGAGCAAGGCTTAACCACCTTTGAAGA
GGTATCCGCGTACTGGGATGCCGCATGACGTAAGCAACTCTGACGCTGGCGCTGGCATAA
CCGGCGACGGCAATGCGAATGGGATGCTATGGGCAGAGCCGTACTTTACTGTATGGCACT
ACAGCAGCAGATGGTTGCCGGCCGCAGGCGAATCGCCATCAATTCTCTGCGCAGTAGTGG
CGAGGAGATAAAAGCGCGGAAGTCATTCTCATCAACTGGCGACGCTACTCAAAGCAGGGT
TAACGCTTTCTGAGGCTGGCTCTGCTGGCGGAACAACAACATCCAGTAAAAAGCAATGGC
AAGCGTGCTGCAATCGCTGGCACGATCTCCAGAACAAGGCATTACTTTTCCAATACCTTC
TGCACGGTCAAAGTATTTCCGCCGCTCTATCAGGCGATGATCCGCACGGGTGAACGACCG
GTAAGCTGGATGAATGCTGCTGAACTGGCGCGTCAAGCAAAAGCCAGCGTCAGTTGACCG
ACAAAGTGGAAGTAGCGTTACGTTATCCCATCATCATTTGCTGATAGCAATCATGGTGGT
TGTGGCAATGCTGCATTTTGTTCTGCCGAGTTTGCCGCTATAGGTGTAACACTTACTACC
ACCGGCACTGGGATCTGTGACGCTGGCAAGACTTTGATGGCGAATGGGCGCTGCTGGTAT
TTGTTGTTCGGCTTTCTACTAGCGTATATCGCGAATTCTGGTCGCCGACAAGCACGGCTA
GTGCGGCAGAAATTGCTGTTACGCATCCCGATTATGGTTCGCGATGCGGGGACAAAACTC
CGCAAATCCTTTACCGTTCTGGCGCTACGGTGCGGCGTACTTTTACAGGCGCCGGCGAAG
CGTCAGAAACAATGCGCTGCCCGTACTGGGTGCAACTTCTGACTAAATCCAGCACGATAT
GTTAACAGTCAACCATCTCTGGCTGGCGCTAAAATACCATTGAAGTTGCCCGCTCTGTTT
GCAATTAGTGAGGTGGGAGGCATCCGGCTCTGGATCTCATGTTGAACAACCTCGCCCATC
ATCATCATCAGGAAAACACAATGGCGCGCTGGACGCCTCGCAGCCTTGCTGGAACCGGCG
TTGCTGATCATAACGGGAGAATTATTGGTACGCTGGGTAGTGGCAATGTATCTGCCAATT
TTCATTTAGGCGATGCGATGAGTAGGATGGGGTCTTTAACTGGCGTGTTGCTCCACGCCA
GCGTTGAAGCTGAGTTGTTAAAGATGCGGTTTTCTTGTTCCTGCACGAATAAACGTGGTG
CGCTTGTCAGCTCTTTCAGGCATGAAGCCCCAACGTATGTACAAGCTGAGCGGCCGCCAA
AATATCTCGCGCATTGTTCAACCGGGCCTCGCAGCGGCAGCAACGGTTTACCTTCTGCTG
CGCGTATTCCATAACGCCGCCAACGTGACGTTTCATCGCAGACTCGGAGCCATGCCGTAA
ACAACGCCGGCTTCTCGCCGTTCTCCTCAGCGATGCGACCGCCGCTCTCTTCGTGGCCCG
CCAGCATGCCGCCAAACATGACGAAATCAGCACCGCCGCGCCAAAGCTTTCGCCACATCG
CCCGGCGTGGTGCAGCCACCATCTGCTAACATTTCCGCAGACCGACGTACGCAGCATCAG
CACATTCGATGCCGCAGAAGTTGCAGATAACCGACGCCTGTTTGACGCGAGTTGTACCGT
AGAACACGGGCCAATGCCAGCACAACGATGTCGGCACCTGAGAGGATAAGCTCCTCCACA
TTCACCAGTCACTACGTTACCAGCACAAATGGTTTGGTCAGCCACACTTCACGCGCTTTC
GCAACAGGCTTGCACGAAGTGTTCGGAATAACCGACCACATCAACAAACGAAGTTTAATA
CCGGGTTCAGGTCGGCGAGAATCTGTTTAGTTTCGAAATCCGCATCAGACGTACCGGTAA
AAACCATCCACATGTTTCAACGCACATCCGGCGGAAAATTGTTGATAAACGCACCACTCT
TCGACAGAATAGTGTTTATGCAACAGTCAAAATATCAAAAGCCAGCGCAAGTACCAAAAT
GTGCCTACGGTGTCCATATTTGCAGCGATAATCAGCACGCCGGACAGCTCGGCCTGAATG
TTTGAAGGTGAATTGACGTTCAGTTAACATCAAACGGCACCAAGAAGTGGAGCGTTTAGA
GCGGATAAGGCGATCTTTAAAACCTAACTTCAGATCTTCTTCAATACGCATGTGCGGATT
CACGGGGTTAATGGCGCTATAAGAGGTAAGAAACTAACTCCAGTGACGCTATCATACGCA
