Repetitive DNA elements ("repeats") are DNA sequences prevalent in genomes, especially of higher eukaryotes. Repeats make up about 50% of the human genome and over 80% of the maize genome. Repeats can be categorized as interspersed, where similar DNA sequences are spread throughout the genome, or tandem, where similar sequences are adjacent (see Treangen and Salzberg). Some interspersed repeats are long segmental duplications, but most are relatively short transposons and retrotransposons. Though repeats are sometimes referred to as “junk,” they are involved in processes of current scientific interest, including genome expansion, speciation, and epigenetic regulation (see Fedoroff). Some are still actively expressed and duplicated, including in the human genome (see Witherspoon et al, Tyekucheva et al).

RepeatMasker

RepeatMasker is both a tool for identifying repeats in a genome sequence, and a database of repeats that have been found. The database covers some well known model species, like human, chimpanzee, gorilla, rhesus, rat, mouse, horse, cow, cat, dog, chicken, zebrafish, bee, fruitfly and roundworm. People often use RepeatMasker to remove ("mask out") repetitive sequences from the genome so that they can be ignored (or otherwise treated specially) in later analyses, though that's not our goal here.

It's intructive to click on some of the species listed in the database and examine the associated bar and pie charts describing their repeat content. For example, note the differences between the bar charts for human and mouse, especially for SINE/Alu and LINE/L1.

Working with RepeatMasker databases

Let's obtain and parse a RepeatMasker database. We'll start with roundworm because it's relatively small (only about 2.5 megabytes compressed).

In [4]:
import urllib
rm_site = 'http://www.repeatmasker.org'
fn = 'ce10.fa.out.gz'
urllib.urlretrieve("%s/genomes/ce10/RepeatMasker-rm405-db20140131/%s" % (rm_site, fn), fn)
Out[4]:
('ce10.fa.out.gz', <httplib.HTTPMessage instance at 0x10374e2d8>)
In [13]:
import gzip
with gzip.open(fn) as fh:
    print ''.join(fh.readlines()[:10])
# Might want to adjust your browser window wider so you can see all the columns
   SW  perc perc perc  query      position in query           matching       repeat              position in  repeat
score  div. del. ins.  sequence    begin     end    (left)    repeat         class/family         begin  end (left)   ID

  508   0.0  0.0  0.0  chrI            1     432 (15071991) +  (GCCTAA)n      Simple_repeat            1  432    (0)      1
 1226  10.0  0.0  0.0  chrI          566     595 (15071828) +  (GCCTAA)n      Simple_repeat            1   41  (240)      2
  344  22.2  0.0  0.0  chrI          596     676 (15071747) C  RCS5           Satellite             (41) 1387   1307      3
 1226  10.0  0.0  0.0  chrI          677     846 (15071577) +  (GCCTAA)n      Simple_repeat           42  281    (0)      2
  432  21.9  2.4  0.0  chrI         1622    1744 (15070679) +  LONGPAL1       DNA/MULE-MuDR          136  261 (2330)      4
 8509   0.6  0.0  0.1  chrI         2052    3026 (15069397) +  PALTTTAAA3     DNA                      1  974  (529)      5
 4521   1.1  0.2  0.2  chrI         3124    3652 (15068771) +  PALTTTAAA3     DNA                    974 1502    (1)      6

Above are the first several lines of the .out.gz file for the roundworm (C. elegans). The columns have headers, which are somewhat helpful. More detail is available in the RepeatMasker documentation under "How to read the results". (Note that in addition to the 14 fields descrived in the documentation, there's also a 15th ID field.)

Here's an extremely simple class that parses a line from these files and stores the individual values in its fields:

In [14]:
class Repeat(object):
    def __init__(self, ln):
        # parse fields
        (self.swsc, self.pctdiv, self.pctdel, self.pctins, self.refid,
         self.ref_i, self.ref_f, self.ref_remain, self.orient, self.rep_nm,
         self.rep_cl, self.rep_prior, self.rep_i, self.rep_f, self.unk) = ln.split()
        # int-ize the reference coordinates
        self.ref_i, self.ref_f = int(self.ref_i), int(self.ref_f)

We can parse a file into a list of Repeat objects:

In [18]:
def parse_repeat_masker_db(fn):
    reps = []
    with gzip.open(fn) if fn.endswith('.gz') else open(fn) as fh:
        fh.readline()  # skip header
        fh.readline()  # skip header
        fh.readline()  # skip header
        while True:
            ln = fh.readline()
            if len(ln) == 0:
                break
            reps.append(Repeat(ln))
    return reps
In [19]:
reps = parse_repeat_masker_db('ce10.fa.out.gz')

Extracting repeats from the genome in FASTA format

Now let's obtain the genome for the roundworm in FASTA format. For more information on FASTA, see the FASTA notebook. As seen above, the name of the genome assembly used by RepeatMasker is ce10. We can get it from the UCSC server. It's around 30 MB.

In [24]:
ucsc_site = 'http://hgdownload.cse.ucsc.edu/goldenPath'
fn = 'chromFa.tar.gz'
urllib.urlretrieve("%s/ce10/bigZips/%s" % (ucsc_site, fn), fn)
Out[24]:
('chromFa.tar.gz', <httplib.HTTPMessage instance at 0x102286560>)
In [25]:
!tar zxvf chromFa.tar.gz
x chrI.fa
x chrII.fa
x chrIII.fa
x chrIV.fa
x chrM.fa
x chrV.fa
x chrX.fa

Let's load chromosome I into a string so that we can see the sequences of the repeats.

In [53]:
from collections import defaultdict

def parse_fasta(fns):
    ret = defaultdict(bytearray)
    for fn in fns:
        with open(fn) as fh:
            for ln in fh:
                if ln[0] == '>':
                    name = ln[1:].rstrip()
                else:
                    ret[name].extend(ln.rstrip())
    return ret
In [54]:
genome = parse_fasta(['chrI.fa', 'chrII.fa', 'chrIII.fa', 'chrIV.fa', 'chrM.fa', 'chrV.fa', 'chrX.fa'])
In [55]:
genome['chrI'][:1000]  # printing just the first 1K nucleotides
Out[55]:
bytearray(b'gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaaAAAATTGAGATAAGAAAACATTTTACTTTTTCAAAATTGTTTTCATGCTAAATTCAAAACGTTTTTTTTTTAGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTtaggcctaatactaagcctaagcctaagcctaatactaagcctaagcctaagactaagcctaatactaagcctaagcctaagactaagcctaagactaagcctaagactaagcctaatactaagcctaagcctaagactaagcctaagcctaatactaagcctaagcctaagactaagcctaatactaagcctaagcctaagactaagcctaagactaagcctaagactaagcctaatactaagcctaagcctaagactaagcctaagcctaaAAGAATATGGTAGCTACAGAAACGGTAGTACACTCTTCTGAAAATACAAAAAATTTGCAATTTTTATAGCTAGGGCACTTTTTGTCTGCCCAAATATAGGCAACCAAAAATAATTGCCAAGTTTTTAATGATTTGTTGCATATTGAAAAAAACA')

Note the combination of lowercase and uppercase. Actually, that relates to our discussion here. The lowercase stretches are repeats! The UCSC genome sequences use the lowercase/uppercase distinction to make it clear where the repeats are -- and they know this because they ran RepeatMasker on the genome beforehand. In this case, the two repeats you can see are both simple hexamer repeats. Also, note that their position in the genome corresponds to the first two rows of the RepeatMasker database that we printed above.

We write a function that, given a Repeat and given a dictionary containing the sequences of all the chromosomes in the genome, outputs each repeat string.

In [56]:
def extract_repeat(rep, genome):
    assert rep.refid in genome
    return genome[rep.refid][rep.ref_i-1:rep.ref_f]
In [57]:
extract_repeat(reps[0], genome)
Out[57]:
bytearray(b'gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa')
In [58]:
extract_repeat(reps[1], genome)
Out[58]:
bytearray(b'CCTGTGTTtaggcctaatactaagcctaag')
In [59]:
extract_repeat(reps[2], genome)
Out[59]:
bytearray(b'cctaagcctaatactaagcctaagcctaagactaagcctaatactaagcctaagcctaagactaagcctaagactaagcct')

Let's specifically try to extract a repeat from the DNA/CMC-Chapaev family.

