In [1]:
'A'
Out[1]:
'A'
In [2]:
'ACGT'
Out[2]:
'ACGT'
In [3]:
st = 'ACGT'
In [4]:
len(st) # getting the length of a string
Out[4]:
4
In [5]:
'' # empty string (epsilon)
Out[5]:
''
In [6]:
len('')
Out[6]:
0
In [7]:
import random
random.choice('ACGT') # generating a random nucleotide
Out[7]:
'C'
In [8]:
random.choice('ACGT') # repeated invocations might yield different nucleotides
Out[8]:
'C'
In [9]:
random.choice('ACGT') # repeated invocations might yield different nucleotides
Out[9]:
'T'
In [10]:
random.choice('ACGT') # repeated invocations might yield different nucleotides
Out[10]:
'A'
In [11]:
random.choice('ACGT') # repeated invocations might yield different nucleotides
Out[11]:
'G'
In [12]:
# now I'll make a random nucleotide string by concatenating random nucleotides
st = ''.join([random.choice('ACGT') for _ in range(40)])
st
Out[12]:
'GTCACATAATGCTGTAGATTAAGCGAGAAGACCTTAGGTC'
In [13]:
st[1:3] # substring, starting at position 1 and extending up to but not including position 3
# note that the first position is numbered 0
Out[13]:
'TC'
In [14]:
st[0:3] # prefix of length 3
Out[14]:
'GTC'
In [15]:
st[:3] # another way of getting the prefix of length 3
Out[15]:
'GTC'
In [16]:
st[len(st)-3:len(st)] # suffix of length 3
Out[16]:
'GTC'
In [17]:
st[-3:] # another way of getting the suffix of length 3
Out[17]:
'GTC'
In [18]:
st1, st2 = 'CAT', 'ATAC'
In [19]:
st1
Out[19]:
'CAT'
In [20]:
st2
Out[20]:
'ATAC'
In [21]:
st1 + st2 # concatenation of 2 strings
Out[21]:
'CATATAC'