CTATCAATGCGGCGCAAGACTGCGAAATTGTCTTTTACGCTACAATCCATAAATTGCACG
GTAAATAGTGAGCGAACGTTTCATCAATTTCGCTTTCGTGCACTCATTTAACGTTTTGAT
AATCATGATGAATTCAGGAATATAAATTATGAGTATATAGTTGCCTTAACGGGAGGCATA
GCAGTGGCAAAGTACCGTTGCCAATGCGTTTGCTGATCTCGAATTAACGTCATTGATGCC
GATATTGTGCGCGTCAGGGTGGTTGAACGGTGCACCTGCGCTACCTGCCGTACTGATCAC
TTTGGCGCTAACATGATTGCTGCTGATGCGTTATTGCAGCGCCGGGCCTGCGCGAGCGAA
TCTTCGCCAACGGAAGAGAAAAACTTGTGCTGCCCTGCCATCCGCGCTAATTCAGCAAGA
CGCAACAGATCCAGCAAGCTACTTCCCCTATGTACTGTAGGTTGTACCATTGCTGGTAGA
AAACTCACTGTATAAAGCCTTGATCAGAATGCTTATGGTGGGTCATCAGCAAAGAAACCT
ACTTTCACGCCTATGCAGCGCAAATGATGTAACTCGCGAGCATGTCGAACAAATCCTTTA
CTCAAACGCGCACCGCAGCCCTGCCGTAAGCAGGCTAATCAGTAATAATAACGGCGCACC
GGATGCTATCGCATCATCGGATGTTGCCCTGCACGCACTATTTGCAGCTTGCGTCACCAG
TTTGTCTCTGGAAAACCATGTAATGCAGGCCAGGTCCTTGCGAACGCATCACTAAATGAA
AAATGTGCGTACATATGGCTGCGCATTGAGTTTTGATTCAGCAACTCACCGTTAATTAAT
TTACCATCGTTGACCACGCGGCACTGCATTTCTTCCGTAATGTCAGGGTAGATACTGGAT
GTTTTCGAGCGCGCGGCAAGTCCACTAGGCTGTTGAAGAACTTGACCGGCAGCAACGTAA
ACCAGACACGGATTGGCAGTATTTGGCGTGGACCGAAACCATATTGAAGCATTAATTCAG
CAGTTAAAAGCGGCGGGAGCGTATTGAAATTCCTGCCCATATCAGCATTCTGCGTGAATC
GTTTGATTGCTCTGGTGCGTCAGCGACTGAGCATCAGGCAGCTGTTGCAGCTTTGGTTAC
CATTGCATTTGGCGGCTGCATCTACGAGCGCGCGACGGTAGAAACACGGATTGCCAGCCT
GACCCTCACCGAGCACCATGGTGGATTTAATTCGCCAGTCAGCCTTCCGTAAACGACCAG
CCCCAGATGGTTTTATCAGAGATATGCTGGTACTTGGCGATATACCGGCACCTGCACCTA
AGAATCCTATCCTCGATTCACCTTATCCATTCGGAACCTGAAACCGTTTGCTGCCATTCG
TTTTATACCGCTGGACACGAAAACCGGGCCAAGTACCGTTGTCTGGATTTCAGTTGGCCT
GTTACTAAGATGCATCTCAGAAAACTATTACGGTGAATTGCCCAACCTGCGGGAAAAGCA
GGTAAAGGTGTGGTGAAAATCAGCCATTTCCGGCCATTGCTCCAAAGCTTGTTGTTATCA
ACTGATCAGCCTCTGCTGGAAAATGGGCTGCTGAAAACAATCCATAGTAGCGATCTTTCA
AGCGATGACTGGGGCGAAGAACCAAAGCAGTGACATTTGTCTGATGCGTAAGCCTGTCCG
ACGCAGACGCGTCCGCATCAAACATCTGTCATCAGATCACCGCGTAGTACTTGTATCCGA
CCTACAAAGCAATTATCAGTTAGAAATCACCCAGGCCTGATAAGACGCGCCAGCATCGCA
TAAACATCATCTCTAATCTCAAGGATGCGGCAACCGCCATCAACCCTGAACAACTTCCTG
ATACCAGACCACGTGGCTGGAAAATCATCGGCATTAAGACCGACCAACATCCACTCCTGA
GTTGCTTCTTTACCCGGCTCCCCTTCCAGCATTCGACCAGCCAAAACCACAGTGTTATAT
ACCTGTCGAATTCATATTCCAGTTTTCTAAATAGCGAAAAATGTTGAGGTAATCCGACTT
CTTCCTAAAGTTCACACCACCTTCATTCCGGCGTTTCACCATTCAATTTACCGCCAGAAA
CTCAATTTATTCGCCATATGCGCATCTGCTGCGCGACGCGTTATAAAAATTTCATTATTC
TCGTTGCGAATAATACCTACCGCAATTTACGCTTTTCATTGTCTTAAACCTATAAAAGCA
CAAAATCCTGCGCCTTTACTTCATGATTAAGCTTTTATTGCAGGCGGCCATGGCACTGCT