In [68]:
chapaevs = filter(lambda x: 'DNA/CMC-Chapaev' == x.rep_cl, reps)
In [69]:
[extract_repeat(chapaev, genome) for chapaev in chapaevs]
Out[69]:
[bytearray(b'cacggcccggcggggggtacatggatgagaattctctaccgtattccaatttggctgactgcgtgctcaacgttgaatactcagtgtaaactttcgtacaccgttgcgtactgcacagcgcgcattttaattgacgacatttagcaaaaattgaacataagatttttcggaattatgaagctcaattttcacaaaaataatgagttttttgtagaatttatgaaaaaacgtgaatatatagattttttgttcatgatattcaagaaaaagcgatttttagttcttcacagaggaatcctctcgcatttcacttgctcatgatgttttttgctccactttaggacgataaaaatgcgaattgttgataaaatgaatgaataatataaaaa'),
 bytearray(b'ggggctgctgaaaccaatgtcggcatgatgagagttccggtcttctgaatccatttcctgcgtgggctgtggcgacgagctgcacgtctgaaaatcaagtttttgtaatt'),
 bytearray(b'tttgggcgcatgatatggagctgaatcattcgattttagaatcagcatgcttttattcatattttaggatctttttaaaaaatctggaccaacagttttcgaaaaaatttaatttttgttcagaaatgtgaatattcactaaatcgaaaaaaataattgcaaaatccgtcagctgaacattcaaaacttatcaatttgaaatcagcatatttcagtgtataattaaaaaagtttcaaaaattctgagaccaatttttattgagaaaaataatttttcgctcgaattattgaattttcactaaatgcaaaaaacagtaaacttgggcccatgctacaagcctgaatctttcaaattaagaaccagcatgattttttcaatattctaggacgtttaaaaaaaatctggaccaacagtttttgaggaacgtaattttttatacaaaaatgttctgatttttcactaaactcaaaaaaatagtcaagttgggcccatgctgtacacctaaatcattaaaattcagaaccgccatgtattttttcttaccaaaggctctttaaaaaaaatctggaccaacagtttttgagatatttagaaaaacaactcacttttcgacgtttttcgccttttcgtggctcacccggttgatttttgcggcgatttgtggtctttcgctgaaaatattatttttatttcaattattaacgaagaaaacaagaaaaaacgacgagaaaacatcaaaaaaacgcgaaaaaacatcgaaaaaccaccgcaacctcatgaacaaaaaaaaagcattgcagccgcgggactagttttcgcaactttctaggccatgtcccgttcgccgtgccgtg'),
 bytearray(b'cacggcccggcggggggtacatggacgagaattctctaccgtattccaatttggctgactgcgtgctcaacgttgaatactcagtttaaagtttcgtacaccgttgcgtactgcacagcgcgcattttaattgacgaaatttcgcgaaaattaacagaagatttttttcggaattatagagctgaaattgaaaaaaaaactatcaaattttcatcgaatttgtgaaaaatcgtaagtatgaagatcttttcttcactatattcaaggaaaatcgatatttcgcttttcacagacgaatgatgtctcattttactcgatgaaagtttctgatgagctgtttttatcgatttttgagcgataaaaatgcgatttgttgataaaatggatcaattatataaagaaacaacatatattgctctgagattactttttgagaatcaattctttatttttcggtcattttaaattaagcattaaaataaaaatattagaaatcataataaaaaaaacagaaaatcgatatattactttttcttcggaatttcacgacttttttggacgaattttattctgtaaactttcttcttcgaatttgtgtccacgtggctttcagtcgaagaagattctgcagcactccttcttgcttgcccacaacttactcgaattttctaaaatttttaacttattgaaattgtcatttcacctttacactcacttcagctaaactattactgcatttcggaagttgataggatactggtggagcaacaagtggatggcttctagtgattggctggcttgtcgagcaagtttgtgtgattgcctgaaataatttttgatttcaattttgagttgatttaaagcagtgaacctaccaccgggttcggacgagaaagagcattactcggtagaccacggaatccaattttcgttgaattgcctccaaatgcaatagaagtttgtacgttttgtgagaagtcgggctgaaaattttcaaaatttgaaacttttcgagaaaaataaaaatctcaccacagcatttcgagattttgtcgattgtggaagccttttcctggagcgaaaattgattttttttttcgctaaattttttcttttttgggcagccgtgacgtcccgaataactgcttttgggtcccgaagatcattttgcgaagaaattggcagaactgttgcatcttttggtacgatggaaagaccgggaatggacgtgttctgaaatagttgtgtttttaagaatgcagaaatgtttttctgtaccaaaattaccatagtcatgtcattcatgatgttacgacacatgagctctctcagaacatggatgtaacgccttttcttgtcccggtaattgcaaaatctcctctcaagtgcattgaaaatcgcgtggacagattcaactccttgttctgtgatccttccaatgtttctcacatcttttgccatttgtggtgcatggtagaccaacaagtgcagctttaaaataattgtttcttcgggaaccgctactttcaaatcctccacaaatccgcgaatcgaattttgaagtattaagacgtcggaatcatttaaaaacttgtttcccgaaagtgacataatagttgaaagctttcccattgctgatttcaatccgagcaacattgggcataaatttgggccaaaaatgttgaaagtctcctctacaacagccggcgttagcagcaatttcaaatggtttccgcaaaatgattggaaccaagcctgcttgtccgctccaaacttagcccaacactgtcccattttttcaagtgttccttcgggagtaccattcacaattgtatcgagcaacaatttttccgattgaagtgctttcagttcagcatgcgactccaatttcatctttccggtggctccttgatacttttcttccgcacttttaattaggttaacagcgttttttagagttgcttttcgtgttttcaggataggaaaagaagtagtgttatccaaagtatcagaatatttccagaggggattgaagatatatttgtcaaaaatacccatgataatgtgcagaagaggaatcaaatagaacatgatcgcaacgtgtggcagaagtggagtacatcctttgcgaacacccaagtcgccattttcacaacaagctttgtaaagatcgattgttcgtgggtggaatgtttcatcaacattcatatccttgattttcatcctctcttcagctccccgtggattctgtgcaaaacatttgaagcagaaattgtgggatgaatgtccttggtgtccaagaatatcagattgaaacttgcaatctccagttgcaatttgcacaatttttgcggttttttgaactcctttgtccaaatatcaaattttcgttagcttgccaagctgctcaagaacgtccggaatgaattttttcagagacgaataattgtcggatccgtcatatactgcaattaccataacgtgtctcgaagaattcggtcgagatacgtttccgattaccaatgccaactttgtgcttccacctccagcgtcaccaacgactccaatcttgattactcctttcgtgtatccgtcgtccacaaattgatttgaattgcatagaagctctattcgataggctaaaacttctgcaattttcatgcactgcacaatggtaatcacttttcctttattgtcgaacgaagtggaaactttgaaactggagatcattgataactggattgacaaatctcttgtgttctttaccgatggaagcaaatcatagccaatggcattagtcaaatagtttttgattttttccatctgacttagagataatccgcattttgataaaaagtcaacggcctcaaagtttgaaagcttgtttttgtagctttgattctcttctgaattcaggaattttgtgaattttcgaataaattgtccgacgtcatcctcgaggcagatttcgtgttgaagcaagtgaagagctttgcgaaatcgatttttgatacaacttttgcttcttagattcgaaatattaactttaaaagctgattttttaaggttttcaacttcttcggcgtgtctttgtagactcagaaccatagctttgccacttttcttcacatctgcacagcttctcaccaatcgaccttctataccactgacgatcgttcgtatattgcatacttccatttgcagcgaagaattagatgctcttatagtgatattttcatggcggactatttgcatttcttccgaaaacaccgcaaactcatcaatccgcttttgtatttcttctgatatttcatttttttcatttttcagtcgttcgatcgttagtcggagcattttgatctgcggaatttgctcaacattggagattattcgaaccctcggtgtactgaacgagtttcgtaaaggtgtcggtggaaatacgggattggagaatctcagcaaaatcatataatattagttttgaaatattgaaaaaaattacattgtgagaaaaagtcggaatttcgtcactaaaatccatttccacgtctctcgtcagaattccttcatccatattgaaacaatttgacgacctgcatgtagttgcggagctactggaagcaatgtcgggatggtgggagtttcgatcttctgaactgatttcctgattagcctgtggcgacgagctgcacgtctgaaaatcacgtttttgaagttagaacaaactactccaacttaattaaagttgacaaaattgagctgaacgaacctccactttcgaattgttcagttcttcctcttcagtttgatcttttgaaactccattagcactgttccttgctctctgggcatttgctaaaagaaggcctgcacaagatttttcttttcttttttgtttgaagtatacttttgtcatctggaaatattgcatgaatattataagggaaacaatttttaaatatcgattttcacgaaatttgaaaaaatcaataatttgggcgcatgatattgagctgaatgtttcgaatttagaatcagcatgcttttattcatattttaggatctttttaaaaaatctggaccaacagtttttgaaaaaaaaatacttttcgttcagaaatgtactgattttccactgattttcacgaaatttgaaaaaatcaataatttaggcgcatgatattgagctgaatgttttgaatttagaatcagcatgcttttattcatattttaggatctttttaaaaaatctggaccaacagttttcgaaaaaattcaatttttgttcagaaatgtgaatattcactaaatcgaaaaaaataattgcaaaatccgtcggctgaacattcaaaacttatcaatttgaaatcagcatatttcagtgtataattaaaaaaggtttcaaaaattctgagaccaatttttgttgagaaaaataatttttcgttcgaattatcgatttttcacgaaatgccaaaaacagtaaacttgggcccatgctaaaagcctgaatctttcaaattaaaaaccagcatgattttttctatattctaagacgtttaaaaaaaatctggaccaacagttcttgaggaaagtaattttttatacaaaaatgtgctgatttttcactaaattcaaaaaaataatcaagttgggcccatgctatacacctaaatcattaaaattcagaaccgccatgtatgtattttttcataccataggctctttaaaaaaaatctggaccaacagtttttgagatatgtcaaaaaaaacaactcactttttgacgtttttcgccttttcgcggatgatgcggtcgatttttgcggcgatttgtggtctttcgctgaaaatattatttttatttcaatttttaacgaagaaaacaagaaaaaacgacgagaaaacatcaaaaaacacgaaaaaaacgtcgaaaaactcccgcaacctcatgaaaaaaaataaagcactgcagccgcgggactagttttcgcaactttctaggccatgtcccgttcgccgtgccgtg'),
 bytearray(b'acgtggctgaagaaatttctacagtagtcccatttggctgactgaatattcaacgcgaataagttttgtacactattgcgtactttgcgtacgcgcattttatttgacgacaattcgtcaatatcagc'),
 bytearray(b'aattcctaaattttttattaaaatcgaaaaaaaaaaatgaaatacgtgagattgagtttcgagacttttttattcagaatcagcatatatttctccatatttgagtaggttttcagaaatattgtaccataatttttggaaaaatgtaatttttaattcgaaattgcactgaatttctcgaatttttcactaaaatcgagaaaataaatatgaaatacgcgagattgaggttcaagactttttaattcggaatcagcatatatttttccatatttgagtagattttcagaaatattgtaccataatttttcgagatattttgaataataacttacttttcgacgttttttgcctttgtccggtttaatccatcgaatttcgaagcggtttgcgtagattagctgaaaacattatgcttattccacgtagtaacaagaaaaaacaagaaaaaataagaaaaaacgaagaaaa'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcagttaata'),
 bytearray(b'cacggtatcacaaaaactagatctctcgtaaaatttgagaaagatctcgcaggtacgcagtgaaatggtccgcaatgtgtcatcgcggtgtttgcgtacttgcgtaccgtagtccgcaaaacattgcagcggcaaatagatttttgaagcaaattttagcagaaaaaaggcagaattaatagtttcaaggtgaaaaaaaaaataaaaaatagattttattattcaatttagtagctaacaattgagaattgaattattgaaacacagaaaaattaattttgaacagtaaaacaaagaaataatcgaaacggaagattgaaaattgaaaaatacatacaaatcgattcaaaaaacgaatttaatatgtggaatcagcctccttcttcgctttacggatgcaagttgaaatttttcttggtaaaactttcgaaaataaggaaacccggtgaaatttcttaattgcctcgactcctggtgaactttttgagataaatccatcgaaattttgctgagtagctcattgacaaggtttcaatctgaaatttcataaaatcaattattttcgaataattttaatcccaacaaaccgaaggaaatcctgaattttagcttttcgatagaatcctaaggtgtcacatcgacaattttccaagttgaaagaaaccatgtggagcatctccgcttataatatcctcgacaaaatattgatgagaaatccatcaaatttgcaccgagtatctgcttgtcaatgtttttacctgaaatttaatgaaattaataattttttaataattttaagcacaactaaccatagaaaatcccgaattttatgatattgaggaaatcccgaaattttaattgcgaaaaggttcagaattgtgtgagggagagcgctgggtggtttattgggaagacgaggcgtcctgcaaagaaaatgttacgatttgtttttttgaaaggttccacttacttcctccatatcagaaattagattgctacatgacagctccttagcaatgtacaggtatcttttccctgtgtttctaaccgagtggaagcgtctttcgaggcgattgaaaacggcatgaagcgattcgattccttgctccgaaagccttcccaaattcctttccgtttttgcgacttctactacgtgagcaaccaggacatgcaatttttgagtgattgattcttctgggtgggcagcttgtaggaattcaacgaattccttcatcgactcatccaattcgctgatgtcatcgtcagagagcaatcgattggccgacaatgacatgattttggacagcctgctcatcgcgttcttgacattcagaagcatcggagtcatgtggtttttcagatttttgaatgcagctgtgacacctttctcagacaaaatcagcttcgtgtgatttccagtgtacatttgaaaccacgctcggcgtgttgcaccaacttcttccagatcattctcaaattgtttaagatatccaccagcaagtccatccagcgtctcgtccaataacactttttcttctttcagagcagtaaactgtgctttcatctctctttttctcttaagtggtgaagcttcgaattttttgttcgcgtcttgaatcttcaaatcggcaactctttttgtctcttctttatttcttcgaatttcaaatgatgttttattgtctaaactcacaacggccatccaaatcggctcaaagatgtatttcgtgaacagtccgacaatcaagtgtagcattgcaggcaagtagtgttccaacttgacattttgaagaattggtccacttccgcatctgacgccaaagctaccgtatttagaattgagcttgtaagaattcattgttttcaagaaatatatcttttgcaagttcagatctttaagcttttgcatcagtcctcctcttggattggtttcgaaacaaaacgggcaaaaataggtggcacattgttttttatgtgacagtaaatcacatgtaaacttaaaatcaccgactactttttggacaacgccacgtgtcaccacccttccatcttccatataggtgatgctggtgaagttgttgatcttcacgataagatcagacaggtaggccatgataagttcccgcgaatcagagtcatcaaaaacagcgagaaggacgattcggtgcggcgagttcgcatgatcacaatttccgatcagaagacaaagtttcgtcgttcctcctcccgaatctccaccaattccgataacaattttgccatcggtataggaatcatggcgtaattgttttgatacagacaaacgctccagcttcggaatgacacttttctcgacatcgataattttgacaacggtcaccttttctccttttgatatatatgttgtggccttataattgtcgatagttgacattctcgttttccgttgcatcgtcaaattaatagttggcatgatttcaagatcggtgaacatcttatagttttgcttcacccgccgcaattgattgttagagaatctacatttttcttgaaaaataatcgtttgccaatgcgtcaattggacttggaaggactgcgaatcattttgttggagatatttctggaaatcaatcatgaaattacgaatatcctcttctcgactgattcgttgaagcaaatccagtgccaaatctatcctagattttccagagaacgattccttcttcgcaactctgatatccatattattctgtactttttcgcccttgacgtaatttgagcgatttgttttcttaatatcagattttcgttggttttccgttttgatgtttttcttattgaaattatctctttcctttgcatgaaaaattcatcagaaaaaacggcaaactcgtcgtctctctccatcaaccgatttagaagtgtctcttcgtcaatgtctgttcttggattgagctggaccgaatggtttgagctggacaggatggcggttctgaaatggaaaattgaataaacaatcaacaacaaagaaataaatctacctctgatatgctatccaaaatggaatcaacttctagaaatctcattcgttctctactcaagtcttctctaattcccttcacatatggtgtctcattcgaaaacacgccgacgctgtcactcgatgaatagagtggacttgacgatctttcaaaagagtgtggtgttcttggaggtgatgaagaagattccgcaatagaagaagttgatggttgtgtgtcgaacggctggaaaaattatttttaaaatattataatcgtcttaggatccgagttgtagcatggattaattcacttacaatatcagtttcaggtgttattgtcagattcaaatcgatattgcgtttcgactccacatccagattatcatcaaaatccacaaatggagacactcgtcttctctcaggagtgatctgcgcatctccgtttctgtcaagagcttctgtcaattctacattcgacaggtttaggtccagggaagcatttctttcagtatttgaattttcgtcttcttcatcttttttccatcgtcgtttccgagcatttagaagatttgaagaccatgctgattgatttgatggaggaggcatctgaaaaaaaaattttttactcaattttcagtgaaaaaaatttacttttggaaaattttaagtgaaaaatgtacgatttgtgtatatgtttgcctttatcttgtagagaatttttagctgattctaattcggcaataaaaataaaacattttgtgatttttttcgaaaaaaatcatttttcctccattttcagtgcaaaattttagtttcgaaaaaattttcttgaagaatgtacgatttctaaaaaattctctctgtatcttgcttaaaattaacagttctttctctttgaagcaaaaaactaacacattttgtgatttttttggcaaaaaaaattattttataaattcttattacaaaaaaaaattttttcgaaaaaattttaatgaaaaattaagatttctctatgaattgagttccatcttatacacaattaaattttgatcataaaacaactataaatcgtaaagagtttttgattttcttgaaaaagggaacgtttttaaaaactattttcagtgaaaaaaatttacttttggaaaattttaagtgaaaaatgtacgattcgtgtatatgtttgcctttatcttgtagagattttttagctgattctaattcggcaataaaaatataacattttgtgatttttttcgaaaaaaatcatttttcctccattttcagtgcaaaattttagtttcgaaaaaaaaattaatgaagaaggtacgatttctaaaaaattcggcccgtatcttgttcagaatttttagctctctctttttcaatcaaaaaaataaaatattttgtgattttttaagagaactcgtcaaaaaactcacttaattcgttttcctttctgcccacgccgacgctcctttgttttcctcgaattttttcgcttactacctgaaacaagacacactttttcgattttacaaaaaaaaataacaaaaaagatacggaaaaacggttaaaatcggcaaaaaacggagagaatcgatgccgagtgaaaggcttgaaatttaaacaattgttcgcaatagagcgtgtttgcctccatctagagattgaaccaccgtg'),