TGTATTTTTACCAAGACCACACAGGCAAGATCATTACATCTCACCGCTCTCCGGTTTACG
CAAACCACAACTTCTGGCACAAAGTCCATCATCCCTAATGCTTCACTTCACTACCTTCAC
ACTAAAGCTGCTCGCTTCCATATACGACGCTGTTGTTCAGCTCCTCGCCTCTTCAGGCAT
ACGTACCTGAACTTGCTCAGCGTACTGATAACTTCGCCTTCAACGGCTCAGCATCGCTGC
GCTGCGAAACAATTCCACATTTATATTCCTGCACTTCAGATCTTTCTATGCACGCCGCCC
GCACCGATACAGATACCTAGCCTGGGCATAGTCCTCGCTGCCAGTGCTACAGAGTCAAGC
GTTGCAGCATGACGCCTTTCTCAGTGACGCATCATCTCGCACCAACCACTACTTCTTTAC
GCTGATACACTTCGATGGACTGCGCCAGAATACGCTCCCGCAGCGTCTCTTCATGCAGTT
CTGGTTCTTTATCCAGCCTGCACTCGGCAGTGTAAATCGAGGTCGAAATCGTTCTTCGAA
CGTTCCTGCAGCCCAGAATATCCACATTTCTTCCAGCGACCTTGGTAGAATATGAGCATC
AATAGTCGCTGAACACATCTTCACGAATGCTGTTAATGGTTTCGCTCACATCGCGACATC
AACAATTCATTACACAAGGAAGTATGGCACGGCAATCATTCGCCACGTACTCCTGACCAA
CGGTGTACTTACGGAATGTCGATTACGGCTCAACTTTACGCTGAGCATTGTAATCGCTTT
AGTCACCCACGGGTGTTCAATAGCCGCACGGCTTCGCGCCTGGTTACGCATCATGCGGAT
ACTCGGTCGGAAGCAAAAATACGCATCAGCACATCTTCCTCAACAAGTAGAAACGGAAGA
ACAACATCCCTGACGGCGCCAGAACGACCACCGCGCAACTGGTTATCGATACGTGGGATT
CGTGACGCTCAGTACCGATATACAGGCCACCTGCTTCGATACCGCATCGTGACGTACCTG
CCAGTCGGCTTTAATTTTCAATTGCTCTGCGGTCAGATTTTCCAGCACGGCAACTTCTGC
CTGCCAGCTACCACCGAGCACAATATCTGTACCGGCCGCCATATTAAGTGCGATAGTCGC
AGCCAGATAACCTGCCTGAGCAACATCGCCGCTGTTAGCGTAAATTTAACATTCAAGACG
TTGTGCTGCCTCCCTTTGTGGTGACTTCCATCTCCGATTTTTCGTGGAGATAAAGTACCC
ACCAGCACCGGCTGGCGCTTCCGCGTACGTTCTTTGATATCTTCAGCTGATCGCCTAAAT
TTTCCGCTTCAGTCATATGAGCCGAGTCCGGCGAATCTTTACGAATCATTGGACGGTTGG
TCGGAACAGCGACCAGTATCCAGCAGGTGAGCTAAATTGCTTCAGTATCATAATACCGGT
CATCCCGCCAGTTTTCATACGGAGCAGAAGTAGTTCTGAAGGAAGGTGATCGAAGCCAGC
GATTTGTGGTTTCGTTCTGAATCACGCCTTTCGCTTCCACAGCACGGTGCAGACATCGGA
CCAGCGACGGCCTGCATGGTACGACCGGTGTGTGTTCGTCTTGATGATAACCACCATCTT
TAACGATGTAGTCGACGTCACGGGTAAGCAGCACACTTGAGCGCTGCCAGCTACGTTACG
TGGTGCATCAGCATGATGTTAGCCGGAAGTACAGAGACTCCCCTTCATCCATGATGCCCT
CTTTCACCAGCAGTTCCTTCAATCGGCACCAGACCGTTCGGTCAGGTTCACTGGCGAATT
TTCGTCCACCGAGAGGCCTTCGCCCTACAAGAGTTTCAGGTCTTCTTTTCCTGACGCGGA
TCAGGTGCGGAATAATTTTATTCACGCGTTTATACATTTCCGAGCTGTCTTCTGCCGGGC
CGACAATCGGCGGTGTGCGCGCAACTTCATCGATCAGGATGGAGTCACTTCGTCCACCAG
CGCATGGTGCAGTTACGCTGTACACGTTCTTCGGGGCTAGAACGCCATATTTGTCGCGCA
GGTAGTCAAAGCCGTATTCGTTGTTCGTACCGTAAAGTGACGTCATCTCAGCTACGCCAG
CTTCGCACACTTTACCGGTACTGGCATGCCAACGAGTTGATACCGACAGTCAGGCCAAGG
AACAGCGGACGGTTGTTCGGCGTCACGTTGCGCCGGTAGTCGTTGACGGTAACTACGTGC
ACGCCTTTACCGATAGTGCGTTCGCGAGTAAGCAGGCAGCGTTGCGGTCAGGGTTTTCCT
TCACCGGTACGCATTTCGGCGTCTGGCGGTCGTTAAGAACCATACCACCGAGTAATGAAC
CGTCAAGTGACATATACCAAAGACGCGCGCTTACTTGCCTCACGTACCACGGCGAAAGCT
TCCGGGATCAGATTTCCAGCACTTCGCCTTGCAGACGTGCACAGAAACTCTGCGGTTTCC
CTTTCAGTTCTTCATCGGAAGTTTTCATCTCGGTTCCATAGTGATGATGTTGACCACTTG
CGCATCCGAAAGCGCAGGGTACGATCGTTACGACTACAAAAACTTTAGTTAATTTGATTA
ACATAATAAAATCTCAAACGCCCGCGTTGCGGTTAATAAAATGAAGTAAAGGTTTATTGT
TGTTAGGTGAGGCGTTGAGGCCCTTTGGATGCCTTGCGCACGGCTTATCAGACGGGCGTG
CTGAATTTTGCTTGTGGGTAAATGCGCATAATCAATACGATAACCCTTTTGGTGGCGATG
CCTTCGGGTCAGCAGCGCGCTGAGCGTATCCAGTAATGCAGATGTTGCCTGAAGAGGCAA
AGATTCTTCAGCAACGGGCGGTGTTGCGGTGCCATTGCGAAAGAAAGATAGTAGTTACCG
TGCGAATGGCATGTTGATGCCAGTATCAACGGAATAGTTCAGGTGGCGGGCGGCGTGTGT
TCGCTTCCAGCAAGGCCAATTGACCAAAGTTAACTTTTGGCTGAAGGCTCGTGGTTGCGG
GTTGTCGCTTTTGCAGGCGCGTTTGGTTCGGCGGCGTTGCTGAGCGCGAGCAAACCTAAA
CTCGCCGCAGCCATCATAAAATGCAGCAAAGTAGCGTTTACAAACTGTCCCTTGTACGTC
GGTATTCCACTCACGTTATTATGCATCCGATCATATTCCAAGCATTGCTTGCTAAATCTT
ATCATTAGCTGCAGTCACAGCACAAATATGAAGAATAAAGATTGTGCAGAAAATTCTTAA
AAACAGCGTTCGCACCGTTTTATAGCTCTTATAAAATTAAAAACGACTGGTTCACACTAG
CGGAAAGTACCAGATTGCCAGTCGAATTTTACTCGACATTATAAATGTCGTTATGCCAGT
ACAGCTGAAGGCGCTTTGAAGGCCAACGGCAGTTCGTCGTCACAGAGGTCACATATTCGA
GCTTCCTGTTTCGCGAGGACAGCCTGCAGCAGTTGTTATTCAGTGCATGACCAGTTTATA
AGCGATGCAATAATATTAATGATACACATGAACCGTCACCGATCGCATCGAGCATTTTGA
CGCACAAATTCGTCTTGCTAAAACGCAGGCCGTCTTCGTTCAGTACGCGATAATCGTCAG
CAACGATGGCACAATCAAGCTGCCGCCGAGCTGAAACCACAGGACTGCAGATATTCGTCG
CACATGAAGAGCAAACATACGCGCAGCTGATCTGGCACCGACGCATCAGCAGAAGATTCC
ATCCGCCTGGGTGCTGGAATCAGCCGGATGGTTAAAATCGATGGTGAAATCCAGCGAAAA
CCATTGTGCCGCCGGTATTCCCGCCTCATGTCTTCGCTGAACAGCGTCTTGATGCGAACC
GTTTTTGGCGCAGTTCAACTCGTCGTACCGGCGTCAAGCGGCAGGTATACAAACGGAGCG
GCGCTGCCGTCCATGACGGGATTTCCGGCGCGCGTTAACTTCGATAACAATGTTATCGAT
GCCGCAAACCCGCGAGAGCAACGTGAGGTGCTGCTCTACGGTTGAAATCCGTACATCATA
CTCGTTGACGAACACCTTCTACAAACGCCGATATCCACACACAGGTGGCATCGGCCGGGA
AATCTACCGGTAGATTCAAGTCGGTGCGACGATAGGCAACCCGGTGTTGGCCGGCACAGG
GCATATTAACGTCGGTGACTTTCTTGCCGGTATGCTAAACCGGCACCCGTCGCGCCTGAA
CGATACATTTAAGTGTCGCTGTTTGATCATCGTATTATCTCGCCATTACCTATCCAAGTG
TACTACTCCTTCAGCAGGGCCAGTTTAGCACAAAACCTCGGCAAATTCCCGTCCAATTCT
TAATCAGCTTGCTTACGCGCAGAATGCTGGGATATCGAATAAATCCGGCTCTTTCGCAGT
TTGCGGCGCATTGTCCATTCACGACTTTAGCAACCGGCTTCTGCTCTGAGTCAGCAGGCC
ATCCATGTATGCTGCTGGTAACGATCCATCACTGGCTGCTGAACTTCTTGGTCTAGGTGA
TTTCAGGACGTTTGTCCATGCCGATACCTGTCGCAACAACGGTTACGCGCAGCTCGTCAT
TCATATCGGGTCAAGAAAGTACCGATAACCCGGTCGCGCGTTGCCAGAAGCAATACCTGT