 bytearray(b'tgctgaaaattgctgaaaatcgaaatttcgtcagctgatgtcgattattctgcgcgggggtacggtacgcaagtccgcaaacactgtcacgccaaattgcgga'),
 bytearray(b'cacggtagcacagaaactagatctctcgtaaaatttgagaaagatctcgcaggtacgcagcgaaatggtccgcaatgtgtctcgcggtgtttgcgtacttgcgtaccgtagtccgcaaaacattgcagcggcaaatagatttttgaagcaaattttagcagaaaaaaggcagaattactagtttaaagtgaataaaattaaaaaaaaaagattttattattaaatttatcaactaacaattcaaaattaatgtattaaaacacagaaaagttgattttgaacagaaaaacggagtaatcatttaaaaagacaatattaaagtgaaaaaacacgcaaatcgattgaaaaaacgaatttaatatgtggaatcggccttctttttcgcttttcggctgcaagttggaatttttcttgggaaaaactttcgaaaatgaggaaatcagtgggaacttcttaatttcctcgactcctggtgaactttttgtgttaaatccatcgaaattgtgcggaatagctcattgacaaggtttcaatctgcaatttgatgaaattctatatttttaaattattttaatcacaacaaacctgaggaaatcccgaattcgatcctttcgataaaatccagagatgtcactttgccacttttccaaaatgaaggaaaccatgtggagcttctcagctttttgagttcctggccgaaatcatgatgaaaaactatcgaaattgacttgagcagcttcttggcaaggtttttgtctgaaattttaagattttaatgatttttgaacgtttttaacacaacgaaccaaaggaaatcctgaatttcacatttctgactgtttcctgggatgttacatcggcagttttccaaaatgaaggacatcatgtagagcatctccacttattgaaattctggtgaagttcttgccgacaaatccatcgacattacgttgaacgtcttctaggcaaggtgtttatctgaaaattcatga'),
 bytearray(b'taagcagtttttgaaaagttttcgaaaaaaaAAAGAATTTCCGTTTTTTGAGATttaattttcagtgaaaaaaatttacttttggaaaatttcaagtgaaaaatgtacgattcgtgtatatgtttgcctttatcttgtagagaatttttagctgattctaattcggcaataaaaatataacattttgtgatcgttttcgaaaaaaaaatctttttctttatttttagtgcaaaattttagtttcgataatttttctatgaagaatgtacgatttctagaaaattctgcctgtatcttgctcaaaattaacagttctttctttttaaagcaaaaaattaacacattttgtgattttttggcaaaaaaaattattttataatttcttatttcaaaaaattttttttcgaaaaaatcttaatgaaaaattaagatttctctatgaatttagttccatcttatacaaaatttaatgctgatcataaaacaactataaaatgtgaagactttttgattttcttgaaaaatggaacgtttttaaaaactgttttcagtgaaaaaaatttacttttgaaaaattgtgaaaattgaaaaattgtgaataagtgaaatatgtacgatctctcaataattttgtcttcatcttgtagagaattgttagctgtttctgattcggcaagaaaaatacaacattttgtgatcgttttcgaaaaaaaaaatttttttcttaatttttagtgcaaaattttagtttcgaaaaaaaatttatgaagaaggtacgatttctagaaaattctgctcgtatcttgttcagaatttttagctctttctttttcataccaaaaaataaaatattttgtgattttttaagagaactcgtcaaaaaactcacttaattcgttttccttgccgcccacttcgacgttcctttgtttttctcgaattttttcgcttactacttgaaacaagacacactcttttgattttacaaaaaaaaattacaaaaaagatacggaaaaacggttaaaatcggcaaaaaacggagagaatcgatgccgagcgaaaggcttgaaatttaaacgattgttcgcaatagagcgtgtttaccgccatctagcgactgaaccaccgtg'),
 bytearray(b'cacggtggttcagttgctagatgggtgcaaacgcgctccaccgaacaa'),
 bytearray(b'cacggcccggcgaaagagacgtggccgcgagagctgcgccggctaggccaccgcctcctatggttaagatttttgaacgaataaacatttttaatttggctgctaagctcatttatctttgttttttctcgttttttctcatttttatcgataaaaatatattttttgttgcagaaaatcacaaaaccgcggcaaaacagcactcaaccgccaactgggaggaggaaaatccgaaaaaagagtttttt'),
 bytearray(b'tgcgaaaaactgtttaaagtatcgattttcttcaatatcagcaacatacaatcctttaaaatgattattttttgtaaattcgataaaaattcatttatttttcacaacttctgcccgaaaattaccgaaataaccagcgtttctataactaagaaagtgtcgtcaattaaaatgccgcgtccgcaaaatgtcgtacgaaacttttcgctgagtatcaaacgttgaatattcagtcagccaaattttactacggtagagattttacagccacgtacggttcgccgggccgtg'),
 bytearray(b'ttgttcggtggagtgcgtttgcacccatctagcaactgaaccaccgtg'),
 bytearray(b'tttttcgtgtttttttatgtttttttatgttttttcgtcgttttttcttgttttcttcgttaataattgaatttaaaataatattttcagtaaaaggacttaaatcgccgcaaaaatcgaccgcgtgagccgcgaaacggcggaaaacgtctaaaagtgagttgtttt'),
 bytearray(b'aaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaactcaacacattttcgatcatttttgaacaaaaaaattgttttctgaaaaatttgacgcttaatttttttgaaactgcactcaaatatgaagaaaagcatgattaaccagaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacactttttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttattttttttgaaactgcactcaaatataaagaaaaacatgcttgttctgaattagtaagaattgcgactcaagctcgcgtatctcatatttatttgttcgatttcagtggaaaatcgacacatttttgggaaaatttttttttttcgaaatattcgctcctaatttttaatgatttccagatgaca'),
 bytearray(b'tctctatattattcattcattttatcaacaaacttctatcgccctaacgtcgatcaaaaaagctcatcagcaactgccgtcgagt'),
 bytearray(b'tctcgtcgagtgaaatgcgatagaatttgtctgtgaaaaaccaaatatcgattttccttgaatatcgtgaagaacaaatcttcatacttacgattcttcacaaattcgatgaaaatctgatagttttttcaattttagctctataattccgaaaaaaatcttctgttaattttcgcgaaatgtcgtcaattaaaatgcgcgctgtgcagtacgcaacggtgtacgaaagtttacactgagtattcaacgttgagcacgcagtcagccaaattggaatacggtagagaatcctcgtccatgtaccccccgccgggccgtg'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'ttgttcggtggagcgcgtttgcacccatctagcaactgaaccaccgtg'),
 bytearray(b'cacggtggttcagttgctagatgggtgcaaacgcgctccaccgaacaa'),
 bytearray(b'gttttttcttattttttcttgtttttttttgttactacgtggaataagcataatgttttcagctaatctacgcaaaccgcttcgaaattcgatggattaaaccggacaaaggtaagaaacgtcgaaaagtaagttattattcaaaatatctcgaaaaattatggtacaatatttctgaaaacctactcaaatatggaaaaatatatgctgattccggattgaaaagtcttgaacctcaatctcgcgtatttcttattgagtttctcgattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaagaattatggtacaatatttctgaaaacccactcaaatatggaaaaatatatgctgattctgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttagtttctcaattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaaaaattatggtacaatatttctgaaaacccactcaaatatggaaaaatatatgctgattctgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttagtttctcaattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaaaaattatggtacaatatttctgaaaacccactcaaatatagaaaaatatatgctgattctgaattagtaacatttgaaactcaatctcacgtatttcataatttttttttcgattttaatgaaaaatatattcagtgcaattttcgattttttttcaaaa'),
 bytearray(b'gctgatattgacgaattgtcgtcaaataaaatacgcgtacgcaaagtacgcaatagtgtacaaaacttattcgcgttgaatattcagtcagccaaatgggactactgtagaaatttcttcagccacgt'),
 bytearray(b'tgtgggctacggtagtcaagtacgcaaacaccacgagcattttcacaattgcgtacaaaatttttttcaagcttt'),
 bytearray(b'tattaattgctaaaatttatgtggactacggtagtcaagtccgcaaacaccacg'),
 bytearray(b'ttttgaaaaaaagttactttttgttcgaaaatgtattgattttcacttattttcactagattcaaaaaaa'),
 bytearray(b'ttggacccatgctatactcaacatttttttggaattctgaatcagcattctcttcataaattagacaatttctaaaaaatctggaccaa'),
 bytearray(b'ttttccggtgatttgctaaaactataatttctatttcaattattaaccgagaaaaccagaaaaaa'),
 bytearray(b'ttgttcggtggagcgcgtttgcacccatctagcaactgaaccaccgtg'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcagttaata'),
 bytearray(b'tattaattgctaaaatttatgtggactacgatagccaagtccgcaaacaccacg'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcagttaatacttcccggtttcgttttacatgataatatcgttgaatttaagcaaaaaatgcagcattagtttcatgaaaaaaaaaataagaga'),
 bytearray(b'atttttcctcaaaaactagaatttttcattgaaaaatggcttaaaaatcgatttttgttcgaaaaaa'),
 bytearray(b'aaggttttcatcgataaagtcacgaatttgtcgaaatgctttggtgagttttatctttttcagaaaaaaaattcgaaaattttcag'),
 bytearray(b'cacggtggttcagttgctagatgggtgcaaacgcgct'),
 bytearray(b'attgttcggtagagcgcgtttgcactcatctagctgctgtaccaccgtg'),
 bytearray(b'agaaatttctacagtagtcccatttggctgactgaatattcaacgcgaataagttttgtacactattgcgtactttgcgtacgcgcattttatttgacgacaattcg'),
 bytearray(b'ttttggaaaaatttaatttttaattcgaaattgcactgaatttctcgaatttttcactaaaatcgaaaaaaaatatatgaaatacgcgagattgaggttcaaggcttttcaattcggaatcagcctatatttttccatacttcaatgggttttcagaaatattgtatgtgaatttttggaaaaatgtgatttttaatttgaaattgcactgaatttcttgaatttttcaataaaatcgagaaaataaatatgaaatacgcgagattgaggttcaagactttttaattcggaatcagcatatatttttctatatttgagtgggttttcagaaatattgtatgtgaattttttgagaaaa'),
 bytearray(b'tttttcgaaaagtgttggaccagatttttttgatcttagaatatgaataaaagcatgctg'),
 bytearray(b'caaggcccggcaaaccgtacgtggctgcaaaatctctaccgtagtaaaatttggctgactgaatattcaacgtttgatactcagtgaaaagattcgtac'),
 bytearray(b'cacggtggttcagtcgctagatggcggtaaacacgctctattgcgaacaatcgtttaaatttcaagcctttcgctcggcatcgattctctccgttttttgccgattttaaccgtttttccgtattttttttgttatttttttttgcaaaattgaaaaagtgtgtcttgtttcaggtagtaatcgaaaaatttcgaggaaaacgaaggaacgtcaccgtgagcagcaaggaaaacgaattcagtgagttttttgactatttctctctgaaaaaattaaaaaatgtattactttttgattgaaaaagaaagagcaaaaaattctgaagaagatgtaacttaatttattcagaacaaaagttttttttgtctcgaaattacaatttttcgaccaaaaatagaaaatgatcattttctcgaaaatgaatcccaaatttatgtcagttttttatgaaaaaataatcagcgtaaacttctgtactagaaatactaccttttttttggattgaaagtttgtatcgtgctcaaaattttaaaagtaaaattattttacgctgaaaaatgcaaaatcataactttttttgaggagaaacccccaaatgttatcgattttgttatcaaattgaactcagcttaaaattatctacaagatgaagctaaattcattgaga'),
 bytearray(b'atattaattaagttttttgtatcaaattgtgtgttttctcaattttatattgcctttttatttcataactttccttttctgttcaaaatcaacttttttttgtgttttaacacttcaattatcaattgttagtttataaatttcataataaactctgattttttattttttttcatcttgaaactattaattctgctgtttttctgctaaaatttgcttcaaaaatctatttgccgcttcattgttttgcggactacggtacgcaagtacgcaaacaccgcaacgacacattgcggaccatttcgctgcgtacgctgcgagatctttctcaaattttacgagagatctagtttctgtgctactgtg'),
 bytearray(b'cacggcccggcgaaccgtacgtggctgtaaaatctctaccgtagtaaaatttagctgactgaatattcaacgtttgatactcagcgaaaagtttcatacgacattttgcggacgcggcattttaattgacgacactttcttagttatagaaacgctggttatttcggcaattttcgggcagaaattgtgaaaaataaatgaatttttatcgaatttacaaaaaataataattttaaaggattgtatgttgctgatattgaagaaaatcgatactttaaacagtttttcgca'),
 bytearray(b'aaaaaaaactcacttttttcgaattttcctccttccagttggcggttgagtgctgttttgccgcggttttgtgattttctgcaacaaaaaaaatatttttatcgataaaaatgagaaaaaacgagaaaaaacgaagataaatgagcttagcagtcaaattaaaaatgtttattcgttcaaaaatcttaaccataggaggcggtggcctagccggcgcagctctcgcggccacgtctctttcgccgggccgtg'),
 bytearray(b'ttttcttcgttttttcttattttttcttgttttttcttgttactacgtggaataagcataatgttttcagctaaactacgcaaatcgcttcgaaattcgatggattaaaccggacaaaggcaaaaaacgtcgaaaagtaagttattattcaaaatatctcgaaaaattctggtacaatatttctgaaaacccactgaaatatggatatgctgatttcgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttattttctcgattttattgaaaaatttgagaaattcagtacaatttcgaattaaaaattaaatttttccaaaaattctggtacaatatttctgaaaacccactgaaatatggaaaaatatgctgatttcgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttattttctcgattttattgaaaaattcaagaaattcagtgcaatttcaaattaaaaatcacatttttccacaa'),