GGTCGTGCCTACTGCGTTTCGTCATCCAGACGCAGGTCAAGCCCGCCACGTGATATTATA
CTTTTGCGCCGCGCGTGCCAACAGATCAATATCTGCTGGAAAAGAATAGCCATTTCAGCT
TCTTCACGGTCTTCACCGCTCGCCACGCCAGAACCCATCATTGCGTAACCATCTCGAACA
TTACGGTGCGTACGTCTGCCAAAGTCACGTTCATCAAACCCGGACGAGTAATCAGTTCAG
CATTACGCTTGCACAGCGCCTTTCAGTACATCGTTCCTGCACCAAAGCATCCAGCAGGAG
ATACCGCGGCCCGAACTTTCAGCAGTTTGTCGTTCGGATGATAGTGATCAGAAAGTCCAC
ATGCTTGAACAGTTCGAAGTCCTGCTCCGCGAATGCCATACGCTTCTTGCCTTCAAAGTT
GAAAGGCTTAGTGACGACAGCAACGGTCAGGATACCCCGTCTTTTGCCACTTCAGCGACG
ACTGGTGCTGCACCTGTGCAGTACCACCACCCTTACCCGCAGCAATAAGACCATGTCTAC
CTTCCAGCGCCGCACGCAATGCATCACCCGTCCTCATCAGCCACATTGCACGGCCAACCT
GGATTAGCGCCAGCGCAGTCCTGGTGATACCGCGCTACCGATTTGAATCGTCTGTCAACC
GCTGTTTACACCTTTGTGCCATCGGTATTTACCGCGAAGAATTCAACACCTTCAATGCTC
GCGCGCACCATGTGTTCAACAGCATTACCGCCGCCGCCGCCGACGCCGATGACTTTAATC
ACCGCGTCATTGGTAAGTTCCATTGGTTCAAACATAGTTTCTCTCCAATTTGTGCCTGTG
TCGCTGAGGCTGTGTCATCGTCAGCCTCATAAAAATTAAAACTCTTTTCGCAGCCAACTA
TTGGTCGCTTGATCCACGAGCCAGCAGTGCTGTAACACGTTTTTCGCCTGTAGCTTCACC
GTTAAAGATGTGACGACTCTTTCCGCGAATGCCGTGGCAATCCCCACCGTCTAGTCATAC
GGCTCCTGGGCATAATCGTTACAAACCAGGTAATGTCTTCAACGCTTGCGCCGATACTTG
CCGCCTGCTGTGCTGAAACACGCGCTGAGCACAGGCTGCAAGACCTTCGATCTGCGCTGC
GCCACCGGTTAATACAATGCCTGCCGCGGTGATGTTAACCCCTTGTTGGCGAAGCTTTTC
TGCAACTGCAATATCTCTTCGGTGACGAATTTGAGCACCGGTATATGGCACGCTCAATCC
TCTGCAGTGTCTGACGTTGCGGGCTCCGTGGCGGAACAGCCACCACTCTTGCCACGCTCT
CATCTTTTCGCGATGGAACCAGCGCACTACTTCATAGCGAACTTTGGCTCCTTCGTAGCG
TCGCTTGGCGGCGTGCCAAGGCGTAGCGATATCATAGTCACGACATTGCCACGGCGCAAG
GAATTACCTTAGTGTGGCGCAATGCCCCACCAGTATAAACGGCGATATCGTGCCACCGAT
ATCGACGACGCAGCGCAGTTCACGTTCATCTTCCGTCAATACCGAATAACTTGATGCCAG
TCCGGCAAATATATCAGTTGGTCAACTTTCAGCCCAACGTTCAACCGCTGACGATGTTTT
CGCCATATCGTTGTGACATGTGATCAGGTGCGCACGCCTGCATCCGCACGCCCGAAAGTC
TACCAGATTCTTGATCACTTCCTGATAAGTCAATCACCGCCCTCTCTGCGAGGATCACCA
CCTTTACGATACTCATCGCGCACGCACCGATTTCGGTATGGACGACGTTTTCCCATCCTT
CTTGCGTCACTTCTTCTTAAAGCCGACTTTCCGCTGCCAATTTCATTCTGGCAGCATGAT
GTGCTTGCAAAGCGCCAGATATACCGAAAGATCGACAATCTGCCATCAATTCTGCACAGT
CAATGGCGCGTTGTACCGCCAGCTGCAGATTCGAGTCATTCTACCACCTTTATCCATACC
GCGACGGGCAGCTGCCCGCCAATGATGTGTCATACCGTCGGGCAGAACTTCCCCTAAAGC
GGCCTTCGGTACAATCTCAGTCCTACTACAGTTTCTGTCACCGTCGCCTTGATCATTGTT
GTTCTGCCTGTGCCTGATTTTTGTTGCTGAGTAGATTCCTGGCAGCAAGGCGCCCAGCCT
ACCGCTCCAAGTCCTGCCTGCAATCAGCATGTAGCTAATCCGTTGCCATCGGTTTGCGCC
TGCTGTAAAACCGGATAAAGTTCTACAAGCGAGCCAAACTGTTTATCATTATCGCCCCGG
CCAAGATTGAGCTTAATATCGTTATTCAGCGACGTCAACTGCCGCGAGAACATAAGTCAT
CGCCGCTTCCTTCAAGTAAATCATCCTTTGCCAGCATCTGCCCCGATAGCCCTGCAACGC
TTCATTGGCGCTTTGCCTTCCAGGCCGCCAGCATTGAGCACCTGCTTGCTGGTGCGTTCC
TGGCGCTGGTATTTCCTTCCGCGTCTACCATGTGTTGATCATTCACCGCGCAATCGGCAT
ATTCAGCCAGATGAATCTTCAATTCATCAGGCCACTGCTTTCTGACACTCCTCGCCATCC
GGCAGGCGTTGTTCTATTTACGTCTGGATAGTCTGTGACCTCATCTTCACGGTCAACAAA
AGGTGTCACCCAATACGAGATCGACTACCCGGATATCAATCACATTGCGTGTGTGGCGTT
CACCGTCGCACCAGCTTTAGAGCGGCAGGCGTTGCATCTCCATCAGCCCAACCCACGACC
AACCGCTCCACTGACTTTTGTCGTTAAAACGGTCGGCAAGGAAAAGATCCACTAGACGTT
CCATGTGCGGCGAAGAAACCTCTTCTTCGCTGTTTCGCGATAATTTCAAGAGCAGCCTGC
GACATAATGATCCGCCAGTTCAGAATTCGTACTACCAGCTCATACCTACCTGACGTGCCG
CCATCGGCACCGGGCTGGCTAGTCATACCCGGTGAGGTATTGGCTTCAACAGATAAAACT
GTCCATCGCTGTCCAGCATAACGTCAATACGTCCCATCCTTTGCAACCTAGCACGTCGTC
CATGCTTTCAGCACTAATGCCTGCAAATTGGCCTCTTGGCCTTCCAGACCTGCGGGGCGA
AATACTGTGTCTCATCAGAGATACTTCGCCTCATAATCATAGAAGGTTCGGACGGTTCGT
ATTGACGGTAAAATTTCTTCACCGAGTATCGCAACCGTGAACTCCGGCCCACTTAGCCAT
TTTCAATCAATGCTTCTTCATCGTGCTGGGAAATACCAATCTGGTATTCATCTTGTAGAG
CATTTTCTACTACTACTAGCATTCCACCTAGACCTTGGCTCGGCTTAACGATAACCGGCA
AACAGAGCAGAAATTTCTACTAACTACCTCGCTCAGGCCTTTTCAACGACTCTGCGCGGG
TTAACGCTACCCGCAGCGCGACCAGTATCCAACGCCTGCCGCACAAAGTTTACCGTAGTT
TATCATTAAGCTGGTCTGCCATCACTCCGCTTCGGTATAAGGCAAGCCCATCGGCTCGAG
CATCCCTGCAGCGTACCATCTTCACCGCCGCGACCGTGTAGCGCGATAAACACTTCTGAA
AGCCCATCGGCTTCAGTTGCGTCACGTCGACTTCTTTCGGGTCACGACAGGATACACTAC
GTCATCGCCGCCTTCCACCAGTCCAGCTGTACCGCTGCCAAATTTGAAAACTTCATGGCA
TGGGGTCCCGCAAACAAGACCGCATTTATCAGTCATGTTGTTCTTTATCCGGGTTGCGGC
CAGTTTGATTTCAGCTAAGGAGCGGGCAATTTTTCCAATACCAGCCCCTGGGCAAGAATC
AAGGTCATTACCAGTTCTCCTGGTGCCAGCATCTCGGCTACCCAGCACCGGATCAAACTT
CCAGAATGGGATCAATTTTCCCACGTCACGGGTGCCGGCCCCAGCGAACGCTGTCCGCTC
GGTGGCGCCCTTAATGGATACACTTCCAGCATCAACTACAAGGTATCAACCTGCACGTGC
TTGTTGGCGAAATCATCATACAGGTCAGCGCGTACAGGTAAAACGGTGCGGCTGAAACAG
CATTACGAGTTTTATCCGGCCAACCTTCGCGCCGCTTTAATAAGTGGCATCCGCTTCCGT
CGGGTGGTGGCCGTAGTCATCGACCAGCATTGCCATACCACTTTACCATTCCACCGCGGG
GAATTCACCGAGAAATCAAAACGGCGACCAGTCCCACCGAGCTGCAGCGCCCACCAAAAT
AGCCTCGTCGTGTCACCTCTTCATGGCAACCGCAACCGCAGCTGCGGCGTTCAGCGCGTT
ATGACGACACGGCGCATTCAGGGTGACGCATCGGCTCTTTGTCTGGCGCAGCAGCGTAAA
GTGCCCTGCGAATCACTGATAATCTTCTACGCGTCGGCATCTTCGCATGAAAATAAGTCG
TGGTCTGACCTTACTCGCGGTAACAATTCGCGGATCACCGGATCATCAGCACACACATCA
CCGCGACCGTAAAACGGCAGGTTGTGAAAATTAATAAAAGTCTGTTTTAAATTCTCAAAG