 bytearray(b'gctgatattgacgaattgtcgtcaaataaaatgcgcgtacgcaatgtacacaatagtgtaaaaaactttatcgcgttgaatattcagtcagccaaatgggactactgtagaaatttcttcagccacgt'),
 bytearray(b'acgtggctgaagaaatttctacagtagtcccatttggctgactgaatattcaacgcgaataagttttgtacactattgcgtactttgcgtacgcgcattttatttgacgacaattcgtcaatatcagc'),
 bytearray(b'aaaatgttgaagagaaaccagagaaattgatcgagtagattcttggcaagttttgaaattatatggttttaataagttttgaacatttttaaatacaactaaccatgga'),
 bytearray(b'ttgtttggtggagcgcgtttgcaccaatctagcaactgaaccaccgtg'),
 bytearray(b'tttttttaaatttttttcttggctgctttactgatgtttttttctcaattttttcttgttttctttgttactaatttaaattaaaaaaactattttcagcttatcacagcaaatcggagcgaaactcgaccgcgataacaggaaaaagtcgaaaagtgagttttttgccaaaatatctcgaaaaactcatattttgttttgaaaacagatgcaaataaaaagaaatacat'),
 bytearray(b'atgtattaattgctaaaatttatgtggactacggtagtcaagtccgcaaacaccacg'),
 bytearray(b'tttcgtaatgtttttttcgagtttttgattgttttttctcatttttttttgtttttctttattattagttaaaatataaaaactattttaagctaatcaacgcaaatcgaggcgaaaaccgatcgcagaaagaggaaaagtcgaaaagtgagtttttttgcaaaaatatttca'),
 bytearray(b'acgtggctgaagaaatttctacagtagtcccatttggctgactgaatattcaacgcgaataagttttgtacactattgcgtactctgcgtacgcgcattttatttgacgacaattcgttaatatcagc'),
 bytearray(b'ttcattaaaatcgaaaaaaaaattatgaaatacgtgagattgagtttcaaatgttactaattcagaatcagcatatatttttctatatttgagtgggttttcagaaatattgtaccataatttttggaaaaattaaattttaattcgaaattgcactgaatttctcgaatttttcactaaaatcgagaaactaaatatgaaatacgcgaaattgaggttcaagacttttaattcagaatcagcatatatttttctatatttgagtgggttttcagaaatattgtaccataatttttggaaaaatttaatttttaattcgaaattgcactgaatttctcgaatttttcactaaaatcgagaaactaaatatgaaatacgcgagattgagattcaagacttttaaattcggaatcagcacatatttttccatatttgagtaggttttcagaaatattgtaccatattttttcgagatattttgaataataacttacttttcgacgttttttgcctttgtccggtttaatccatcgaatttcgaagcggtttgcgtagattagctgaaaacattatgcttattcca'),
 bytearray(b'gcaaacatactcttttgcgaataagcgatttttttgttttttttttttggtgttttccgttttttgcttgttttcaccgtttcccctctttttttttgtttttttttgtcaaatcgagaaagagtgtgtttttttttcaggtgttaaacaagatttgcgagcaaaacgagggcacaccatcgtaagaagcgaagaaaacgagaaaagtgagttttttgaagattcctctttaaaaaatagggaaatgttttagttttgagccaaaaaagaaagagctgaatttttcaaacaagatacatgc'),
 bytearray(b'cacggcccggcgaaccgtacgtggctgtaaaatctctaccgtagtgaaatttggctgactgaatattcaacgtttgatactcagcgaaaagtttcgtacgacattttgcggacgcggcattttaattgacgacactttcttagttatagaaacgctggttatttcggcaatttcgggcagaaattgtgaaaaataaatggatttttatcgaatttacagaaaataattatttgaaagtattgtatgttgctgatattgaagaaaatcgatactttaaacagtttttcgca'),
 bytearray(b'aaaaaactcacttttttcggattttccgcctcccagttggcggttgagtgctgttttgtcgcggttttttaattttctgcaacaaaatgtatatttttatcgataaaaatgagaaaaaacgagaaaaaac'),
 bytearray(b'ttgttcggtggagcgcgtttgcacccatctagcagctgaaccaccgtg'),
 bytearray(b'cacggtggttcacttgctagatgggtgcaaacgcgctccactgaacaa'),
 bytearray(b'tattaattgctaaaatttatgtggactacggtagtcaagtccgcaaacaccacg'),
 bytearray(b'gcgaaattctgcattttgtcgtgagatccgcggtgtttgcgtacttctggggctaccgtaacccggaaaa'),
 bytearray(b'tcgagttttacattgaaaaaaaatggccaaaaatcggagaaaaatgggcaaaaaacggagagaattgatgacaaatcaaag'),
 bytearray(b'tcgagttttacattgaaaaaaaatggccaaaaatcggagaaaaatgggcaaaaaacggagagaattgatgacaaatcaaag'),
 bytearray(b'ccttaaaaggaagaaatttggtggaaaaatacaattttcgctctaaaaaattccgtaaattcgagaatttatgaaaaatactttggttttttat'),
 bytearray(b'gcaaaattctgcaatatgtcgtcaaattcggtgtttgcgtattttcgacgctaccgtaccccgcggaa'),
 bytearray(b'ttttcttcgttttttcttattttttcttgttttttcttgttactacgtggaataagcataatgttttcagctaatctacgcaaaccgcttcgaaattcgatggattaaaccggacaaaggtaaaaaacgtcgaaaagtaagttattattcaaaatatctcgaaaaattatggtacaatatttctgaaaacctactcaaatatggaaaaatatatgctgattccggattgaaaagtcttgaacctcaatctcgcgtatttcttattgagtttctcgattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaaaaattatggtacaatatttctgaaaacccactcaaatatggaaaaatatatgctgattctgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttagtttctcaattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaaaaattatggtacaatatttctgaaaacccactcaaatatagaaaaatatatgctgattctgaattagtaacatttgaaactcaatctcacgtatttcataatttttttttcgattttaatgaaaaatctaagaattcagtgcaattttcgattttttttcaaaa'),
 bytearray(b'gctgatattgacgaattgtcgtcaaataaaatgcgcgtacgcaaagtacgcaatagtgtacaaaacttattcgcgttgaatattcagtcagccaaatgggactactgtagaaatttcttcagccacgt'),
 bytearray(b'actacggtgcgcaagtactcaaacactgcgacgtcagagcgcagac'),
 bytearray(b'tttagacgtatttttcttttctctgctcttatgatcgattttcgcagaggtttttgattatccggtaaatattactagttattctaatttttcattaaaaaattacatcgaaaataacgaaaaaacatcgaaaaacgcgaaagatcaacgaaaccaattcatgaattaattcgaatttataattcagtacaaaagcgattcggtcgcgggactagattttgcaacttcctaggccatttccaatttgcagtgc'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'ggtggttcagttgctagatgggtgcaaacgcgctccaccgaacaa'),
 bytearray(b'ttgttcggtggagctcgtttgcacccatctagcaactgaaccaccgtg'),
 bytearray(b'cacggtgcttcagttgctagatgggtgcgaacgcgctccaccgaacaa'),
 bytearray(b'ttgttcggtggagcgcgtttgcacccatctagcaactgaaccaccgtg'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'gcatggggcgtggccgaaaattctctactaccgtttaccaatttggctaatttgccaatcaacgttgaaaagttttgtacatcg'),
 bytearray(b'cacggcccggcggggggtacatggacgagaattctctaccgtattccaatttgactgactgcgtgctcaacgttgagtactcagtttaaagtttcgtacaccgttgcgtactacacagcgcgcattttaattgacgacatttcgcgaaaattaacagaagattttttcggaattatagagctgaaattgaaaaaaaactatcaaattttcatcgaatttgtgaaaaatcgtaagtatgaagatcttttcttcactatattcaaggaaaatcgatatttagcttttcacagacgaatgatgtctcattttact'),
 bytearray(b'gcctcattttactcgatggaagtttctgatgagctgtttttatcgatttttgagcgataaaaatgcgatttgttgataaaatggataaattatataaagaaacaacatatattgctctgagattactttttgagaatcaattctttatttttcggtcattttaaattaagcattaaaataaaaatattagaaatcataataaaaaaaacagaaaatcgatatattactatttcttcggaatttcacgacttttttggacgaattttagtctgtaaactttcttcttcgaatttgtgtccacgtggctttcagtcgaagaagattctgcagcactccttcttgcttgcccacaacttgctcgaattttctaaaatttttaacttattgaaattgtcatttcacctttacactctcttcagctaaactattactgcatttcggaagttgataagatactggtggagcaacaagtggatggcttctagtgattggctggcttgtcgagcaagtttgtgtgattgcctgaaataatttttgatttcaattttgagttgatttaaag'),
 bytearray(b'gatttaaagcagtgaacctaccatcgggttcggacgagaaagagcattgctcggtagaccacggaatccaattttcgttgaattgcctccaaatgcaatagaagtttgtacgttttgtgagaagtcgggctggaaattttcaaaatttgaaacttttcgtgaaaaataaaaatctcaccacagcatttcgagattttgtcgattgtggaagccttttcttggagctaaaattgattt'),
 bytearray(b'tacgatggaaagaccgggaatggacgtgttctgaaatagttgtgtttttaagaatgcataaatttttttctgtaccaaaattaccatagtcatgtcattcatgatgttacgacacatgagctctctcagaacatggatgtaacgccttttcttgtcccggtaattgcaaaatctcctctcaagtgcattgaaaatcgcgtggacagattcaactccttgttctgtgatccttccaatgtttctcacatcttttgccatttgtggtgcatggtagaccaacaagtgcagctttaaaataattgtttcttcgggaaccgctactttcaaatcctccacaaatccgcgaatcgaattttgaagtattaagacgtcggaatcatttaaaaacttgtttcccgaaagtgacataatagttgaaagctttcccattgctgatttcaatccgagcaacattgggcataaatttgggccaaaaatgttgaaagtctcctctacaacagccggcgttagcagcaatttcaaatggtttccgcaaaatgattggaaccaagcctgcttgtccgctccaaacttagcccaacactgttccattttttcaagtgttcctccgggagtaccattcacaattgtgtcgagcaacaatttttccgattgaagtgctttcagttcagcatgcgactccaatttcatctttccggtggctgcttgatacttttcttccgcacttttgattaggttaacagcgttttttagagttgcttttcgtgttttcaggatagggaaacaagtagtgttatccaaagtgacagaatatttccagaggggattgaagatatatttgtcaaaaatacccatgataatgtgcagaagaggaatcaaatagaacatgatcgcaacgtgtggcagaagtggagtacatcctttgcgaacacccaagtcgccattttcacaacaagctttgtaaagatcgattgttcgtgggtggaatgtttcatcaacattcatatccttgattttcatcctctcttcagctccccgtggattctgtgcaaaacatttgaagcagaaattgtgggatgaatgtccttggtgtccaagaatatcagattgaaacttgcaatctccagttgcaatttgcacaatttttgcggttttttgaactcctttgtccaaatatcgaattttcgttagcttgccaagctgctcaagaacgtccggaatgaattttttcagagacgagtaattgtcggatccgtcatatactgcaattaccataacgtgtctcgaagaattcggtcgagatacgtttccgattaccaatgccaactttgtgcttccacctccagcgtcaccaacgactccaatgttgattactcctttcgtgtatccgtcgtccacaaattgatttgaattgcatagaagctctattcgataggctaaaacttctgcaattttcatgcactgcacaatggtaatcacttttcctttattgtcgaacgaagtggaaactttgaaactggagatcattgataactggattggcaaatctcttgcgttctttaccgatggaagcaaatcatagccaatggcattagtcaaatagtttttgattttttccatctgacttagagataatccgcattttgataaaaagtcaacggcctcaaagtttgaaagcttgtttttgtagctttgattctcttctgaattcaggaattttgtaaattttcgaataaattgtccgacgtcatcctcgaggcagatttcgtgttgaagcaagtgaagagctttgcgaaatcgatttttgatacaacttttgtttcttagattcgaaaatttaactttaaaagctgattttttaaggttttcaacttcttcggcgtgtctttgtagactcagaaccatagctttgccacttttcttcacatctgcacagcttctcaccaatcgaccttctataccactgacgatcgttcgtatattgcatacttccatttgcagcgaagaattagatgctcttatagtgatattttcatggcggactatttgtatttcttccgaaaacaccgcaaacgcatcattctgcttttgtatttcttctgatatttcatttttttcatttttcagtcgttcgatcgttagtcggagcattttgatctgcggaatttgctcaacattggagattattcgaaccctcggtgtactgaacgagtttcgtgaaggtgtcggtggaaatacgggattggagaatctctgcgaaatcatataatataatattagttttgaaatattgaaaaaaattacattgtgagaaaaagtcggaatatcgtcactaaaatccatttccacgtctctcgtcagaattccttcatccatattgaaacaatttgacgacctgcatgtagttgcggagctactggaagcaatgtcgggatggtgggagtttcgatcttctgaactgatttcctgattagcctgtggcgacgaactgcacgtctgaaaatcacgtttttgaagttagaacaaactactccaacttaattaaagtagacaaaattgagctgaacgaacctccactttcgaattgttcagttcttcctcttcagtttgatcttttgaaactccattagcactgttccttgctctctgggcatttgctaaaagaaggcctgcacaagatttttcttttcttttttgtttgaagtatacttttgtcatctggaaatattgcatgaatattataagggaaacaatttttaaatatcgattttcacgaaatttgaaaaaatcaataatttgggcgcatgatattgagctgaatgtttcgaatttagaatcagcatgcttttattcatattttaggatctttttaaaaaatctggaccaacagtttttgaaaaaaaatacttttcgttcagaaatgtactgattttccactgattttcacgaaatttgaaaaaatcaataatttgggcgcatgatattgagctgaatgtttcgaatttagaatcagcatgcttttattcatattttaggatctttttaaaaaatctggaccaacagttttcgaaaaaattcaatttttgttcagaaatgtgaatattcactaaatcgaaaaaaataattgcaaaatccgtcggctgagcattcaaaacttatcaatttgaaatcagcatatttcagtgtataattaaaaaagatttcaaaaattctgagaccaatttttgttgagaaaaataatttttcgttcgaattatcgatttttcacgaaatgccaaaaacagtaaacttgggcccatgctaaaagcctgaatctttcaaattaaaaaccaacatgattttttctatattctaagacgtttaaaaaaaatctggaccaacagttcttgaggaaagtaattttttatacaaaaatgtgctgatttttcactaaattcaaaaaaatagtcaagttgggcccatgctatacacctaaatcattaaaattcagaaccgccatgtattttttcataccataggctctttaaaaaaaatctggaccaacagtttttgagagatgtcaaaaaaacaactcacttttcgacgtttttcgtgtttccccggatgatgcggtcgatttttgctgcgatttgtggtctttcgctgaaaatattatttttatttcaatttttaacgaagaaaacaagaaaaaacgacgagaaaacatcaaaaaacacgaaaaaaacgtcgaaaaactcccgcaacctcatgaaaaaaaataaagcactgcagccgcgggactagttttcgcaactttctaggccatgtcccgttcgccgtgtcgtg'),
 bytearray(b'aaaaaaactcacttttcgactttttcctgtttctgcgatcgggttttgcgtcgatttgtggtaattagctgaaaatataaactatagtttttatattttaactattaataaagaaaacaagagaaaagtgagaaaaaacaatcaaaaactcgaaaaa'),
 bytearray(b'tattaattgctaaaatttatgtggactacggtagtcaagtccgcaaacaccacg'),
 bytearray(b'TGCGAAAAACTGTTTAaagtatcgattttcttcaatatcagcaacatacaattctttaaaatgattattttttgtaaattcgataaaaattaatttatttttcacaatttctgcccgaaaattgccgaaatgaccagcgtttctagaactaaaacaagtgtcgtcaattaaaatgccgcgtccgcaaaatgtcgtacgaaacttttcgctgagtatcaaacgttgaatattcagtcagccaaattttactacggtagagattttacagccacgtacggttcgccgggccgtg'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'cacggtggttcagttgctagatgggtgcaaacgcgctccaccgaacaa'),