TCGCCTGGTAGGTATCCATGGTCGGCTTCGATATTGAGCAATCGCCACCATCGGTTGCAG
ATGGGAACGATGCATCACTCATCTGCTTCTCGGCAATCAGGTACCGACCATGCCCAAACG
CATGAACCCCACCGCTTTACAAGCCCGCCGTATGTGAAAGTTGGGTCGAGCCCGCTTCTG
CGTAGATGCTGGAAACCATCGCGGTGGTTGCTCATTTTACCATGCGTTCCGGCAATGGCG
ATGCCATGACGAAAACGCATTAACTCAGCAGCATTTCGGCGACGGATCACCGGGAATACG
CACTTCGCAAACGGCGACAATTTCGGTTATCGAAAATCGCGCTGGAAACAACGACACGCT
GGCATCACGTACACGTTTCCGGCGTGGTTGAAATAAATCGTCGCACCGTTGTGCTGCTGC
GTGACCGGATTTGGCGCTAAATCTGGAGACCACTGATCTGATAACCTTCGGCCCAAAGCA
GAACTTCGGCAATACCGCCCATACCGGCACCACCAATGCCGACAAAATGTATGTGCCGAA
CGCGACGCATTTCGGGCACGATATGGAACGCAGTTTGCCAATTGTTGTATATTCAGCTTT
CACACATGGCGTACTTCTTAAGCATACGATGCAAAAGGCATCGCTACAATTACGCCGGGC
AGCCCGGCTCACTTCATTGCCCTCGCTCAGGTGGCATCCGGAATCGTCTGGCACAGGCAC
GTTCTACCTGAATTCATGGTTTCTCGCGGCCACAGCACGGTGTTGGCGGCTGTATCCCCT
TCGCTGTAGCTGCTCGATAATTTGCTGCTTCACCCGCACCAGCGGTAGCGCATTCAGTAT
TACTGGCGGTCTTTATGTTGAAACGGCACAAACAACGCCGGTCCTGCCGCGGCGATTTCA
CTCACCATTAACGCACCGGGCGGCAAACGACGACATCACCCGCATACGCACCGCCGCCTA
TCGTCAATAAATTCGTCACTTTATGCTGCGGTTGCCCGCTGGCATACGCCTGTTCAACGG
ATTGTTGCGAACCTTTGCCGCTCTGATGCCGAATGTTGACTGAATCACCCAGTTTCGCAG
CAACCTGCGGCATTATCTAGATTAAAATAAGTACCCAAGAACCACCACTACCAGCACACG
AACCGGACCTTCATCCAGCAAACGTTGCTGCGGCAACGGCTGCGCCAACTACTATCGGTA
CGCACCAGGTTACCCACTACTTCCGCATTAGGAAAGCACGGAAACGCCTGCCATCACTTT
GGTGGCAATCTTCGCCAGCCATTTATTGGGTTAAGCCCTGTACCGTTTTTGTTCATGAAG
TACAACCGGAATGCCTAACGACCACGCGGCAGACCACGGACCTGGCCACGTAGCCTCCCC
ATACCAAGGCACCCATCAGGTTTACCGCTTTCTTCATCGCCCCAGCGCGGGCGTTTGAAA
GATACTGGCAGAGCGGCTTCTCAGTGCTTGCGCCATTTTCCGCAGACCAGGAATACAGGC
CAAATCAAAATTTCGATGCCATGTTTGGCACTAAGTCCGCTTCCATACGGTCGGCGGTCC
CAGCTGGCAACGCAACCTGAGCCATTAGATGGTGCACCGCCAGTCCAGAATACCTGTCCA
CCAAGTTCCGCCTGCCATCACCGTGTCGCTTTCGCCGGCCACTCATCGTGAACCTCGTAC
AAACGCCTGCGCTTTCCTCAGACGCGTTTCACCGTCGTACGCAACAGCATCGCGGTGGCT
GTGACGCAATCGGTAGCTCGAACCCATGCTGATCAGCGGCAATATCAGACCTTTGGTCGG
TAACATCCCGCCGCCGCGCCTGCCGTTAACCAGCGCACAGGAAGCTTCAACCAGATGCAA
TAGACAGGCTTTGAAAAACCGGAAAACGGTGGTCAATTTCTAAATACTTTACGGCCATCG
ACATCGCGCGAAAGCGACGAAGAATACCATTAAAAGTGCCAGCACCCGCAGCCTGCAGTT
CTTCGCCGATATTGGCGAAAATAAAGTCAGTGTGCGCTTCCGGCAGATACTCCAGTTTTG
TACCGAGTTACCTAAACCTTGCCCAAGTTCGCGCCGCGGCCAAACGCCATCCAGCATTGC
ATTCTTGTCGCCACTACGCCAGGATCTTCCAGGTTAGGGCTGCGGTAACACGGCGGATAC
GGTGGTACGATTCGGCAGTATCAGCAACACAGCCACAGAAGTACCCGCCGTGTACTTGTG
GAACTACCCACAAATTCCTCCACCGAAACCTTGTCGCCAGCGTAGTCTGAGCAACACCAC
CACCGTACCAAGGTCTGGCTGTGCCTCAGTAACACTACCAACACCAGAATCACGCCCATC