 bytearray(b'cacggtggttcaatcgctagatggaggcaaacacgctctattgcgaacaattgtttaaatttcaagcctttcactcggcatcgattctctccgttttttgccgattttaaccgtttttccgtatcttttttgttatttttttttgtaaaatcgaaaaagtgtgtcttgtttcaggtagtaagcgaaaaaattcgaggaaaacaaaggagcgtcggcgtgggcagcaaggaaaacgaattaagtgagttttttgacgagttctcttaaaaaatcacaaaatattttatttttttgattgaaaaagagagagctaaaaattctgaacaagatacgggccgaattttttagaaatcgtaccttcttcattaattttttttcgaaactaaaattttgcactgaaaatggaggaaaaatgatttttttcgaaaaaaatcacaaaatgttatatttttattgccgaattagaatcagctaaaaaatctctacaagataaaggcaaacatatacacgaatcgtacatttttcacttaaaattttccaaaagtaaatttttttcactgaaaatagtttttaaaaacgttccctttttcaagaaaatcaaaaactctttacgatttatagttgttttatgatcaaaatttaattgtgtataagatggaactcaattcatagagaaatcttaatttttcattaaaattttttcgaaaaaatttttttttgtaataagaatttataaaataattttttttgccaaaaaaatcacaaaatgtgttagttttttgcttcaaagagaaagaactgttaattttaagcaagatacagagagaattttttagaaatcgtacattcttcaagaaaattttttcgaaactaaaattttgcactgaaaatggaggaaaaatgatttttttcgaaaaaaatcacaaaatgttttatttttattgccgaattagaatcagctaaaaattctctacaagataaaggcaaacatatacataaatcgtacatttttcacttaaaattttccaaaagtaaatttttttcactgaaaattgaggaaaaaatttttttttcagatgcctcctccatcaaatcaatcagcatggtcttcaaatcttctaaatgctcggaaacgacgatggaaaaaagatgaagaagacgaaaattcaaatactgaaagaaatgcttccctggacctaaacctgtcgaatgtagaattgacagaagctctcgacagaaacggagatgcgcagatcactcctgagagaagacgagtgtctccatttgtggattttgatgataatctggatgtggagtcgaaacgcaatatcgatttgaatctgacaataacacctgaaactgatattgtaagtgaattaatccatgctacaactcggatcctaagacgattataatattttaaaaatgatttttccagccgttcgacacacaaccatcaacttcttctattgcggaatcttcttcattacctccaagaacaccacactcttttgaaagatcgtcaagtccactctattcatcgagtgacagcgtcggcgtattttcgaatgagacaccatatgtgaagggaattagagaagacttgagtagagaacgaatgagattgctagaagttgattccattttggatagcatatcagaggtagatttatttctttgttgttgattgtttattcaattttccatttcagaaccttgacgccatcctgtccagctcaaaccattcggtccagctcaatccaagaacagacattgacgaagagacacttctaaatcggttgatggagagagacgacgagtttgccgttttttctgatgaatttttcatgcaaaggaaagagataatttcaataagaaaaacatcaaaacggaaaaccaacgaaaatctgatattaagaaaacaaatcgctcaaattacgccaagggcgaaaaagtacagaataatatggatatcagagttgcgaagaaggaatcgttcacaaagccgaaacgttgtcacgcttcccaagtataccatcgaatggagcaagctcgaaaataagagctctggaaaatctaggatagatttggcactggatttgcttcaacgaatcagtcgagaagaggatattcgtaatttcatgattgatttccagaaatatctccaacaaaatgattcgcagtccttccaagtccaattgacgcattggcaaacgattatttttcaagaaaaatgtagattctctaacaatcaattgcggcgggtgaagcaatactataagatgttcaccgatcttgaaatcatgccaactattaatttgacgatgcaactgaaaacgagaatgtcaactatcgacaattataaggccacaacatatatatcaaaaggagaaaaggtgaccgttgtcaaaattatcgatgtcgagaaaagtgtcattccgaagctggagcgtttttctgtatcaaaacaattacgccatgattcctataccgatggcaaaattgttatcggaattggtggagattcgggaggaggaacgacgaaactttgtcttctgatcggaaattgtgatcatgcgaactcgccgcaccgaatcgtccttctcgctgtttttgatgactctgattcgcgggaacttatcatggcctacctgtctgatcttatcgtgaagatcaacaacttcaccagcatcacctatatggaagatggaagggtggtgacacgtggcgttgtccaaaaagtagtcggtgattttaagtttacatgtgatttactgtcacataaaaaacaatgtgccacctatttttgcccgttttgtttcgaaaccaatccaagaggaggactgatgcaaaagcttaaagatctgaacttgcaaaagatatatttcttgagaacaatgaattcttacaagctcaattctaaatacggtagctttggtgtcagatgcggaagtggaccaattcttcaaaatgtcaagttggaacactacttgcctgcaatgctacacttgattgtcggactgttcacgaaatacatctttgagccgatttggatggccgttgtgagtttagacaataaaacatcatttgaaattcgaagaaataaagaagagacaaaaagagttgccgatttgaagattcaagacgcgaacaaaaaattcgaagcttcaccacttaagagaaaaagagagatgaaagcacagtttactgctctgaaagaagaaaaagtgttattggacgagacgctggatggacttgctggtggatatcttaaacaatttgagaatgatctggaagaagttggtgcaacacgccgagcgtggtttcaaatgtacactggaaatcacacgaagctgattttgtctgagaaaggtgtcacagctgcattcaaaaatctgaaaaaccacatgactccgatgcttctgaatgtcaagaacgcgatgagcaggctgtccaaaatcatgtcattgtcggccaatcgattgctctctgacgatgacatcagcgaattggatgagtcgatgaaggaattcgttgaattcctacaagctgcccacccagaagaatcaatcactcaaaaattgcatgtcctggttgctcacgtagtagaagtcgcaaaaacggaaaggagctgggaaggctttcggagcaaggaatcgaatcgcttcatgccgttttcaatcgcctcgaaagacgcttccactcggttagaaacacagggaaaagatacctgtacattgctaaggagctgtcatgtagcaatctaatttctgatatggaggaagtaagtggaacctttcaaaaaaacaaatcgtaacattttctttgcaggacgcctcgtcttcccaataaaccacccagcgctctccctcacacaattctgaaccttttcgcaattaaaatttcgggatttcctcaatatcataaaattcgggattttctatggttagttgtgcttaaaattattaaaaaattattaatttcattaaatttcaggtaaaaacattgacaagcagatactcggtgcaaatttgatggatttctcatcaatattttgtcgaggatttcataagcggagatgctccacatggtttctttcaacttggaaaattgtcgatgtgacaccttaggattctatcgaaaagctaaaattcaggatttccttcggtttgttgggattaaaattattcgaaaataattgattttatgaaatttcagattgaaaccttgtcaatgagctactcagcaaaatttcgatggatttatctcaaaaagttcaccaggagtcgaggcaattaagaaatttcaccgggtttccttattttcgaaagttttacctagaaaaatttcaacttgcatccgtaaagcgaagaaggaggctgattccacatattaaattcgttttttgaatcgatttgtatgtatttttcaattttcaatcttccgtttcgattatttctttgttttactgttcaaaattaatttttctgtgtttcaataattcaattctcaattgttagctactaaattgaataataaaatctattttttatttttttttcaccttgaaactattaattctgccttttttctgctaaaatttgcttcaaaaatctatttgccgctgcaatgttttgcggactacggtacgcaagtacgcaaacaccgcgatgacacattgcggaccatttcgctgcgtacctgcgagatctttctcaaattttacgagagatctagtttttgtgataccgtg'),
 bytearray(b'ttgttcggtggagcgcgtttgcacccatctagcaactgaaccaccgtg'),
 bytearray(b'cacggtggttcaatcgctagatggaggcaaacacgctctattgcgaacaattgtttaaatttcaagcctttcactcggcatcgattctctccgttttttgccgattttaaccgtttttccgtatcttttttgttatttttttttgtaaaatcgaaaaagtgtgtcttgtttcaggtagtaagcgaaaaaattcgaggaaaacaaaggagcgtcggcgtgggcagcaaggaaaacgaattaagtgagttttttgacgagttctcttaaaaaatcacaaaatattttatttttttgattgaaaaagagagagctaaaaattctgaacaagatacgggccgaattttttagaaatcgtaccttcttcattaattttttttcgaaactaaaattttgcactgaaaatggaggaaaaatgatttttttcgaaaaaaatcacaaaatgttatatttttattgccgaattagaatcagctaaaaaatctctacaagataaaggcaaacatatacacgaatcgtacatttttcacttaaaattttccaaaagtaaatttttttcactgaaaatagtttttaaaaacgttccctttttcaagaaaatcaaaaactctttacgatttatagttgttttatgatcaaaatttaattgtgtataagatggaactcaattcatagagaaatcttaatttttcattaaaattttttcgaaaaaatttttttttgtaataagaatttataaaataattttttttgccaaaaaaatcacaaaatgtgttagttttttgcttcaaagagaaagaactgttaattttaagcaagatacagagagaattttttagaaatcgtacattcttcaagaaaattttttcgaaactaaaattttgcactgaaaatggaggaaaaatgatttttttcgaaaaaaatcacaaaatgttttatttttattgccgaattagaatcagctaaaaattctctacaagataaaggcaaacatatacataaatcgtacatttttcacttaaaattttccaaaagtaaatttttttcactgaaaattgaggaaaaaatttttttttcagatgcctcctccatcaaatcaatcagcatggtcttcaaatcttctaaatgctcggaaacgacgatggaaaaaagatgaagaagacgaaaattcaaatactgaaagaaatgcttccctggacctaaacctgtcgaatgtagaattgacagaagctctcgacagaaacggagatgcgcagatcactcctgagagaagacgagtgtctccatttgtggattttgatgataatctggatgtggagtcgaaacgcaatatcgatttgaatctgacaataacacctgaaactgatattgtaagtgaattaatccatgctacaactcggatcctaagacgattataatattttaaaaatgatttttccagccgttcgacacacaaccatcaacttcttctattgcggaatcttcttcattacctccaagaacaccacactcttttgaaagatcgtcaagtccactctattcatcgagtgacagcgtcggcgtattttcgaatgagacaccatatgtgaagggaattagagaagacttgagtagagaacgaatgagattgctagaagttgattccattttggatagcatatcagaggtagatttatttctttgttgttgattgtttattcaattttccatttcagaaccttgacgccatcctgtccagctcaaaccattcggtccagctcaatccaagaacagacattgacgaagagacacttctaaatcggttgatggagagagacgacgagtttgccgttttttctgatgaatttttcatgcaaaggaaagagataatttcaataagaaaaacatcaaaacggaaaaccaacgaaaatctgatattaagaaaacaaatcgctcaaattacgccaagggcgaaaaagtacagaataatatggatatcagagttgcgaagaaggaatcgttcacaaagccgaaacgttgtcacgcttcccaagtataccatcgaatggagcaagctcgaaaataagagctctggaaaatctaggatagatttggcactggatttgcttcaacgaatcagtcgagaagaggatattcgtaatttcatgattgatttccagaaatatctccaacaaaatgattcgcagtccttccaagtccaattgacgcattggcaaacgattatttttcaagaaaaatgtagattctctaacaatcaattgcggcgggtgaagcaatactataagatgttcaccgatcttgaaatcatgccaactattaatttgacgatgcaactgaaaacgagaatgtcaactatcgacaattataaggccacaacatatatatcaaaaggagaaaaggtgaccgttgtcaaaattatcgatgtcgagaaaagtgtcattccgaagctggagcgtttttctgtatcaaaacaattacgccatgattcctataccgatggcaaaattgttatcggaattggtggagattcgggaggaggaacgacgaaactttgtcttctgatcggaaattgtgatcatgcgaactcgccgcaccgaatcgtccttctcgctgtttttgatgactctgattcgcgggaacttatcatggcctacctgtctgatcttatcgtgaagatcaacaacttcaccagcatcacctatatggaagatggaagggtggtgacacgtggcgttgtccaaaaagtagtcggtgattttaagtttacatgtgatttactgtcacataaaaaacaatgtgccacctatttttgcccgttttgtttcgaaaccaatccaagaggaggactgatgcaaaagcttaaagatctgaacttgcaaaagatatatttcttgagaacaatgaattcttacaagctcaattctaaatacggtagctttggtgtcagatgcggaagtggaccaattcttcaaaatgtcaagttggaacactacttgcctgcaatgctacacttgattgtcggactgttcacgaaatacatctttgagccgatttggatggccgttgtgagtttagacaataaaacatcatttgaaattcgaagaaataaagaagagacaaaaagagttgccgatttgaagattcaagacgcgaacaaaaaattcgaagcttcaccacttaagagaaaaagagagatgaaagcacagtttactgctctgaaagaagaaaaagtgttattggacgagacgctggatggacttgctggtggatatcttaaacaatttgagaatgatctggaagaagttggtgcaacacgccgagcgtggtttcaaatgtacactggaaatcacacgaagctgattttgtctgagaaaggtgtcacagctgcattcaaaaatctgaaaaaccacatgactccgatgcttctgaatgtcaagaacgcgatgagcaggctgtccaaaatcatgtcattgtcggccaatcgattgctctctgacgatgacatcagcgaattggatgagtcgatgaaggaattcgttgaattcctacaagctgcccacccagaagaatcaatcactcaaaaattgcatgtcctggttgctcacgtagtagaagtcgcaaaaacggaaaggagctgggaaggctttcggagcaaggaatcgaatcgcttcatgccgttttcaatcgcctcgaaagacgcttccactcggttagaaacacagggaaaagatacctgtacattgctaaggagctgtcatgtagcaatctaatttctgatatggaggaagtaagtggaacctttcaaaaaaacaaatcgtaacattttctttgcaggacgcctcgtcttcccaataaaccacccagcgctctccctcacacaattctgaaccttttcgcaattaaaatttcgggatttcctcaatatcataaaattcgggattttctatggttagttgtgcttaaaattattaaaaaattattaatttcattaaatttcaggtaaaaacattgacaagcagatactcggtgcaaatttgatggatttctcatcaatattttgtcgaggatttcataagcggagatgctccacatggtttctttcaacttggaaaattgtcgatgtgacaccttaggattctatcgaaaagctaaaattcaggatttccttcggtttgttgggattaaaattattcgaaaataattgattttatgaaatttcagattgaaaccttgtcaatgagctactcagcaaaatttcgatggatttatctcaaaaagttcaccaggagtcgaggcaattaagaaatttcaccgggtttccttattttcgaaagttttacctagaaaaatttcaacttgcatccgtaaagcgaagaaggaggctgattccacatattaaattcgttttttgaatcgatttgtatgtatttttcaattttcaatcttccgtttcgattatttctttgttttactgttcaaaattaatttttctgtgtttcaataattcaattctcaattgttagctactaaattgaataataaaatctattttttatttttttttcaccttgaaactattaattctgccttttttctgctaaaatttgcttcaaaaatctatttgccgctgcaatgttttgcggactacggtacgcaagtacgcaaacaccgcgatgacacattgcggaccatttcgctgcgtacctgcgagatctttctcaaattttacgagagatctagtttttgtgataccgtg'),
 bytearray(b'cacggcccggcggggggtacatggacgagaattctctaccgtattccaatttggctgactgcgtgctcaacgttgaatactcagtgtaaactttcgtacaccgttgcgtactgcacagcgcgcattttaattgacgacatttagcaaaaattgaacagaagatttttcggaattatgaagctcaattttcacaaaaataatgagttttttgtagaatttatgaaaaaacgtgaatatatagattttttgttcatgatattcaagaaaaatcgatttttagttcttcacagagtaatcctatcgcatttcacttgctcatgatgtttttgctcgactttaggacgataaaaatgcgaattgttgataaaatgaatgaacaatataaagaa'),
 bytearray(b'ggggctgctggaaccaatgtcggcatgacgagagttccggtcttctggatccatttcctgcgtgggctgtggcgacgagctgcacgtctgaaaatcaagtttttgtaatt'),
 bytearray(b'tttgggcgcatgatatggagctgaatcattcgattttagaatcagcaagcttttattcatattttaggatctttttaaaaaatctggaccaacagtttttgaaaaaaaatacttttcgttcagaaatgtactgattttccactgattttcacgaaatttgaaaaaatcaataatttgggcgcatgatattgagctgaatgtttcgaatttagaatcagcatgcttttattcatattttaggatctttttaaaaaatctggcccaacagttttcgaaaaaatttaatttttgttcagaaatgtgaatattcacgaaatcgaaaaaaataattgcaaaatccgtcagctgaacattcaaaacttatcaatttgaaatcagcatatttcagtgtataattaaaaaaggtttcaaaaattctgagaccaatttttattgagaaaaataatttttcgctcgaattattgaattttcactaaatgcaaaaaacagtaaacttgggcccgtgctacaagcctgaatctttcaaattaaaaaccagcatgattttttcaatattctaggacgtttaaaaaaaatctggaccaacagtttttgaggaacgtaattttttatacaaaaatgtactgatttttcactaaactcaaaaaaatagtcaagttgggcccatgctatacacctaaattattaaaattcagaaccgccatgtattttttcatactataggctctttaaaaaaaatctggaccaacagtttttgagatatttagaaaaacaactcacttttcgacgtttttcgccttttcgcggctcacccggtcgatttttgcggcgatttgtgttctttcgctgaaaatattatttttatttcaattattaacgaagaaaacaagaaaaaacgacgagaaaacatcaaaaaaacgcgaaaaaacatcgaaaaaccaccgaaacctcatgaaaaaaataaagcattgcagccgcgggattagttttcgcaactttctaggccatgtcccgttcgccgtgccgtg'),
 bytearray(b'aactagatctctcgtaaaatttgagaaagatctcgcaggtacgcagcgaaatggtccgcaatgtgtcatcgcggtgtttgcgtacttgcgtaccgtagtccgcaaaacattgcagcggcaaatagatttttgaagcaaattttagcagaaaaaaggcagaattaatagtttcaaggtgaaaaaaaaaaaaatagattttattattcaatttattagctaacaattgagaattgaattatcaaaacacagaaaaattaattttgaacagtaaaacaaagaaataatcgaaacggtagattgaaaattgaaaaatacatacaaaacgattcaaaaaacgaattaatatgtggaatcggcctccttcttcgctttacggatgcaagttgagatttttcttggaaaaactttcgaaaataaggaaatcagtgggaacttcttatttcctcgactcctgcaggatcctggtgaactttttctgttaaatccatcgaaattgtgcggagtagctcattgacaaggtttcaatctgaaattttgtgaaattttatatttttgaataattttaatcacagcaaacctagggaaatcccgaattcgagcctttcgataaaatccagagatgtcacatcgccacttttccaaaatgaaggaaaccaggtggagcttctcagctttttggcttcctggtcgaaatcttgatgaaaaaaccatcgaaatttacttgagcagcttcttggcaaggtttttgtctgaaattttaggattttaatgatttttaacatttttaaacacaactaaccataaacaatccggattttttcggttttgactgaatccttggatttatgtagaaaacatgcccagaaatcaaggaacgaggtggaacatctcatttttttgaaattctggtgtaattcttgatgaaaaatccatcgacattacgttgaacgtcttcttggcaaggtgttttcttctgaaaattcatga'),
 bytearray(b'ctgtaacatctaagcagtttttgaaaagttttcgaaaaaaaaataaatttcagtttttgagatttaattttcagtgaaaaaaatttacttttggaaaattttaagtgaaaaatgtaccgtttctgaaaatgtttgcttttatcgtgtagagaatttttagctggttctaatccggcaagaaaaacagaacattttgtgatcgttttcgaaaaaaaaatttttttctttaattttaagtgcaaaattttagtttcgataatttttctgtgaagaatgtacgatttctagaaaattctgcctgtatcttgcttaaaatgaacagttctttctttttaaagcaaaaaactaacacattttgtgattttttttggcaaaaaaaattattttataatttcttatttcaaaaaatgttttttcgaaaaaattttaatgaaaaattaatatttctttatgaacttagttccgtcttatacaaaatttaatgctgattataaaataactataaaacgtgaaga'),
 bytearray(b'cacggcccggcgaaagagacttggccgcgagagctgcgccggctaggccaccgcctcctatggttaagatttttgaacgaataaacatttttaatttggctgctaagctcatttattttcgttttttctcgtttttttctcatttttatcgataaaaatatattttttgttgcagaaaatcaaaaaaccgcgacaaaacagcactcaaccgccaactgggaggaggaaaatccgaaaaaagtgagtttttt'),
 bytearray(b'tgcgaaaaactgtttaaagtatcgattttcttcaatatcagcaacatacaatcctttaaaatgattattttttgtaaattcgataaaaattaatttatttttcacaatttctgcccgaaaattgccgaaataaccagcgtttctataactaaaacaagtgtcgtcaattaaaatgccgcatccgcaaaatgtcgtacgaaacttttcgctgagtatcaaacgttgaatattcagtcagccaaattttactacggtagagattttacagccacgtacggttcgccgggccgtg'),
 bytearray(b'ttgttcagtggagcgtatttgcataaatctagcaactgaaccaccatg'),
 bytearray(b'attgaccaaaatcgagaaacattgcgaaaaactgtttaaagtgtcgattttcttcaatatcagcaacatacaatactttcaaatgattattttctgtaaattcgataaaaatccatttatttttcacaatttctgcccgaaaattgccgaaataaccagcgtttctataactaagaaagcgtcgtcaattaaaatgccgcgtccgcaaaatgtcgtacgaaacttttcgctgagtatcaaacgttgaatattcagtcagccaaattttactacggtagagaatttacagccacgtacggttcgccgggccgtg'),
 bytearray(b'cacggcccggcgaaccgtacgtggctgtaaaatctctaccgtagtaaaatttggctgactgaatattcaacgtttgatactcagcgaaaagtttcgtacgacattttgcggacgcggcattttaattgacgacacttgttttagttatagaaacgctggttatttcggcaattttcgggcagaaattgtgacaaataaatgaatttttatcgaatttacaaaaaataatcattttaaaggattgtatgttgctgatattgaagaaaatcgatactttaaacagtttttcgca'),
 bytearray(b'aaattgtagtcagtatcactgcagatgctggagcaggaatcacaaagttttgtctgattatcgagaattgt'),
 bytearray(b'ttttcgagatattttggcaaaaacctcacttttcgtcgttttcctcctactgcgatcgattttcgccccgatgattagctgaaaataattttatatgttagttagtaacaaagaaaataagaaaaattgagaaaaaacaatcaaaaactcgagaaaa'),
 bytearray(b'cgaattgtcgtcaaattaaatgcgcgtacgcaaagtacgcaatagtgtacaaaacttcttcgcgttgaatattcagtcgcgactagtcagccaaatgggactactgtagaaatttcctcggccacgttccaaacgccgctccgtg'),
 bytearray(b'ttgttcgatggagcgcgtttgaacccatctagcaactgaaccaccgtg'),
 bytearray(b'cacggtggttcagttgctagttgggtgcaaacgcgctccaccgaacaa'),
 bytearray(b'cacggtggttcagttgctagttgggtgcaaacgcgctccaccgaacaa'),
 bytearray(b'cacggtagcacagaaactagatctctcgtaaaatttgagaaagatctcgcagcgtacgcagcgaaatggtccgcaatgtgtcatcgcggtgtttgcgtacttgcgtaccgtagtccgcaaaacaatgaagcggcaaatagatttttgaagcaaattttaacagaaaaacagcagaattaatagtttcaagatgaaaaaaaaaataaaaaatcagagtttattatgaaatttataaactaacaattgataattgaagtgttaaaacacaaaaaaagttgattttgaacagaaaaggaaagttatgaaataaaaaggcaatataaaattgagaaaacacacaatttgatacaaaaaacttaattaatat'),
 bytearray(b'tgcataaattcaatttcatcttgcccagaattttaagctgattcgaattcatatcaaaatctgaagattcttcaattttttttatcgaaaaatttttttttctaaattttgtgaaaaatttt'),
 bytearray(b'tttagcttcatcttgtagataactttaagctgagttcaatttgataacaaaatcgataacatttggggatttctccacataaaaaattacgatttttaattttttagtgaaaaatatttttactttcgaaattttgagcatgacacaaactttcaatcgaaaaaaaagcgtacatatctggtacagaattttatgtagattattttttcataaaaaactgatccaattttgggattcgttttcgagatagtgatcattttctatttttggtctaaaatttttgatttcgaggcaaaaaaaaattattctgaataaattaagttacatcttattcagaatttttagcttaatttctagctcgaattaaataaaaaatctgaagattcttcaatttttttttaccaaaaacagttttttttctaaactttgtgaaaaaatttttttaattcaaatggatctgacaaatttttttcaatctcaattattttagctttctcttgtacagaattttaagctgttttcaattcaataacaaaatcgataacatttgggggtttctcctcaaaaaaagttatgattttgcatttttcagcgtaaaataattttacttttaaaattttgagcacgatacaaactttcaatccaaaaaaaggtagtatttctagtacagaattttacgctgattattttttcataaaaaacttacataaatttgggattcattttcgagaaaatgatgattttctatttttggccgaaaaattgtaatttcgagacaaaaaaaaaccttttgttctgaataaattaagttatatcttcttcagaattttttgctctttctttttcaatcgaaaagtaatacattttttaattttttcaaagagaaatagtcaaaaaactcactgaattcgttttccttgttgctcacggtgacgttccttcgttttcctcgaaatgtttcgattactacctaaaacaagacacactttttcaattttgcaaaaaaaaataacaaaaaagatacggaaaaacggttaaaatcggcaaaaaacggagagaatccatgccgagcgaaaggcttgaaatttaaacgattgttcgcaatagagcgtgtttgccgccatctagcgactgaaccaccgtg'),
 bytearray(b'tcagttttcacaaaatgtcgtcaattaaaatgcgcgctgtgcagtacgcattcggtgtataaattgtaaac'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'tttgctggttacggtaaaaaagtacgcaaacaccaaacgtgaagtgcagacattgcgttttaccgtacttccgtgttcttttt'),
 bytearray(b'cacggcacggcgaacgggacatggcctagaaagttgcgaaaactagtcccgcggctgcaatgctttatttttttcatttggttgcggtgggcttttcgatgttttttcgtgttttttgaagttttttcgtcgttttttcttgttttcttcgttaataattgaatttaaaataatattttcagtaaaaggccacaaatcgccgcaaaaatcgaccgcgtgagccgcgaaacggcggaaaacgtctaaaagtgagttttttttctaaatatctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttgaaactgcactcaaatatgaagaaaagcatgattaaccagaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaa'),
 bytearray(b'tagaaagatttgagactcaagctcgcgtatttcagcttatttttttcatttggttgcggtgggcttttcgatgttttttcgtgttttttgaagttttttcgtcgttttttcttgttttcttcgttaataattgaatttaaaataatattttcagtaaaaggccacaaatcgccgcaaaaatcgaccgcgtgagccgcgaaacggcggaaaacgtctaaaagtgagttttttttctaaatatctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttgaaactgcactcaaatatgaagaaaagcatgattaaccagaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttattttttttgaaactgcactcaaataagaagaaaagcatgattaaccagaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttgaaactgcactcaaatatgaagaaaagcatgattaaccagaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttcggaattagaaagatttgagactcaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaattgttttctcaaaaatttgacgcttattttttttgaaactgcactcaaataagaagaaaagcatgattaaccagaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaaattgttttctcaaaaatttgacgcttattttttttgaaactgcactcaaatatgaagaaaagcatgattaaccagaaaaagtaacagttgagacccaagctcgcgtatttcatattttttttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaaattgttttctcaaaaatttgacgcttttttttttgaaactgcactcaaatatgaagaaaagcatgattaaccagaaaaagtaacatttgagactcaagctcgcgtatttcattttttttttcgattttagcacaaaatcaacactcttttgaaaaaaatattcgaaatattcgctcctaatttttaatgatttccagatgacaagctggttcacaccacattctactgaggaaatcgcttcaaataaccgaaatcatcccgacattggctccagcagctccgcaactacctacagctcgtcaaattgtttgaatatggatgaaggaattctgacgagagacgttgaaatggctttcagtgatgaaattccgactttttctaaaaccgtaatttttttaaaaatttcaaaaataacattatatgattttgcagaggacctccaattccgtgtttcctcctgcaccttatcgaaattcgttcagt'),
 bytearray(b'ttctttacattattcattcattttatcaacaattcgcacttctatcgctctaaagtcgatcaaaaaagcttatcagcaactgccgtcgagtgaaatgcgatacaatttgtctgtgaaaaaacaaatatcgattttccttgaatatcgtgaagaacaaatcttcatacttacgattattcacaaattcgatgaaaatctgatagttttttccaatttcagctctataattccaaaaaaaaaccttctgttaattttcgcgaaatgtcgtcaattaaaatgcgcgctgtgcagtacgcaacggtgtacgaaactttaaactgagtattcaacgttgagcacgcagtcagccaaattggaatacggtagagaattctcgtccatgtaccccccgccgggccgtg'),
 bytearray(b'gctgatattgacgaattgtcgtcgaataaaatgcgcgtacgcaaagtacgcaatagtgtacaaaacttattcgcgttgaatattcagtcagccaaatgggactactgtagaaatttcttcggccacgt'),
 bytearray(b'cacggtggttcaatcgctagatggaggcaaacacgctctattgcgaacaattgtttaaatttcaagcctttcactcggcatcgattctctccgttttttgccgattttaaccgtttttccgtatcttttttgttatttttttttgtaaaatcgaaaaagtgtgtcttgtttcaggtagtaagcgaaaaaattcgaggaaaacaaaggagcgtcggcgtgggcagcaaggaaaacgaattaagtgagttttttgacgagttctcttaaaaaatcacaaaatattttatttttttgattgaaaaagagagagctaaaaattctgaacaagatacgggccgaattttttagaaatcgtaccttcttcattaatttttttttcgaaactaaaattttgcactgaaaatggaggaaaaatgatttttttcgaaaaaaatcacaaaatgttatatttttattgccgaattagaatcagctaaaaaatctctacaagataaaggcaaacatatacacgaatcgtacatttttcacttaaaattttccaaaagtaaattattttcactgaaaatagtttttaaaaacgttccctttttcaagaaaatcaaaaactctttacgatttatagttgttttatgatcaaaatttaattgtgtataagatggaactcaattcatagagaaatcttaatttttcattaaaattttttcgaaaaaatttttttttgtaataagaatttataaaataattttttttgccaaaaaaatcacaaaatgtgttagttttttgcttcaaagagaaagaactgtttattttaagcaagatacagagagaattttttagaaatcgtacattcttcaagaaaattttttcgaaactaaaattttgcactgaaaatggaggaaaaatgatttttttcgaaaaaaatcacaaaatgttttatttttattgccgaattagaatcagctaaaaattctctacaagataaaggcaaacatatacacaaatcgtacatttttcacttaaaattttccaaaagtaaatttttttcactgaaaattgaggaaaaaatttttttttcagatgcctcctccatcaaatcaatcagcatggtcttcaaattttttaaatgctcggaaacgacgatggaaaaaagatgaagaagacgaaaattcaaatactgaaagaaatgcttccctggacctaaacctgtcgaatgtagaattgacagaagctcttgacagaaacggagatgcgccgatcactcctgagagaagacgagtgtctccatttgtggattttggtgataatctggatgtggagtcgaaacgcaatattgatttgaatctgacaataacacctgaaactgatattgtaagtgaattaatccatgctacaactcggatcctaagacgattataatattttaaaaataattttcccagccgttcgacacacaaccatcaacttcttctattgcggaatcttcttcatcacctccaagaacaccacactcttttgaaagatcgtcaagtccactctattcatcgagtgacagcgtcggcgtattttcgaatgagacaccatatgtgaagggaattagagaagacttgagtagagaacgaatgagattgctagaagttgattccattttggatagcatatcagaggtagatttatttctttgttgttgattgtttattcaattttccatttcagaaccttgacgccatcctgtccagctcaaaccattcggtccagctcaatccaagaacagacattgacgaagagacacttctaaatcggttgatggagagagacgacgagtttgccgttttttctgatgaatttttcatgcaaaggaaagagataatttcaataagaaaaacatcaaaacggaaaaccaacgaaaatctgatattaagaaaacaaatcgctcaaattacgtcaagggcgaaaaagtacagaataatatggatatcagagttgcgaagaaggaatcgttctcaaagccgaaacgttgtcacgcttcccaagtatatcatcgaatggagcaagctcgaaaataagagctctggaaaatctaggatagatttggcactggatttgcttcaacgaatcagtcgagaagaggatattcgtaatttcatgattgatttccagaaatatctccaacaaaatgattcgcagtccttccaagtccaattgacgcattggcaaacgattatttttcaagaaaaatgtagattctctaacaatcaattgcggcgggtgaagcaatactataagatgttcaccgatcttgaaatcatgccaactattaatttgacgatgcaactgaaaacgagaatgtcaactatcgacaattataaggccacaacatatatatcaaaaggagaaaaggtgaccgttgtcaaaattatcgatgtcgagaaaagtgtcattccgaagctggagcgtttgtctgtatcaaaacaattacgccatgattcctataccgatggcaaaattgttatcggaattggtggagattcgggaggaggaacgacgaaactttgtcttctgatcggaaattgtgatcatgcgaactcgccgcaccgaattgtccttctcgctgtttttgatgactctgattcgcgggaacttatcatggcctacctgtctgatcttatcgtgaagatcaacaacttcaccagcatcacctatatggaagatggaagggtggtgacacgtggcgttgtccaaaaagtagtcggtgattttaagtttacatgtgatttactgtcacataaaaaacaatgtgccacctatttttgcccgttttgtttcgaaaccaatccaagaggaggactgatgcaaaacttaaagatctgaacttgcaaaagatatatttcttgagaacaatgaattcttacaagctcaattctaaatacggtagctttggtgtcagatgcggaagtggaccaattcttcaaaatgtcaagttggaacactacttgcctgcaatgctacacttgattgtcggactgttcacgaaatacatctttgagccgatttggatggccgttgtgagtttagacaataaaacatcatttgaaattcgaagaaataaagaagagacaaaaagagttgccgatttgaagattcaagacgcgaacaaaaaattcgaagcttcaccacttaagagaaaaagagagatgaaagcacagtttactgctctgaaagaagaaaaagtgttattggacgagacgctggatggacttgctggtggatatcttaaacaatttgagaatgatctggaagaagttggtgcaacacgccgagcgtggtttcaaatgtacactggagctgattttgtctgagaaagctgattttgtctgagaaaggtgtcacagctgcattcaaaaatctgaaaaaccacatgactccgatgcttctgaatgtcaagaacgcgatgagcaggctgtccaaaatcatgtcattgtcggccaatcgattgctctctgacgatgacatcagcgaattggatgagtcgatgaaggaattcgttgaattcctacaagctgcccacccagaagaatcaatcactcaaaaattgcatgtcctggttgctcacgtagtagaagtcgcaaaaacggaaaggaatttgggaaggctttcggagcaaggaatcgaatcgcttcatgccgttttcaatcgcctcgaaagacgcttccactcggttagaaacacagggaaaagatacctgtacattgctaaggagctgtcatgtagcaatctaatttctgatatggaggaagtaagtggaacctttcaaaaaaacaaatcgtaacattttctttgcaggacgcctcgtcttcccaataaaccacccagcgctctccctcacacaattctgaaccttttcgcaattaaaatttcgggatttcctcaatatcataaaattcgggattttctatggttagttgtgcttaaaattattaaaaaattattaatttcattaaatttcaggtaaaaacattgacaagcagatactcggtgcaaatttgatggatttctcatcaatattttgtcgaggatttcataagcggagatgctccacatggtttctttcaacttggaaaattgtcgatgtgacaccttaggattctatcgaaaagctaaaattcaggatttccttcggtttgttgggattaaaattattcgaaaataattgattttatgaaatttcagattgaaaccttgtcaatgagctactcagcaaaatttcgatggatttatctcaaaaagttcaccaggagtcgaggcaattaagaaatttcaccgggtttccttattttcgaaagttttaccaagaaaaatttcaacttgcatccgtaaagcgaagaaggaggctgattccacatattaaattcgttttttgaatcgatttgtatgtatttttcaattttcaatcttccgtttcgattatttctttgttttactgttcaaaattaatttttctgtgtttcaataattcaattctcaattgttagctactaaattgaataataaaatctattttttatttttttttcaccttgaaactattaattctgccttttttctgctaaaatttgcttcaaaaatctatttgccgctgcaatgttttgcggactacggtacgcaagtacgcaaacaccgcgatgacacattgcggaccatttcgctgcgtacctgcgagatctttctcaaattttacgagagatctagtttttgtgataccgtg'),
 bytearray(b'atgtcgtcaactaaaatgccgcggtacacgtccgcagtcggtgaacaaaacttttcgttgaatactcagtcagccaaatttaactactgtagaaatttctccccacacgtcgcgattgccgctccgtg'),
 bytearray(b'ttgtttaaaataagtttccttttttttgaatacgcaaagaacttgatttttccaaaaaaaaaaattgttttcgaatttttatgataaaaaaaaatttttt'),
 bytearray(b'cacggcacggcgaacgggacatggcctagaaagttgcgaaaactagtcccgcggctgcaatgctttattttttcatttggttgcggtgggtttttcgatgttttttcgtgtttttttaatgttttttcgtcgttttttcttgttttcttcgttaataattgaatttaaaataatattttcagcaaaaggccacaaatcgccgcaaaaatcgaccgcgtgagccgcgaaacggcggaaaacgtctaaaagtgagttgtttttctaaatatctcaaaaatttgacgcttatttttttcgaaaaagctctcaaatatggagaaaaacatgtttgttctgaattagaaagatttgagactcaagctcgcgtatttcaaatttattttttcgattttagcgaaaaatcaacacattttcgatcatttttgaacaaaaaaattgttttctcaaaaatttgacgcttattttttttgaaactgcactcaaatatgaagaaaattttgattaaccggaaaaagtaacatttgagacccaagctcgcgtatttcatatttattttttcgattttagcgaaaaatcaacacattttcgatcattttcgaacaaaaaattcattttctcaaaaattcaacgcttattttttttgaaactgcactcaaatatgaagaaaaacatgcttgttctgaattagtaagaattgcgactcaagctcgcgtatctcatatttatttgttcgatttcagtggaaaatcaacacatttttgggaaaaattttttttcgaaa'),
 bytearray(b'ttctaatttttaatgattttcagatgacacgccggttcacaccacattctactgaggagatcgcttcaaataaccgaaaccatcccgacattggctcca'),
 bytearray(b'ctctatattattcattcattttatcaacaattcgcacttctatcgccctaacgtcgatcaaaaaagctcatcagcaactgccgtcgagtgaaatgcgatagaatttgtctgtgaataaccaaatatcgattttccttgtatatcgtgaagaacaaatcttcatatttacgattcttcacaaattcgatgaaaatctgatagttttttcaatttcagctctataattccaaaaaaaatcttttgtcaatttcgcgaaatgtcgtcaattaaaatgcgcgctgtgcagtacgcaacggtgtacaaaactttaaactgagtattcaacgttgagcacgcagtcagccaaattggaatacggtagagaattctcgtctatgtaccccccgccgggccgtg'),
 bytearray(b'gctgctgcagtgttttggcgactacggtacgctgttacgcaaaccgcgcaatgacaacatt'),
 bytearray(b'attgaacagggcatgaaaggattcaatgccctgctccgatgatcttccc'),
 bytearray(b'cacggcccggcgaaagagacgtggccgcgagagctgcgccggctaggccaccgcctcctatggttaagatttttgaacggataaaaatttttaatttggctgctaagctcatttatcttcgttttttctcgttttttctcatttttatcgataaaaatatattttttgttgcagaaaatcaaaaaaccacgacaaaacagcactcaaccgccaactgggaggaggaaaatccgaaaaaagtgagtttttt'),
 bytearray(b'tgcgaaaaactgtttaaagtatcgattttcttagtaaatatcagcatcataaaattatttaaaattattattttctgtaaattcgataaaaatccatttatttttcacaatttctgcccgaaaattaataaccagcgtttctataactaagaaggtgtcgtcaattaaaatgccgcgtccgcaaaatgtcgtacgaaacttttcgctgagtatcaaacgttgaatattcagtcagccaaattttactacggtagagattttacagccacgtacggttcgccgggccgtg'),
 bytearray(b'gttcgttcagctcaattttgtctactttaattaagttggagtagtttgttctaacttcaaaaacgtgattttcagacgtgcagctcgtcgccacaggctaatcaggaaatcagttcagaagatcgaaactcccaccatcccgacattgcttccagtagctccgcaactacatgcaggtcgtcaaattgtttcaatatggatgaaggaattctgacgagagacgtggaaatggattttagtgacgaaattccgactttttctcacaatgtaattttttttcaatatttcaaaactaatattatatgattttgcagagattctccaatcccgtgtttccaccgacaccttcacgaaactcgttcagtacaccgagggttcgaataatctccaatgttgagcaaattccgcagatcaaaatgctccgactaacgatcgaacgactgaaaaatgaaaaaatgaaatatcagaagaaatacaaaagcggaatggtgagtttgcggtgttttcggaagaaatactaatagtccgccaagaaaatatcactgtaagagcatcgaattcttcgctgcaaatggaagtatgcaatatgcgaacgatcgtcagtggtatagaaggtcgattggtgagaagctgggcagatgtgaagaaaagtggcaaagctatggttctgagtctacaaagacacgccgaagaaattgaaaacctcaaaaaatcagcttttaaagttaaattttcgaatctaagaaacaaaagttgtatcaaaaatcgatttcgcaaagctcttcacttgcttcaacacgaaatctgcctcgaggatgacgtcggacaatttattcgaaaattcacaaaattcctgaattcagaagagaatcaaagctacaaaaacaagctttcaaactttgaggccgttgactttttatcaaaatgcggattatctctaagtcagatggaaaaaatcaaaaactatttgactaattccattggctatgatttgcttccattggtaaagaacacaagagatttgtcaatccagttatcaatgatctccagtttcaaagtttccacttcgttcgacaataaaggaaaagtgattaccattgtgcagtgcatgaaaattgcagaagttttagcctatcgaatagagcttctatgcaattcaaatcaatttgtggacgatggctacacgaaaggagtaatcaagattggagtcgttggtgacgctggaggtggaagcacaaagttggcattggtaatcggaatgtatctcgaccgaattcttcgagacacgttatggtaattgcagtatatgacggatccgacaattactcgtgtctgaaaaaattcattcccgacgttcttgagcagcttggcaagctgacaaaaattcgatatttggacaaaggagttcaaaaaaccgcaaaaattgtgcaaattgcaactggagattgcaagtttcaatttgatattcttggacaccaaggacattcatcccacaatttctgcttcaagtgttttgcccagaatccacggggagctgaagagaggatgaaaatcaaggatatgaatgttgatgaaacattccacccacgaacaatcgatctttacaaagcttgttgtactccacttctgccacacgttgcgatcatgttctatttgattcctcttctgcacattatcatgggtatttttgacaaatatatcttcaatcccctctggaaatattctgtcactttggataacactacttgtttccctatcctgaaaacgcgaaaagcaactctaaaaaacgctgttaacctaatcaaaagtgcggaagaaaagtatcaagcagccaccggaaagatgaaattggagtcgcatgctgaactgaaagcacttcaatcggaaaaattgttgctcgacacaattgtgaatggtactcccggaggaacacttgaaaaaatggaacagtgttgggctaagtttggagcggacaagcaggcttggttccaatcattttgcggaaaccatttgaaattgctgctaacgccggctattgtagaggagactttcaacatttttggcccaaatttatgcccaatgttgctcggattgaaatcagcaatgggaaagctttcaactattatgtcactttcgggaaacaagtttttaaatgattccgacgtcttaatacttcaaaattcgattcgcggatttgtggaggatttgaaagtagcggttcccgaagaaacaattattttaaagctgcacttggtggtctaccatgcaccacaaatggcaaaagatgtgagaaacattggaaggatcacagaaccaggagttgaatctgtccacgcgattttcaatgcacttgagaggagattttgcaattaccgggacaagaaaaggcgttacatccatgttctgagagagctcatgtgtcgtaacatcatgaatgacatgactatggtaatttttgtacagaaaaaaatttctgcattcttaaaaacacaactatttcagaacacgtccattcccggtctttccatcgtaccaaaagatgcaacagttctgccaatttcttcgcaaaatgatcttcgggacccaaaagtagttattcgggacgtcacggctgcccaaaaaagaaaaaatttagcgaaaaaaaaaatcaattttagctccaagaaaaggcttccacaatcgacaaaatctcgaaatgctgtggtgagatttttatttttcacgaaaagtttcaaattttgaacattttcagcccgacttctcacaaaacgtacaaacttctattgcatttggaggcaattcaacgaaaattggattccgtggtctaccgagcaatgctctttctcgtccgaacccgatggtaggttcactgctttaaatcaactcaaaattgaaatcaaaaattatttcaggcaatcacacaaacttgctcgacaagccagccaatcactagaagccatccacttgttgctccaccagtatcttatcaacttccgaaatgcagtaatagtttagctgaagtgagtgtaaaggtgaaatgacaatttcaataagttaaaaattttagaaaattcgagcaagttgtgggcaagcaagaaggagtgctgcagaatcttcttcgactgaaagccacgtggacacaaattcgaagaagaaagtttacagactaaaattcgtccaaaaaagtcgtgaaattccgaagaaatagtaatatatcgattttctgttttttttattatgatttctaatatttttattttaatgcttaatttaaaatgaccgaaaataaagaattgattctcaaaaagtaatctcagagcaatatatgttgtttctttatataatttatccattttatcaacaaatcgcatttttatcgctcaaaaatcgataaaaacagctcatcagaaactttcatcgagtaaaatgagacatcattcgtctgtgaaaagctaaatatcgattttccttgaatatagtgaagaaaagatcttcatacttacgatttttcacaaattcgatgaaaatttgatagttttttttcaatttcagctctataattccgaaaaaaatcttctgataattttcgcgaaatgtcgtcaattaaaatgcgcgctgtgcagtacgcaacggtgtacgaaactttaaactgagtattcaacgttgagcacgcagtcagccaaattggaatacggtagagaattctcgtccatgtaccccccgccgggccgtg'),
 bytearray(b'ttgttcggtggatcgcgtttgcacccatctagcaactgaaccacagtg'),
 bytearray(b'GAAGCCAATGTCGGGATGGTTTCGGTTATTTGAAGCGATTTCCTTAGTAGAATGTGGTGTGAACCGGCGtgccatctggaaatc'),
 bytearray(b'tgccatctggaaatccttaaaaatttggtgcgaatatttcgaaaaaaagttttccaaaaatgtgttgattttccactaaaatcgaaaaaataaatatgaaatacgcgagcttgagtctcaattcttactaattcagaacaagcatttttttctccatattcgagtgcagtttcaaaaaaattaaacgttgaatttttgagaaaataatttttttgttcgaaaatgtgttgattttccactaacataaaatcgaaaaagt'),
 bytearray(b'cacggtggttcagttgctagatgggtgcaaacgcgctccaccgaataa'),
 bytearray(b'gtcttaatacttcaaaattcgattcgcggatttgtggaggatttgaaagtagctgttcccgaagaaacaattattttaaagctgcacttgttgatctaccatgcaccacaaatgacaaaagatctgagaaacattggaaagatcacagaacaaggagttgaatctgtccacgcgattttcaatgcacttgagaggagattttgcaattaccgggacaagaaaagacgttacatccatgttctgagagagctcatgtgtcgtaacatcatgaatggtaattttggtacagaaaaacatttctgcattcttaaaaacacaactatttcagaacacgtccattcccggtctttccatcgtaccaaaatatgcaacagttctgccaatttcttcgcaaaatgatcttcgggacccaaaagcagttatacgggacgtcacggctgcccaaaaaagaaaaaatttagcgaaaaaaaaaaatcaattttcgctccaagaaaaggcttccacaatcgacaaaatctcgaaatgctgtggtgagatttttatttttcacgaaaagttttaaattttgaaaattttcagcccgacttctcacaaaacgtacaaacttctatttcatttggaggcaattcgacgaaaattggattccgtggtctaccgagcaatgctctttctcgtccgaacccgatggtacgttcactgctttaaatccactcaaaattgaaatcaaaaattatttcagccaatcacacaaacttgctcaacaagccagcaaatcactagaagccatccacttgttgctccaccagtatcttatcaacttccgaaatgcagtaatagtttagctgaagtgagtgtaaacgcgaaatgacaatttcaataagttaaaaattttagaaaattcgagcgagttgtgggcaagcaagaaggagtgctgcagaatcttcttcgactcaaagccacgtggacacaaattcgaagaagaaagtttacagactaaaattcgttcaaaaaagtcgtgaaattccgaagaaatagtaatatatcgattttctgtttaaatatttatgatttctaatatttttattttaatgcttcatttaaaatgaccgaaaaataaagaatagattttcaaaaagtaatctcagagcaatatatgttgtttctttatataatttatccattttatcaacaaatcgcatttttatccctcaaaaatcgataaaaacagctca'),
 bytearray(b'ttgttcggtggagcgcgtttgcacccatttagcaactgaaccaccgtg'),
 bytearray(b'actacggtgtgcaagtacgcaaacaccgcggcggcaatttgc'),
 bytearray(b'ttcttcaaaaaaacttcttcgaaattcaaattttgcaccaaaaa'),
 bytearray(b'ttgttcggtggagcgcgtttgcacctatttaacaactgaaccaccgtg'),
 bytearray(b'tattaattgctaaaatttatgtggactacggtagtcaagtccgcaaacaccacg'),
 bytearray(b'cgtggtgtttgcggacttgactaccgtagtccacataaattttagcaattaata'),
 bytearray(b'aaattatacacgtttgttcggtggagcgagtttgcttccatctagcaactgaaccaccgtg'),
 bytearray(b'gtgtgcaacttgccgccgcggtgtttgcgtacttgcacaccgtagt')]