GGTTTCAGGAAGCCGCGCAGGTGTGCAGTACTTCGTCCTTTTTCAGATAGTTGGCGATAT
AACCAAAACAGCGACAGTTTTGTCGGCTCCGCAGCTGGATACGCAGCAAACCGAGATCGT
CCGCGCGTGCCCCTTCGCCGAGCTACCCACTACGGGACGATCATCAGGATGATGAATCCG
AGCAGCATCGTGGCACTGTGGCGTTGCCAGAACTCCATCGGCAGACGCAGCGTAATGATC
GCCAAAGTCCGGCTTGCCAAAATCAGATAGACACCATCACGCTTCGCGAAGAAGAACGGA
CGTTGGTTAGCGTTGCCCTATAGGCATTGACGCCGAGTCACCATGATAAAACCAATCGCC
GCGAGGGCCGAAGATCAGCCACAGTAGGTGCGATCGTACATGATCAGGCTGTCGGTATCT
TTCCTGGCTTGCTCTACCCCGGCCTTTAGCGCCGTGGAGATCGAACCGGGATACTGAATC
ACGGCAGGCGCGGCATTTTCAGGCGAGGAGATAAACGCATCGGCCTAACTCCTTCGCCAG
GCCGACTCAGCATTACCTCGTTGTTAAGTTCTTGAACTGATCAAGGCTTCGGCTGGGCTG
GGAAACAAGACCATATCGCCCGGCTGACACGCGCGACAGCAAGCACATCGCCTCGTCCCT
GTTTGGTTTGTTCTGCCACTTCCGGGCGTAGCCTGTACGCGCCGTCGACCGAAACAATGG
TGTACGTTATCGCCATTCAAGTACCGCGCGCCAGTGGGCTAAAGTCCGCCGATTTACCAT
CGCCACCCAGCAACAAATGCGTGTGCCGTCTGCGTGCAGGCCATTCGGCGCCGCTTCCGT
ACCGACGTTGGTCGCTGAATCATTAAATCCAACGTACGCCGACCTGCTCAACTACTTCAG
CGATGCGGCAGGTGATAGATGTAAGGTTAACGCACCAGAGCTGCTGCGCAGTAACCTGCG
GCATCTGCACCGGCGCCAGCGCCGCCAGCGCACATTGGTGTGGTGCTGCTGGAAAGTTTC
ATCTCTTTCACATTCCTTTTCTCGCCTTTAACCCGCAACCCGAGTTTCGCCCACTGATGA
TTCAGGTGATAGTCACCCATGTTGACGCCAAAGCTGACGCAGCGTTCATCGCACCGCGAT
CGGCATTGTTAAGGCATCATCAGCGTACCACGCAAACTGCGTTTCGTAAATGCGCAGTTT
TGCTGATACTGGCTGTAAACCAAACGGATACTTGATCCGCTTGGAATCTTCGGTCACGTT
CAGATAATTCGCTGCCGCCTGTAAGCTGGAGGTGGTTTCAGCGCTGGAGCTCTCGACAAT
TCCAGCACGTACAGTTCACCTCTCATCATGTCGCCTCCAACAGGCAGGCCAATATTGCCA
CCCACCAACGTTGCCCCCGCCGCTTTCGCCATTTCACCCACTGGCGTGGTGACCGTGCTG
TTAGAACTGTTGTCATACAATCGGTGCTTGCTTCGCGACAAGAACAGCTCGATATCGCCA
ACGATTTCGATTCCGGCATCAGCGGCAGCAGCAAGGATGGATGCGCCAGTGCAATACCGG
GACTGGCGACAATCAGATCTGCCGCCATCAGCCATTCATCATTCAGACTGCCGTGTGGCG
TTCTACGGCTTCGGGTAATTTATCGAGCCGAGGCGGTGTCATACGCGTATCATAACGCAG
CATCACCGACGAGGAAAAGTCCACGCAGG
In [47]:
%%R
library(ggplot2)
align=read.table("E_coli_K12_1D_R9.2_SpotON_2.error_profile.txt", header=T)
ggplot(align, aes(x=100*matches/(matches+deletions+insertions+mismatches))) + geom_histogram() + theme_bw() + xlab("Identity (percentage)")
In [61]:
%%R
library(ggplot2)
align=read.table("E_coli_K12_1D_R9.2_SpotON_2.error_profile.txt", header=T)
align$qual = 100*align$matches/(align$matches+align$deletions+align$insertions+align$mismatches)
summary(align$qual)
   Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
  61.00   80.30   83.82   83.12   86.42   95.26