How are repeats related?

Look at the repeat family/class names for the first several repeats in the roundworm database:

In [70]:
from operator import attrgetter

'  '.join(map(attrgetter('rep_cl'), reps[:60]))
Out[70]:
'Simple_repeat  Simple_repeat  Satellite  Simple_repeat  DNA/MULE-MuDR  DNA  DNA  DNA  Simple_repeat  Unknown  Unknown  DNA/PiggyBac?  DNA  DNA  DNA  DNA  DNA  DNA  DNA  DNA/TcMar-Tc1?  DNA/TcMar-Tc1?  DNA  DNA  Simple_repeat  DNA/hAT  DNA/hAT  DNA/MULE-MuDR  DNA/hAT  DNA/TcMar-Tc1?  DNA/TcMar-Tc1?  DNA/TcMar-Tc1?  DNA/hAT  DNA/MULE-MuDR  Simple_repeat  DNA/hAT  Unknown  Unknown  Unknown  DNA  DNA  DNA/CMC-Chapaev  DNA/CMC-Chapaev  DNA/CMC-Chapaev  RC/Helitron  Simple_repeat  DNA  DNA/TcMar-Tc1?  DNA/TcMar-Tc1?  DNA/TcMar-Tc1?  DNA/TcMar-Tc1?  DNA/TcMar-Pogo  Simple_repeat  DNA  Simple_repeat  DNA  DNA  DNA/TcMar-Tc1  DNA/TcMar-Tc1  DNA/hAT  Simple_repeat'

You'll notice a few things. (1) The family names seem to have some hierarchical relationships; e.g. DNA/TcMar-Tc1 seems to be more specific than DNA, (2) some of them end in a question mark, (3) some of them are Unknown. I don't really know what these mean or what to do as a result -- you'll have to navigate that issue. Seems like you can often look up the family names on RepeatMasker's site and find more detailed info (e.g., here are the details for DNA/TcMar-Tc1).

Alternatives to RepeatMasker

Dfam is an alternative. Note that Dfam ultimately relies on Repbase for its "seed alignments." Also, the only the human genome has a pre-built Dfam database, as far as I can tell.